miRTarBase - #MIRT456108


—
pre-miRNA Information
pre-miRNA hsa-mir-4667   
Genomic Coordinates chr9: 35608094 - 35608159
Description Homo sapiens miR-4667 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4667-3p
Sequence 46| UCCCUCCUUCUGUCCCCACAG |66
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM9588049 20 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs774051936 3 dbSNP
rs1178819936 5 dbSNP
rs1467653371 6 dbSNP
rs770405488 6 dbSNP
rs776175657 7 dbSNP
rs370758546 11 dbSNP
rs1341648855 13 dbSNP
rs1023852947 14 dbSNP
rs374809971 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol VAV3   
Synonyms -
Description vav guanine nucleotide exchange factor 3
Transcript NM_001079874   
Other Transcripts NM_006113   
Expression
Putative miRNA Targets on VAV3
3'UTR of VAV3
(miRNA target sites are highlighted)		 
>VAV3|NM_001079874|3'UTR
   1 ATTCAAATCCCGTGTTGCACCCTGCACCAAAAATTTCAGAGAAGGGATAAATAGAAGCCTGCACAGCATCGTGAATTAAC
  81 TGAAGTGTTTAAAAAGCTGCATTTCTGGCTGTTCAACATCCTCCCTCCTTAGCCCCTCCTAAGTCTTAATGCTGAGATTT
 161 CTAAAGATGCTGGTACTGACAGATTAATGGCTTGCCTAGAGCTGTGCAAGAAACAGCCTGCCAGTCTGTCATTGTCAGGG
 241 ACCAGGGCAAAACCAAGAGCTGTTCTTCCCAGAAGAGCCCTGCAAACACATTGGTTCGTGCTTCCCTTTACTTCTTCTGG
 321 TCAGATACCATGAATGCCAGTCATCAGTAAATCTTAATACACTTTTGCTTTATTCTCACATGCCATTCACCAGATTATTT
 401 GATGGTACAAAGAAGCAGAAGTGTAATTTTCCTTTTCCCAGCATGACGAAAAATTGGAGTTCTGCCATTTGAGCAGCTTA
 481 CTGGAAAGATCCAGCCTTACTTGTCTTAAATTGTCCAACAAGGTGACTCATTGCCCGGCAAACACTTTTACCCTCAGATG
 561 TTACTCATGATATTATAAAATATGAGGCCAGTGCTCAGGTTTGCATCATAAGTGAGCTATCCCTGAAGGGTTTTAATTAC
 641 TTATTTGGTGTCCTGATTATATTTGCAAACTTCTTTATAAAAGGTGAAAAAAGCACACAAAAGAGAGGGTGTCTTCATAT
 721 TAAACCTTCACAACCTTCATGATTTCATAGGATTATTTTGGAAATATAGCACTTGACTTTATGAAAGGATCTGGGCTAGG
 801 TATATTAAGGGTAGTTGCCAATAACCTGAAGAAGCTGGCATTGTTTACAGAAACAGATCAAGGGCTATAATTTATGTCAT
 881 TTTATAGCAGCAGTATCTATTAATACATGCCTTTTCCTCCCATCCACCTCCCCCGCACACACACAAAGATGACCTGGGAC
 961 ATGATTTTTTTATTCCCACATTTTCTTGGAGCACAAACAACTTTGTTGAGGATTTTGGAAGGAAAGCACAACTGGGTCCT
1041 TTATTCATTTCTGGGACAGAAAGAGGGTCAGTGGACTTTTGTGGGCCTCCAGCTTCTCTCAGAGTCTCCCCCTCTGCAGC
1121 CCATCCTGGGAGTGTATTAACTGGAGGGAAGATGGGTCTTGCAGTACATTTGTTTTGCCCAGCCATCACTCTTTTTTGTG
1201 AGGAGCCTAAATACATTCTTCCTGGGGTCCAGAGTCCCCATTCAAGGCAGTCAAGTTAAGACACTAACTTGGCCCTTTCC
1281 TGATGGAAATATTTCCTCCATAGCAGAAGTTGTGTTCTGACAAGACTGAGAGAGTTACATGTTGGGAAAAAAAAGAAGCA
1361 TTAACTTAGTAGAACTGAACCAGGAGCATTAAGTTCTGAAATTTTGAATCATCTCTGAAATGAAGCAGGTGTAGCCTGCC
1441 CTCTCATCAATCCGTCTGGGTGCCAGAACTCAAGGTTCAGTGGACACATCCCCCTGTTAGAGACCCTCATGGGCTAGGAC
1521 TTTTCATCTAGGATAGATTCAAGACCTTTACCTCAGAATTATGTAAACTGTGATTGTGTTTTAGAAAAATTATTATTTGC
1601 TAAAACCATTTAAGTCTTTGTATATGTGTAAATGATCACAAAAATGTATTTTATAAAATGTTCTGTACAATAAAGTTACA
1681 CCTCAAAGTGTACTCTTGGAATGGATTCTTTCCTGTAAAGTCTTATCTGCGACTCTGTCTCGGGAATGTTTTGTCTGTTG
1761 CCGTCAGCCGAACTTTGTTATGGAGGGAGCAGCCTCACACAAGCAGAAACACTCCTGTGGATGGTATTGTAGCATGTATT
1841 GTTTATTTTAGTCAATAGACCCTCTCCTTATAAATGGTGTTTAGTCTTCCTGTTGCATTTCATGGGCCTGGGGGTTTCCT
1921 AGCAGAGGATATTGGAGCCCCTTTTTGTGACATTACCAATTACATCTTTGTCCACGTTTAATACTTTGTTTTGGAAAATT
2001 TAAATGCTGCAGATTTGTGTAGAGTTCTAATACCAAAGACAGAAGTAAATGTTTTCCATATACTTTGTCTTGCCTGTATG
2081 CAGCCCTCGTGTAATACGGTGAATTAGAGTGGTATTTCACTTTGTATTATTTTGTAAATATGTCAATATAATAAATAGTG
2161 ACTAAATTGATAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacacCCCUGUCUUCCUCCCu 5'
               ||||||||| ||||| 
Target 5' tttctGGGACAGAAAGAGGGt 3'
 1048 - 1068 148.00 -24.90
2 
miRNA  3' gacaccccUGUCUUC-CUCCCu 5'
                  ||| ||| ||||| 
Target 5' aaaagcacACAAAAGAGAGGGt 3'
 689 - 710 125.00 -12.20
3 
miRNA  3' gacaccccugucuuCCUCCCu 5'
                        |||||| 
Target 5' ggagtgtattaactGGAGGGa 3'
 1129 - 1149 120.00 -14.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31502367 4 COSMIC
COSN31586685 9 COSMIC
COSN30190063 11 COSMIC
COSN30157171 14 COSMIC
COSN30530097 39 COSMIC
COSN30467196 41 COSMIC
COSN28890895 48 COSMIC
COSN31497903 59 COSMIC
COSN30496500 66 COSMIC
COSN16130371 71 COSMIC
COSN30121012 73 COSMIC
COSN30145613 97 COSMIC
COSN5997710 200 COSMIC
COSN31604784 201 COSMIC
COSN31558367 297 COSMIC
COSN22830101 306 COSMIC
COSN30110134 312 COSMIC
COSN14630292 412 COSMIC
COSN27551202 423 COSMIC
COSN26816061 430 COSMIC
COSN30159407 534 COSMIC
COSN21079365 649 COSMIC
COSN30159411 661 COSMIC
COSN31542772 909 COSMIC
COSN1400222 998 COSMIC
COSN15787954 1128 COSMIC
COSN17690417 1347 COSMIC
COSN26549757 1448 COSMIC
COSN30159373 1456 COSMIC
COSN28453565 1533 COSMIC
COSN31529579 1543 COSMIC
COSN31608378 1590 COSMIC
COSN1400221 1608 COSMIC
COSN19490088 1639 COSMIC
COSN17181578 1730 COSMIC
COSN5196995 1743 COSMIC
COSN1400220 1858 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs899446923 2 dbSNP
rs764955911 7 dbSNP
rs1313247484 9 dbSNP
rs759402727 10 dbSNP
rs776619927 11 dbSNP
rs542122942 12 dbSNP
rs746574187 17 dbSNP
rs772705792 18 dbSNP
rs771713648 25 dbSNP
rs747774059 28 dbSNP
rs1368650134 38 dbSNP
rs1192974517 39 dbSNP
rs779276047 40 dbSNP
rs755398431 41 dbSNP
rs749808685 43 dbSNP
rs1490210379 44 dbSNP
rs780763388 48 dbSNP
rs375285827 49 dbSNP
rs373579542 50 dbSNP
rs377617538 58 dbSNP
rs1057441540 61 dbSNP
rs938783918 62 dbSNP
rs1011986853 64 dbSNP
rs927349946 67 dbSNP
rs752422079 70 dbSNP
rs767367610 71 dbSNP
rs62618754 82 dbSNP
rs1430286210 87 dbSNP
rs1333171129 91 dbSNP
rs535993365 96 dbSNP
rs182104204 105 dbSNP
rs112965883 110 dbSNP
rs989420542 114 dbSNP
rs112107766 115 dbSNP
rs1024102601 121 dbSNP
rs754798816 123 dbSNP
rs1459449943 125 dbSNP
rs546353195 149 dbSNP
rs956791059 151 dbSNP
rs1248147881 162 dbSNP
rs1480462582 167 dbSNP
rs143546591 173 dbSNP
rs17019458 185 dbSNP
rs1334557922 194 dbSNP
rs1473540188 198 dbSNP
rs1240388647 204 dbSNP
rs1406976053 209 dbSNP
rs1192088612 220 dbSNP
rs886186908 231 dbSNP
rs1451421854 239 dbSNP
rs1405589169 258 dbSNP
rs1302654247 261 dbSNP
rs189767773 262 dbSNP
rs745658316 269 dbSNP
rs1288616864 276 dbSNP
rs1210073527 279 dbSNP
rs1048831852 287 dbSNP
rs1280709403 294 dbSNP
rs188091969 298 dbSNP
rs1258507678 307 dbSNP
rs954488718 313 dbSNP
rs1490419039 314 dbSNP
rs1221018719 317 dbSNP
rs532627404 321 dbSNP
rs574887881 324 dbSNP
rs1266156824 331 dbSNP
rs1377622751 334 dbSNP
rs1483789612 340 dbSNP
rs1182424415 342 dbSNP
rs1363203875 345 dbSNP
rs1468380072 356 dbSNP
rs1164812896 361 dbSNP
rs1028679964 362 dbSNP
rs1311406281 375 dbSNP
rs1438391539 377 dbSNP
rs1330306396 387 dbSNP
rs1324383306 390 dbSNP
rs1411806851 402 dbSNP
rs1040335383 422 dbSNP
rs554999439 431 dbSNP
rs942978542 436 dbSNP
rs1335722623 438 dbSNP
rs1440413224 439 dbSNP
rs538183134 444 dbSNP
rs899350615 445 dbSNP
rs946234154 447 dbSNP
rs569111481 448 dbSNP
rs1343654559 450 dbSNP
rs552120373 456 dbSNP
rs774325091 471 dbSNP
rs1189292345 474 dbSNP
rs957581465 475 dbSNP
rs748820963 477 dbSNP
rs1057163885 480 dbSNP
rs770880777 480 dbSNP
rs1183207538 489 dbSNP
rs1383667099 494 dbSNP
rs368091734 495 dbSNP
rs927256591 498 dbSNP
rs1396337585 500 dbSNP
rs1408721878 510 dbSNP
rs971292158 512 dbSNP
rs1383973641 518 dbSNP
rs1452432835 522 dbSNP
rs1024218504 524 dbSNP
rs3187207 536 dbSNP
rs755527195 537 dbSNP
rs1337288201 539 dbSNP
rs1202100293 540 dbSNP
rs1263738274 546 dbSNP
rs947418853 551 dbSNP
rs886303044 558 dbSNP
rs1241473648 563 dbSNP
rs1027799875 567 dbSNP
rs1287991296 570 dbSNP
rs994616687 572 dbSNP
rs900137130 589 dbSNP
rs1474501789 606 dbSNP
rs1179182908 607 dbSNP
rs1344018968 611 dbSNP
rs915081911 628 dbSNP
rs989716544 644 dbSNP
rs17236113 646 dbSNP
rs1386170633 647 dbSNP
rs1438847157 664 dbSNP
rs923840301 666 dbSNP
rs1386601845 669 dbSNP
rs561891598 682 dbSNP
rs78755947 687 dbSNP
rs140026517 693 dbSNP
rs891381167 693 dbSNP
rs1297853088 694 dbSNP
rs146083978 698 dbSNP
rs954394274 703 dbSNP
rs1234842149 704 dbSNP
rs1283812866 704 dbSNP
rs1322761593 705 dbSNP
rs1051377644 708 dbSNP
rs1400613658 708 dbSNP
rs1362549407 709 dbSNP
rs1028585134 717 dbSNP
rs1269790261 718 dbSNP
rs1486110578 722 dbSNP
rs1205933131 725 dbSNP
rs766838325 731 dbSNP
rs963097724 735 dbSNP
rs1016468527 739 dbSNP
rs1005449693 742 dbSNP
rs1426276307 743 dbSNP
rs1430546531 748 dbSNP
rs550153997 752 dbSNP
rs936110112 758 dbSNP
rs1365908239 762 dbSNP
rs758971235 767 dbSNP
rs980126740 769 dbSNP
rs1406196000 776 dbSNP
rs1420977816 780 dbSNP
rs373675100 787 dbSNP
rs2769668 808 dbSNP
rs1044378034 810 dbSNP
rs947491284 813 dbSNP
rs563214531 818 dbSNP
rs1317273321 821 dbSNP
rs1053654190 824 dbSNP
rs1485027172 826 dbSNP
rs1224736003 827 dbSNP
rs546154570 835 dbSNP
rs3187208 842 dbSNP
rs528500620 843 dbSNP
rs1490225090 848 dbSNP
rs1197876290 850 dbSNP
rs1253342668 854 dbSNP
rs1207931766 856 dbSNP
rs1420015641 856 dbSNP
rs950532634 857 dbSNP
rs923772107 859 dbSNP
rs1441817268 861 dbSNP
rs987359773 862 dbSNP
rs1027501550 863 dbSNP
rs765520249 867 dbSNP
rs17019453 869 dbSNP
rs921645000 877 dbSNP
rs1315843135 879 dbSNP
rs1402617184 893 dbSNP
rs974374964 899 dbSNP
rs373735946 918 dbSNP
rs563642212 918 dbSNP
rs1390553724 922 dbSNP
rs1304612408 925 dbSNP
rs963190594 928 dbSNP
rs1248436241 930 dbSNP
rs1292852902 931 dbSNP
rs890153607 934 dbSNP
rs536707914 935 dbSNP
rs753959740 937 dbSNP
rs1481254697 946 dbSNP
rs1176918973 947 dbSNP
rs1248856445 948 dbSNP
rs1446882752 950 dbSNP
rs1051328282 965 dbSNP
rs1282542428 989 dbSNP
rs1016410770 991 dbSNP
rs1354977703 992 dbSNP
rs891926535 993 dbSNP
rs1054634502 996 dbSNP
rs1384704360 998 dbSNP
rs983199526 1004 dbSNP
rs1315957874 1005 dbSNP
rs570780511 1010 dbSNP
rs1226626878 1016 dbSNP
rs552512219 1019 dbSNP
rs1447921069 1030 dbSNP
rs1360204420 1033 dbSNP
rs191620266 1035 dbSNP
rs1204427813 1038 dbSNP
rs1256770005 1040 dbSNP
rs927395397 1044 dbSNP
rs1204749985 1047 dbSNP
rs368492930 1052 dbSNP
rs1400050101 1054 dbSNP
rs149593145 1055 dbSNP
rs1477983792 1063 dbSNP
rs906111612 1068 dbSNP
rs567106872 1071 dbSNP
rs544578714 1078 dbSNP
rs983303718 1081 dbSNP
rs1425120002 1091 dbSNP
rs1168204884 1106 dbSNP
rs867675651 1108 dbSNP
rs1179555534 1113 dbSNP
rs1472194144 1117 dbSNP
rs1405538799 1123 dbSNP
rs374545999 1132 dbSNP
rs1011569932 1136 dbSNP
rs1446089042 1141 dbSNP
rs575511762 1148 dbSNP
rs548896793 1151 dbSNP
rs920383379 1157 dbSNP
rs558834322 1161 dbSNP
rs1326313206 1167 dbSNP
rs1224446969 1169 dbSNP
rs1262910188 1169 dbSNP
rs934732587 1177 dbSNP
rs902350114 1183 dbSNP
rs1242384609 1187 dbSNP
rs538509454 1191 dbSNP
rs139351899 1197 dbSNP
rs747889462 1198 dbSNP
rs1175706196 1206 dbSNP
rs1426927802 1214 dbSNP
rs1020643676 1221 dbSNP
rs1010454691 1224 dbSNP
rs892047097 1225 dbSNP
rs1430053202 1231 dbSNP
rs1296439391 1234 dbSNP
rs1199471683 1240 dbSNP
rs1320336264 1243 dbSNP
rs1310875756 1254 dbSNP
rs543609836 1261 dbSNP
rs1379990359 1262 dbSNP
rs1343280396 1268 dbSNP
rs1225873160 1271 dbSNP
rs1286416497 1274 dbSNP
rs1284470960 1275 dbSNP
rs933276532 1279 dbSNP
rs552738260 1289 dbSNP
rs1376626363 1296 dbSNP
rs921840358 1298 dbSNP
rs1467528616 1300 dbSNP
rs1044436615 1306 dbSNP
rs1244952400 1312 dbSNP
rs974406135 1320 dbSNP
rs1158958727 1321 dbSNP
rs941710763 1328 dbSNP
rs1129409 1329 dbSNP
rs1408916883 1330 dbSNP
rs1802379 1331 dbSNP
rs535985544 1332 dbSNP
rs370668561 1338 dbSNP
rs1404179662 1340 dbSNP
rs908850743 1346 dbSNP
rs768422800 1347 dbSNP
rs983614699 1350 dbSNP
rs1157152392 1352 dbSNP
rs1367513776 1355 dbSNP
rs1405674672 1355 dbSNP
rs917213841 1355 dbSNP
rs950458991 1359 dbSNP
rs1035899707 1360 dbSNP
rs1444752002 1371 dbSNP
rs1280516317 1377 dbSNP
rs1372074901 1380 dbSNP
rs1413963112 1381 dbSNP
rs1237491083 1388 dbSNP
rs761872931 1393 dbSNP
rs1293556920 1403 dbSNP
rs530360002 1406 dbSNP
rs56410431 1411 dbSNP
rs1221133339 1414 dbSNP
rs970325658 1421 dbSNP
rs1047722427 1427 dbSNP
rs1437791232 1428 dbSNP
rs1023203867 1436 dbSNP
rs1011806255 1439 dbSNP
rs563299706 1446 dbSNP
rs1437652997 1449 dbSNP
rs1176976128 1451 dbSNP
rs919809531 1452 dbSNP
rs893138574 1453 dbSNP
rs74111051 1454 dbSNP
rs1263836035 1460 dbSNP
rs1425335701 1463 dbSNP
rs781683950 1475 dbSNP
rs1162762264 1484 dbSNP
rs550229468 1488 dbSNP
rs973754898 1490 dbSNP
rs999345492 1500 dbSNP
rs759493161 1504 dbSNP
rs1330217154 1505 dbSNP
rs1354291460 1513 dbSNP
rs891205375 1514 dbSNP
rs1051577275 1517 dbSNP
rs997287286 1521 dbSNP
rs1292203844 1527 dbSNP
rs900322065 1528 dbSNP
rs1238575081 1529 dbSNP
rs530552622 1531 dbSNP
rs1196288767 1533 dbSNP
rs954448915 1537 dbSNP
rs1020758011 1546 dbSNP
rs571112299 1547 dbSNP
rs1245143859 1551 dbSNP
rs1038941537 1552 dbSNP
rs987800478 1558 dbSNP
rs941924291 1578 dbSNP
rs1366791935 1590 dbSNP
rs1476461272 1598 dbSNP
rs769181464 1601 dbSNP
rs1168970016 1607 dbSNP
rs17236120 1609 dbSNP
rs1464347463 1611 dbSNP
rs1365939793 1613 dbSNP
rs1406275866 1614 dbSNP
rs1395089871 1620 dbSNP
rs1047388701 1622 dbSNP
rs1327651610 1628 dbSNP
rs1227567302 1629 dbSNP
rs1435397170 1632 dbSNP
rs1316011880 1634 dbSNP
rs1225057997 1635 dbSNP
rs1263531094 1639 dbSNP
rs929080545 1646 dbSNP
rs1164985019 1648 dbSNP
rs928355612 1665 dbSNP
rs1417347940 1668 dbSNP
rs1033247611 1669 dbSNP
rs1254384215 1676 dbSNP
rs981629755 1682 dbSNP
rs1448770518 1687 dbSNP
rs1379572106 1694 dbSNP
rs1194021377 1696 dbSNP
rs532687105 1698 dbSNP
rs1477132505 1704 dbSNP
rs1441255521 1706 dbSNP
rs1265082211 1711 dbSNP
rs906003413 1717 dbSNP
rs916051162 1720 dbSNP
rs780657392 1723 dbSNP
rs1014252925 1726 dbSNP
rs115069908 1730 dbSNP
rs376103235 1737 dbSNP
rs770804893 1738 dbSNP
rs957603106 1741 dbSNP
rs1032126686 1742 dbSNP
rs998856787 1745 dbSNP
rs749127768 1746 dbSNP
rs1406691573 1748 dbSNP
rs1283912908 1753 dbSNP
rs150886240 1762 dbSNP
rs777266713 1763 dbSNP
rs530251979 1769 dbSNP
rs376782453 1770 dbSNP
rs542013070 1775 dbSNP
rs910352499 1777 dbSNP
rs1487384683 1793 dbSNP
rs1202204168 1797 dbSNP
rs1270281050 1798 dbSNP
rs1432921843 1804 dbSNP
rs181718082 1812 dbSNP
rs758949728 1813 dbSNP
rs987301431 1814 dbSNP
rs1453998469 1834 dbSNP
rs558637805 1836 dbSNP
rs1038804274 1838 dbSNP
rs964515486 1843 dbSNP
rs1426053855 1849 dbSNP
rs1303645747 1855 dbSNP
rs1366850268 1857 dbSNP
rs988322999 1858 dbSNP
rs1308890915 1860 dbSNP
rs1336201545 1864 dbSNP
rs1241138883 1875 dbSNP
rs1006591258 1877 dbSNP
rs190950060 1880 dbSNP
rs957705633 1883 dbSNP
rs887693081 1884 dbSNP
rs1298723189 1892 dbSNP
rs1032438723 1902 dbSNP
rs747605006 1904 dbSNP
rs1293072349 1912 dbSNP
rs1488446515 1919 dbSNP
rs1189772998 1920 dbSNP
rs745880260 1924 dbSNP
rs780738472 1927 dbSNP
rs1177599996 1929 dbSNP
rs970717612 1934 dbSNP
rs1023211549 1939 dbSNP
rs1349165479 1940 dbSNP
rs1456327538 1941 dbSNP
rs1299877273 1948 dbSNP
rs1396921642 1951 dbSNP
rs141569623 1955 dbSNP
rs572795705 1959 dbSNP
rs896014040 1962 dbSNP
rs1374978389 1964 dbSNP
rs552773395 1972 dbSNP
rs1313534567 1973 dbSNP
rs139302493 1975 dbSNP
rs1458464976 1976 dbSNP
rs994006723 1978 dbSNP
rs567097555 1981 dbSNP
rs899136499 1983 dbSNP
rs1482590224 1985 dbSNP
rs916082227 1989 dbSNP
rs990329599 1992 dbSNP
rs1421600166 2000 dbSNP
rs1376031830 2004 dbSNP
rs1314315099 2010 dbSNP
rs1284743336 2011 dbSNP
rs957888776 2013 dbSNP
rs889029854 2014 dbSNP
rs1398293157 2019 dbSNP
rs750890540 2046 dbSNP
rs879458292 2051 dbSNP
rs1303699545 2053 dbSNP
rs147326269 2054 dbSNP
rs544350115 2058 dbSNP
rs779421069 2059 dbSNP
rs1298308415 2063 dbSNP
rs1319231742 2067 dbSNP
rs1218335995 2069 dbSNP
rs1383831641 2070 dbSNP
rs8676 2088 dbSNP
rs1029585429 2089 dbSNP
rs571262744 2094 dbSNP
rs996890816 2096 dbSNP
rs8458 2097 dbSNP
rs1408097988 2102 dbSNP
rs1187784358 2108 dbSNP
rs1017889783 2113 dbSNP
rs924934096 2115 dbSNP
rs1424397322 2121 dbSNP
rs532870032 2123 dbSNP
rs1431137212 2132 dbSNP
rs1195355110 2134 dbSNP
rs1470169198 2141 dbSNP
rs1006039851 2146 dbSNP
rs3790681 2148 dbSNP
rs1445839002 2150 dbSNP
rs1290717101 2158 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacaccccuGUCUUCCUCCCu 5'
                   :|| ||||||| 
Target 5' --------cUAGUAGGAGGGc 3'
 		1 - 13
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166 , TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293/HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells) HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells) ...

- Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology.

Article - Kishore S; Gruber AR; Jedlinski DJ; Syed et al.
- Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177602. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_4 PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11 PAR-CLIP data was present in ERX177610. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_12 PAR-CLIP data was present in ERX177614. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_4 PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8 PAR-CLIP data was present in ERX177622. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_12 PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11 PAR-CLIP data was present in ERX177634. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_12 PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8 PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5 PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7 PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10 PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10 PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7 PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8 PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10 PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1 PAR-CLIP data was present in ERX177607. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_9 PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5 PAR-CLIP data was present in ERX177619. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_9 PAR-CLIP data was present in ERX177631. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_9 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760618. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3_B PAR-CLIP data was present in SRX1760631. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_B PAR-CLIP data was present in SRX1760620. RNA binding protein: AGO2. Condition:AGO-CLIP-LAPC4_A PAR-CLIP data was present in SRX1760628. RNA binding protein: AGO2. Condition:AGO-CLIP-LAPC4_B PAR-CLIP data was present in SRX1760638. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3-miR148 PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset Chi_ControlB_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control B
Location of target site ENST00000370056.4 | 3UTR | CUAGUAGGAGGGCCGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1067869
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (asynchronous cells)
Location of target site ENST00000370056.4 | 3UTR | UAGUAGGAGGGCCGCUGCGGUGAGUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1067870
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (mitotic cells)
Location of target site ENST00000370056.4 | 3UTR | CUAGUAGGAGGGCCGCUGCGGUGAGUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000370056.4 | 3UTR | GUAGGAGGGCCGCUGCGGUGAGUCUUGAAGCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000370056.4 | 3UTR | UAGGAGGGCCGCUGCGGUGAGUCUUGAAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000370056.4 | 3UTR | AGUAGGAGGGCCGCUGCGGUGAGUCUUGAAGCCCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000370056.4 | 3UTR | AGUAGGAGGGCCGCUGCGGUGAGUCUUGAAGCCCAGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000370056.4 | 3UTR | AGUAGGAGGGCCGCUGCGGUGAGUCUUGAAGCCCAGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000370056.4 | 3UTR | CUAGUAGGAGGGCCGCUGCGGUGAGUCUUGAAGCCCAGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
236 hsa-miR-4667-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT256051 UBE2K ubiquitin conjugating enzyme E2 K 2 4
MIRT306046 SKIL SKI like proto-oncogene 2 10
MIRT348290 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT380488 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT441955 MAGEB10 MAGE family member B10 2 6
MIRT447735 MOCOS molybdenum cofactor sulfurase 2 2
MIRT449260 PALM2 paralemmin 2 2 4
MIRT456108 VAV3 vav guanine nucleotide exchange factor 3 2 8
MIRT471140 PHF19 PHD finger protein 19 2 4
MIRT486256 BCORL1 BCL6 corepressor like 1 2 2
MIRT489562 PLD6 phospholipase D family member 6 2 2
MIRT489898 PPIC peptidylprolyl isomerase C 2 4
MIRT497434 SEC63 SEC63 homolog, protein translocation regulator 2 4
MIRT499611 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT506401 NSD1 nuclear receptor binding SET domain protein 1 2 8
MIRT513021 NSFL1C NSFL1 cofactor 2 6
MIRT513044 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT526173 ANKRD65 ankyrin repeat domain 65 2 2
MIRT527820 TMEM74B transmembrane protein 74B 2 2
MIRT528177 C6orf47 chromosome 6 open reading frame 47 2 2
MIRT530306 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT531943 AACS acetoacetyl-CoA synthetase 2 2
MIRT531987 SLCO1B3 solute carrier organic anion transporter family member 1B3 2 2
MIRT534821 RAB30 RAB30, member RAS oncogene family 2 2
MIRT536153 MAP4K5 mitogen-activated protein kinase kinase kinase kinase 5 2 2
MIRT540297 TMA16 translation machinery associated 16 homolog 2 2
MIRT543485 RXRA retinoid X receptor alpha 2 2
MIRT547506 MAZ MYC associated zinc finger protein 2 2
MIRT569289 SLC35C2 solute carrier family 35 member C2 2 2
MIRT572754 FAM204A family with sequence similarity 204 member A 2 2
MIRT575266 Timp3 tissue inhibitor of metalloproteinase 3 2 2
MIRT609477 LSAMP limbic system-associated membrane protein 2 2
MIRT610265 LRRC47 leucine rich repeat containing 47 2 2
MIRT610350 AGTRAP angiotensin II receptor associated protein 2 2
MIRT610396 FOXE1 forkhead box E1 2 2
MIRT610492 GPC4 glypican 4 2 4
MIRT612511 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT612760 MYOCD myocardin 2 2
MIRT613414 CDH8 cadherin 8 2 2
MIRT613703 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT613814 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT614170 MYO1F myosin IF 2 2
MIRT614214 LENG9 leukocyte receptor cluster member 9 2 2
MIRT614225 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT614497 RHOB ras homolog family member B 2 2
MIRT614986 GIPC1 GIPC PDZ domain containing family member 1 2 2
MIRT615222 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT615326 ERN1 endoplasmic reticulum to nucleus signaling 1 2 2
MIRT615494 SHB SH2 domain containing adaptor protein B 2 2
MIRT615506 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT615536 PHF1 PHD finger protein 1 2 2
MIRT615550 TNFSF15 TNF superfamily member 15 2 2
MIRT615954 SORD sorbitol dehydrogenase 2 2
MIRT616478 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT616667 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT616742 DCTN5 dynactin subunit 5 2 2
MIRT616760 SVOP SV2 related protein 2 2
MIRT616913 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT617645 RAB43 RAB43, member RAS oncogene family 2 2
MIRT617822 EMX2 empty spiracles homeobox 2 2 2
MIRT618468 GPR55 G protein-coupled receptor 55 2 2
MIRT618517 SELPLG selectin P ligand 2 2
MIRT618687 DVL1 dishevelled segment polarity protein 1 2 2
MIRT619464 XRCC2 X-ray repair cross complementing 2 2 2
MIRT619560 GABRG2 gamma-aminobutyric acid type A receptor gamma2 subunit 2 2
MIRT620004 C1orf64 steroid receptor associated and regulated protein 2 2
MIRT620210 VN1R1 vomeronasal 1 receptor 1 2 2
MIRT620446 SEMA3E semaphorin 3E 2 2
MIRT621297 SLC35B1 solute carrier family 35 member B1 2 2
MIRT621765 TNFAIP3 TNF alpha induced protein 3 2 2
MIRT621812 TMEM170B transmembrane protein 170B 2 2
MIRT622171 SMYD1 SET and MYND domain containing 1 2 2
MIRT622202 SLC5A12 solute carrier family 5 member 12 2 2
MIRT622295 SH3BP5L SH3 binding domain protein 5 like 2 2
MIRT622718 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT622893 PDCL phosducin like 2 2
MIRT623215 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT623230 MON1B MON1 homolog B, secretory trafficking associated 2 2
MIRT623548 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT623557 JPH3 junctophilin 3 2 2
MIRT623669 HRK harakiri, BCL2 interacting protein 2 2
MIRT623730 GTDC1 glycosyltransferase like domain containing 1 2 4
MIRT623742 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 2
MIRT623906 FOXK2 forkhead box K2 2 2
MIRT624181 DERL2 derlin 2 2 2
MIRT625758 GPC5 glypican 5 2 2
MIRT625975 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT626300 KCNK12 potassium two pore domain channel subfamily K member 12 2 2
MIRT626779 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 2
MIRT627034 TMEM109 transmembrane protein 109 2 4
MIRT627109 PDRG1 p53 and DNA damage regulated 1 2 2
MIRT627405 TMEM170A transmembrane protein 170A 2 2
MIRT628390 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT628428 ARRB1 arrestin beta 1 2 2
MIRT629824 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT630870 UBXN11 UBX domain protein 11 2 2
MIRT630968 KIAA2022 neurite extension and migration factor 2 2
MIRT631588 ITGAL integrin subunit alpha L 2 2
MIRT633209 WFDC6 WAP four-disulfide core domain 6 2 2
MIRT635310 FAM179A TOG array regulator of axonemal microtubules 2 2 2
MIRT637062 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 2 2
MIRT637116 KLHL21 kelch like family member 21 2 2
MIRT637635 ZNF431 zinc finger protein 431 2 2
MIRT638390 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT639178 CEP70 centrosomal protein 70 2 2
MIRT639777 GPR45 G protein-coupled receptor 45 2 2
MIRT639885 STC1 stanniocalcin 1 2 2
MIRT640003 PHF21B PHD finger protein 21B 2 2
MIRT640640 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT640824 GPR107 G protein-coupled receptor 107 2 2
MIRT641253 CENPN centromere protein N 2 2
MIRT641434 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT641746 MACROD2 MACRO domain containing 2 2 2
MIRT641869 STOML1 stomatin like 1 2 2
MIRT641890 SND1 staphylococcal nuclease and tudor domain containing 1 2 2
MIRT642356 C19orf40 Fanconi anemia core complex associated protein 24 1 1
MIRT644007 PPP1R3G protein phosphatase 1 regulatory subunit 3G 2 2
MIRT644301 ZSCAN29 zinc finger and SCAN domain containing 29 2 2
MIRT645706 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT645752 FAM213A family with sequence similarity 213 member A 2 2
MIRT646123 SLC26A9 solute carrier family 26 member 9 2 2
MIRT646397 SLC22A6 solute carrier family 22 member 6 2 2
MIRT646490 APBB3 amyloid beta precursor protein binding family B member 3 2 2
MIRT646576 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT647151 CYP27C1 cytochrome P450 family 27 subfamily C member 1 2 2
MIRT647554 CYP2B6 cytochrome P450 family 2 subfamily B member 6 2 2
MIRT647761 RNF168 ring finger protein 168 2 2
MIRT648078 ZMIZ2 zinc finger MIZ-type containing 2 2 2
MIRT648644 ZNF562 zinc finger protein 562 2 2
MIRT648967 TMEM45B transmembrane protein 45B 2 2
MIRT649126 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT649556 FAM20B FAM20B, glycosaminoglycan xylosylkinase 2 2
MIRT649644 SAMHD1 SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1 2 2
MIRT649781 MRPS27 mitochondrial ribosomal protein S27 2 4
MIRT649945 SIT1 signaling threshold regulating transmembrane adaptor 1 2 2
MIRT649975 TRAFD1 TRAF-type zinc finger domain containing 1 2 2
MIRT650250 CD68 CD68 molecule 2 2
MIRT650717 KRT32 keratin 32 2 2
MIRT650979 ZNF831 zinc finger protein 831 2 2
MIRT651049 ZNF644 zinc finger protein 644 2 2
MIRT651120 ZNF48 zinc finger protein 48 2 2
MIRT651221 ZNF225 zinc finger protein 225 2 2
MIRT651277 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT651401 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT651410 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT652198 TRIM39 tripartite motif containing 39 2 2
MIRT652710 THBS2 thrombospondin 2 2 4
MIRT652763 TENM4 teneurin transmembrane protein 4 2 2
MIRT653031 STX1B syntaxin 1B 2 2
MIRT653099 SRSF7 serine and arginine rich splicing factor 7 2 2
MIRT653354 SMG7 SMG7, nonsense mediated mRNA decay factor 2 2
MIRT653366 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT653755 SLC12A5 solute carrier family 12 member 5 2 2
MIRT653864 SHANK2 SH3 and multiple ankyrin repeat domains 2 2 2
MIRT653961 SEPN1 selenoprotein N 2 2
MIRT654463 RAP2B RAP2B, member of RAS oncogene family 2 2
MIRT654483 RANBP2 RAN binding protein 2 2 2
MIRT654696 PSMB5 proteasome subunit beta 5 2 2
MIRT655075 PIP4K2B phosphatidylinositol-5-phosphate 4-kinase type 2 beta 2 2
MIRT655443 PALM2-AKAP2 PALM2-AKAP2 readthrough 2 2
MIRT655606 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT656026 MYO5A myosin VA 2 4
MIRT656038 MYO10 myosin X 2 2
MIRT656304 METTL1 methyltransferase like 1 2 2
MIRT656372 MDFI MyoD family inhibitor 2 4
MIRT656399 MCU mitochondrial calcium uniporter 2 2
MIRT656415 MCTP1 multiple C2 and transmembrane domain containing 1 2 2
MIRT656762 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT656905 KIAA1958 KIAA1958 2 2
MIRT658938 DPY19L1 dpy-19 like C-mannosyltransferase 1 2 2
MIRT659221 CXXC5 CXXC finger protein 5 2 2
MIRT659281 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT659483 CLDN1 claudin 1 2 2
MIRT660112 BTBD3 BTB domain containing 3 2 2
MIRT660305 BHLHE40 basic helix-loop-helix family member e40 2 2
MIRT660334 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT660788 AKAP2 A-kinase anchoring protein 2 2 2
MIRT661578 EPHX2 epoxide hydrolase 2 2 2
MIRT661744 DTHD1 death domain containing 1 2 2
MIRT661873 PDLIM5 PDZ and LIM domain 5 2 2
MIRT662256 C15orf52 chromosome 15 open reading frame 52 2 2
MIRT662698 SPIRE2 spire type actin nucleation factor 2 2 2
MIRT662761 LRRC3C leucine rich repeat containing 3C 2 2
MIRT663315 TECPR2 tectonin beta-propeller repeat containing 2 2 2
MIRT664687 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 4
MIRT665966 SZRD1 SUZ RNA binding domain containing 1 2 2
MIRT666057 STK40 serine/threonine kinase 40 2 2
MIRT666875 POMGNT1 protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) 2 2
MIRT667214 NIPAL1 NIPA like domain containing 1 2 2
MIRT667285 NAV1 neuron navigator 1 2 2
MIRT667648 LGALSL galectin like 2 2
MIRT668045 GTPBP10 GTP binding protein 10 2 2
MIRT668155 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668492 ETV3 ETS variant 3 2 2
MIRT669356 BHLHE22 basic helix-loop-helix family member e22 2 2
MIRT676486 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT684285 CDK9 cyclin dependent kinase 9 2 2
MIRT686689 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT691270 GET4 golgi to ER traffic protein 4 2 2
MIRT698669 TEF TEF, PAR bZIP transcription factor 2 2
MIRT699893 RUNX1 runt related transcription factor 1 2 2
MIRT702635 ITGA5 integrin subunit alpha 5 2 2
MIRT708797 KIFC3 kinesin family member C3 2 2
MIRT710950 AMZ1 archaelysin family metallopeptidase 1 2 2
MIRT711228 RETSAT retinol saturase 2 2
MIRT711637 PEBP1 phosphatidylethanolamine binding protein 1 2 2
MIRT711968 APOA5 apolipoprotein A5 2 2
MIRT712078 WDR37 WD repeat domain 37 2 2
MIRT712542 CYB561D1 cytochrome b561 family member D1 2 2
MIRT713595 ANKMY1 ankyrin repeat and MYND domain containing 1 2 2
MIRT713715 PAOX polyamine oxidase 2 2
MIRT714482 TBL2 transducin beta like 2 2 2
MIRT715510 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT715833 SZT2 SZT2, KICSTOR complex subunit 2 2
MIRT715931 CHD4 chromodomain helicase DNA binding protein 4 2 2
MIRT716183 MTRNR2L1 MT-RNR2-like 1 2 2
MIRT716330 POU5F1 POU class 5 homeobox 1 2 2
MIRT716942 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT717337 URM1 ubiquitin related modifier 1 2 2
MIRT718114 CRTC1 CREB regulated transcription coactivator 1 2 2
MIRT718866 LRSAM1 leucine rich repeat and sterile alpha motif containing 1 2 2
MIRT719456 APBA1 amyloid beta precursor protein binding family A member 1 2 2
MIRT719989 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT720262 FAM83F family with sequence similarity 83 member F 2 2
MIRT721361 ENTHD1 ENTH domain containing 1 2 2
MIRT721370 SEC14L6 SEC14 like lipid binding 6 2 2
MIRT721489 LTB4R2 leukotriene B4 receptor 2 2 2
MIRT723010 FADS1 fatty acid desaturase 1 2 2
MIRT723608 FKRP fukutin related protein 2 2
MIRT723686 CIRH1A UTP4, small subunit processome component 2 2
MIRT723972 GPR146 G protein-coupled receptor 146 2 2
MIRT724826 HOXB8 homeobox B8 2 2
MIRT725283 OSTM1 osteopetrosis associated transmembrane protein 1 2 2
MIRT725437 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 2
MIRT725606 CAPN6 calpain 6 2 2
MIRT731686 BTK Bruton tyrosine kinase 3 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4667 Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-mir-4667 Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-4667 Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-miR-4667-3p Tripterygium wilfordii Hook F sensitive tissue
hsa-miR-4667-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4667-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-4667-3p Platinum 23939 sensitive tissue (non-small cell lung cancer)
hsa-miR-4667-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4667-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission