miRTarBase - #MIRT456116


—
pre-miRNA Information
pre-miRNA hsa-mir-6787   
Genomic Coordinates chr17: 82236668 - 82236728
Description Homo sapiens miR-6787 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6787-5p
Sequence 6| UGGCGGGGGUAGAGCUGGCUGC |27
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs778888046 4 dbSNP
rs772018061 5 dbSNP
rs760886644 6 dbSNP
rs776925052 7 dbSNP
rs760060985 8 dbSNP
rs1432528063 9 dbSNP
rs778772390 10 dbSNP
rs924024166 11 dbSNP
rs201523090 13 dbSNP
rs1451075810 17 dbSNP
rs1378844609 18 dbSNP
Putative Targets

Gene Information
Gene Symbol VAV3   
Synonyms -
Description vav guanine nucleotide exchange factor 3
Transcript NM_001079874   
Other Transcripts NM_006113   
Expression
Putative miRNA Targets on VAV3
3'UTR of VAV3
(miRNA target sites are highlighted)		 
>VAV3|NM_001079874|3'UTR
   1 ATTCAAATCCCGTGTTGCACCCTGCACCAAAAATTTCAGAGAAGGGATAAATAGAAGCCTGCACAGCATCGTGAATTAAC
  81 TGAAGTGTTTAAAAAGCTGCATTTCTGGCTGTTCAACATCCTCCCTCCTTAGCCCCTCCTAAGTCTTAATGCTGAGATTT
 161 CTAAAGATGCTGGTACTGACAGATTAATGGCTTGCCTAGAGCTGTGCAAGAAACAGCCTGCCAGTCTGTCATTGTCAGGG
 241 ACCAGGGCAAAACCAAGAGCTGTTCTTCCCAGAAGAGCCCTGCAAACACATTGGTTCGTGCTTCCCTTTACTTCTTCTGG
 321 TCAGATACCATGAATGCCAGTCATCAGTAAATCTTAATACACTTTTGCTTTATTCTCACATGCCATTCACCAGATTATTT
 401 GATGGTACAAAGAAGCAGAAGTGTAATTTTCCTTTTCCCAGCATGACGAAAAATTGGAGTTCTGCCATTTGAGCAGCTTA
 481 CTGGAAAGATCCAGCCTTACTTGTCTTAAATTGTCCAACAAGGTGACTCATTGCCCGGCAAACACTTTTACCCTCAGATG
 561 TTACTCATGATATTATAAAATATGAGGCCAGTGCTCAGGTTTGCATCATAAGTGAGCTATCCCTGAAGGGTTTTAATTAC
 641 TTATTTGGTGTCCTGATTATATTTGCAAACTTCTTTATAAAAGGTGAAAAAAGCACACAAAAGAGAGGGTGTCTTCATAT
 721 TAAACCTTCACAACCTTCATGATTTCATAGGATTATTTTGGAAATATAGCACTTGACTTTATGAAAGGATCTGGGCTAGG
 801 TATATTAAGGGTAGTTGCCAATAACCTGAAGAAGCTGGCATTGTTTACAGAAACAGATCAAGGGCTATAATTTATGTCAT
 881 TTTATAGCAGCAGTATCTATTAATACATGCCTTTTCCTCCCATCCACCTCCCCCGCACACACACAAAGATGACCTGGGAC
 961 ATGATTTTTTTATTCCCACATTTTCTTGGAGCACAAACAACTTTGTTGAGGATTTTGGAAGGAAAGCACAACTGGGTCCT
1041 TTATTCATTTCTGGGACAGAAAGAGGGTCAGTGGACTTTTGTGGGCCTCCAGCTTCTCTCAGAGTCTCCCCCTCTGCAGC
1121 CCATCCTGGGAGTGTATTAACTGGAGGGAAGATGGGTCTTGCAGTACATTTGTTTTGCCCAGCCATCACTCTTTTTTGTG
1201 AGGAGCCTAAATACATTCTTCCTGGGGTCCAGAGTCCCCATTCAAGGCAGTCAAGTTAAGACACTAACTTGGCCCTTTCC
1281 TGATGGAAATATTTCCTCCATAGCAGAAGTTGTGTTCTGACAAGACTGAGAGAGTTACATGTTGGGAAAAAAAAGAAGCA
1361 TTAACTTAGTAGAACTGAACCAGGAGCATTAAGTTCTGAAATTTTGAATCATCTCTGAAATGAAGCAGGTGTAGCCTGCC
1441 CTCTCATCAATCCGTCTGGGTGCCAGAACTCAAGGTTCAGTGGACACATCCCCCTGTTAGAGACCCTCATGGGCTAGGAC
1521 TTTTCATCTAGGATAGATTCAAGACCTTTACCTCAGAATTATGTAAACTGTGATTGTGTTTTAGAAAAATTATTATTTGC
1601 TAAAACCATTTAAGTCTTTGTATATGTGTAAATGATCACAAAAATGTATTTTATAAAATGTTCTGTACAATAAAGTTACA
1681 CCTCAAAGTGTACTCTTGGAATGGATTCTTTCCTGTAAAGTCTTATCTGCGACTCTGTCTCGGGAATGTTTTGTCTGTTG
1761 CCGTCAGCCGAACTTTGTTATGGAGGGAGCAGCCTCACACAAGCAGAAACACTCCTGTGGATGGTATTGTAGCATGTATT
1841 GTTTATTTTAGTCAATAGACCCTCTCCTTATAAATGGTGTTTAGTCTTCCTGTTGCATTTCATGGGCCTGGGGGTTTCCT
1921 AGCAGAGGATATTGGAGCCCCTTTTTGTGACATTACCAATTACATCTTTGTCCACGTTTAATACTTTGTTTTGGAAAATT
2001 TAAATGCTGCAGATTTGTGTAGAGTTCTAATACCAAAGACAGAAGTAAATGTTTTCCATATACTTTGTCTTGCCTGTATG
2081 CAGCCCTCGTGTAATACGGTGAATTAGAGTGGTATTTCACTTTGTATTATTTTGTAAATATGTCAATATAATAAATAGTG
2161 ACTAAATTGATAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgUCGGUCGAGAUGGGGGCGgu 5'
            | ||| ||   |||||||  
Target 5' ccATCCACCT---CCCCCGCac 3'
 920 - 938 137.00 -21.30
2 
miRNA  3' cgucGGUCGAGAUGGGGGCGGu 5'
              ||  | :|| |||| || 
Target 5' tcctCCCTCCTTAGCCCCTCCt 3'
 119 - 140 122.00 -16.00
3 
miRNA  3' cgUCGGUCGAGAUG-GGGGCGgu 5'
            | || |: :|:| |||:||  
Target 5' aaATCCCGTGTTGCACCCTGCac 3'
 5 - 27 120.00 -17.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31502367 4 COSMIC
COSN31586685 9 COSMIC
COSN30190063 11 COSMIC
COSN30157171 14 COSMIC
COSN30530097 39 COSMIC
COSN30467196 41 COSMIC
COSN28890895 48 COSMIC
COSN31497903 59 COSMIC
COSN30496500 66 COSMIC
COSN16130371 71 COSMIC
COSN30121012 73 COSMIC
COSN30145613 97 COSMIC
COSN5997710 200 COSMIC
COSN31604784 201 COSMIC
COSN31558367 297 COSMIC
COSN22830101 306 COSMIC
COSN30110134 312 COSMIC
COSN14630292 412 COSMIC
COSN27551202 423 COSMIC
COSN26816061 430 COSMIC
COSN30159407 534 COSMIC
COSN21079365 649 COSMIC
COSN30159411 661 COSMIC
COSN31542772 909 COSMIC
COSN1400222 998 COSMIC
COSN15787954 1128 COSMIC
COSN17690417 1347 COSMIC
COSN26549757 1448 COSMIC
COSN30159373 1456 COSMIC
COSN28453565 1533 COSMIC
COSN31529579 1543 COSMIC
COSN31608378 1590 COSMIC
COSN1400221 1608 COSMIC
COSN19490088 1639 COSMIC
COSN17181578 1730 COSMIC
COSN5196995 1743 COSMIC
COSN1400220 1858 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs899446923 2 dbSNP
rs764955911 7 dbSNP
rs1313247484 9 dbSNP
rs759402727 10 dbSNP
rs776619927 11 dbSNP
rs542122942 12 dbSNP
rs746574187 17 dbSNP
rs772705792 18 dbSNP
rs771713648 25 dbSNP
rs747774059 28 dbSNP
rs1368650134 38 dbSNP
rs1192974517 39 dbSNP
rs779276047 40 dbSNP
rs755398431 41 dbSNP
rs749808685 43 dbSNP
rs1490210379 44 dbSNP
rs780763388 48 dbSNP
rs375285827 49 dbSNP
rs373579542 50 dbSNP
rs377617538 58 dbSNP
rs1057441540 61 dbSNP
rs938783918 62 dbSNP
rs1011986853 64 dbSNP
rs927349946 67 dbSNP
rs752422079 70 dbSNP
rs767367610 71 dbSNP
rs62618754 82 dbSNP
rs1430286210 87 dbSNP
rs1333171129 91 dbSNP
rs535993365 96 dbSNP
rs182104204 105 dbSNP
rs112965883 110 dbSNP
rs989420542 114 dbSNP
rs112107766 115 dbSNP
rs1024102601 121 dbSNP
rs754798816 123 dbSNP
rs1459449943 125 dbSNP
rs546353195 149 dbSNP
rs956791059 151 dbSNP
rs1248147881 162 dbSNP
rs1480462582 167 dbSNP
rs143546591 173 dbSNP
rs17019458 185 dbSNP
rs1334557922 194 dbSNP
rs1473540188 198 dbSNP
rs1240388647 204 dbSNP
rs1406976053 209 dbSNP
rs1192088612 220 dbSNP
rs886186908 231 dbSNP
rs1451421854 239 dbSNP
rs1405589169 258 dbSNP
rs1302654247 261 dbSNP
rs189767773 262 dbSNP
rs745658316 269 dbSNP
rs1288616864 276 dbSNP
rs1210073527 279 dbSNP
rs1048831852 287 dbSNP
rs1280709403 294 dbSNP
rs188091969 298 dbSNP
rs1258507678 307 dbSNP
rs954488718 313 dbSNP
rs1490419039 314 dbSNP
rs1221018719 317 dbSNP
rs532627404 321 dbSNP
rs574887881 324 dbSNP
rs1266156824 331 dbSNP
rs1377622751 334 dbSNP
rs1483789612 340 dbSNP
rs1182424415 342 dbSNP
rs1363203875 345 dbSNP
rs1468380072 356 dbSNP
rs1164812896 361 dbSNP
rs1028679964 362 dbSNP
rs1311406281 375 dbSNP
rs1438391539 377 dbSNP
rs1330306396 387 dbSNP
rs1324383306 390 dbSNP
rs1411806851 402 dbSNP
rs1040335383 422 dbSNP
rs554999439 431 dbSNP
rs942978542 436 dbSNP
rs1335722623 438 dbSNP
rs1440413224 439 dbSNP
rs538183134 444 dbSNP
rs899350615 445 dbSNP
rs946234154 447 dbSNP
rs569111481 448 dbSNP
rs1343654559 450 dbSNP
rs552120373 456 dbSNP
rs774325091 471 dbSNP
rs1189292345 474 dbSNP
rs957581465 475 dbSNP
rs748820963 477 dbSNP
rs1057163885 480 dbSNP
rs770880777 480 dbSNP
rs1183207538 489 dbSNP
rs1383667099 494 dbSNP
rs368091734 495 dbSNP
rs927256591 498 dbSNP
rs1396337585 500 dbSNP
rs1408721878 510 dbSNP
rs971292158 512 dbSNP
rs1383973641 518 dbSNP
rs1452432835 522 dbSNP
rs1024218504 524 dbSNP
rs3187207 536 dbSNP
rs755527195 537 dbSNP
rs1337288201 539 dbSNP
rs1202100293 540 dbSNP
rs1263738274 546 dbSNP
rs947418853 551 dbSNP
rs886303044 558 dbSNP
rs1241473648 563 dbSNP
rs1027799875 567 dbSNP
rs1287991296 570 dbSNP
rs994616687 572 dbSNP
rs900137130 589 dbSNP
rs1474501789 606 dbSNP
rs1179182908 607 dbSNP
rs1344018968 611 dbSNP
rs915081911 628 dbSNP
rs989716544 644 dbSNP
rs17236113 646 dbSNP
rs1386170633 647 dbSNP
rs1438847157 664 dbSNP
rs923840301 666 dbSNP
rs1386601845 669 dbSNP
rs561891598 682 dbSNP
rs78755947 687 dbSNP
rs140026517 693 dbSNP
rs891381167 693 dbSNP
rs1297853088 694 dbSNP
rs146083978 698 dbSNP
rs954394274 703 dbSNP
rs1234842149 704 dbSNP
rs1283812866 704 dbSNP
rs1322761593 705 dbSNP
rs1051377644 708 dbSNP
rs1400613658 708 dbSNP
rs1362549407 709 dbSNP
rs1028585134 717 dbSNP
rs1269790261 718 dbSNP
rs1486110578 722 dbSNP
rs1205933131 725 dbSNP
rs766838325 731 dbSNP
rs963097724 735 dbSNP
rs1016468527 739 dbSNP
rs1005449693 742 dbSNP
rs1426276307 743 dbSNP
rs1430546531 748 dbSNP
rs550153997 752 dbSNP
rs936110112 758 dbSNP
rs1365908239 762 dbSNP
rs758971235 767 dbSNP
rs980126740 769 dbSNP
rs1406196000 776 dbSNP
rs1420977816 780 dbSNP
rs373675100 787 dbSNP
rs2769668 808 dbSNP
rs1044378034 810 dbSNP
rs947491284 813 dbSNP
rs563214531 818 dbSNP
rs1317273321 821 dbSNP
rs1053654190 824 dbSNP
rs1485027172 826 dbSNP
rs1224736003 827 dbSNP
rs546154570 835 dbSNP
rs3187208 842 dbSNP
rs528500620 843 dbSNP
rs1490225090 848 dbSNP
rs1197876290 850 dbSNP
rs1253342668 854 dbSNP
rs1207931766 856 dbSNP
rs1420015641 856 dbSNP
rs950532634 857 dbSNP
rs923772107 859 dbSNP
rs1441817268 861 dbSNP
rs987359773 862 dbSNP
rs1027501550 863 dbSNP
rs765520249 867 dbSNP
rs17019453 869 dbSNP
rs921645000 877 dbSNP
rs1315843135 879 dbSNP
rs1402617184 893 dbSNP
rs974374964 899 dbSNP
rs373735946 918 dbSNP
rs563642212 918 dbSNP
rs1390553724 922 dbSNP
rs1304612408 925 dbSNP
rs963190594 928 dbSNP
rs1248436241 930 dbSNP
rs1292852902 931 dbSNP
rs890153607 934 dbSNP
rs536707914 935 dbSNP
rs753959740 937 dbSNP
rs1481254697 946 dbSNP
rs1176918973 947 dbSNP
rs1248856445 948 dbSNP
rs1446882752 950 dbSNP
rs1051328282 965 dbSNP
rs1282542428 989 dbSNP
rs1016410770 991 dbSNP
rs1354977703 992 dbSNP
rs891926535 993 dbSNP
rs1054634502 996 dbSNP
rs1384704360 998 dbSNP
rs983199526 1004 dbSNP
rs1315957874 1005 dbSNP
rs570780511 1010 dbSNP
rs1226626878 1016 dbSNP
rs552512219 1019 dbSNP
rs1447921069 1030 dbSNP
rs1360204420 1033 dbSNP
rs191620266 1035 dbSNP
rs1204427813 1038 dbSNP
rs1256770005 1040 dbSNP
rs927395397 1044 dbSNP
rs1204749985 1047 dbSNP
rs368492930 1052 dbSNP
rs1400050101 1054 dbSNP
rs149593145 1055 dbSNP
rs1477983792 1063 dbSNP
rs906111612 1068 dbSNP
rs567106872 1071 dbSNP
rs544578714 1078 dbSNP
rs983303718 1081 dbSNP
rs1425120002 1091 dbSNP
rs1168204884 1106 dbSNP
rs867675651 1108 dbSNP
rs1179555534 1113 dbSNP
rs1472194144 1117 dbSNP
rs1405538799 1123 dbSNP
rs374545999 1132 dbSNP
rs1011569932 1136 dbSNP
rs1446089042 1141 dbSNP
rs575511762 1148 dbSNP
rs548896793 1151 dbSNP
rs920383379 1157 dbSNP
rs558834322 1161 dbSNP
rs1326313206 1167 dbSNP
rs1224446969 1169 dbSNP
rs1262910188 1169 dbSNP
rs934732587 1177 dbSNP
rs902350114 1183 dbSNP
rs1242384609 1187 dbSNP
rs538509454 1191 dbSNP
rs139351899 1197 dbSNP
rs747889462 1198 dbSNP
rs1175706196 1206 dbSNP
rs1426927802 1214 dbSNP
rs1020643676 1221 dbSNP
rs1010454691 1224 dbSNP
rs892047097 1225 dbSNP
rs1430053202 1231 dbSNP
rs1296439391 1234 dbSNP
rs1199471683 1240 dbSNP
rs1320336264 1243 dbSNP
rs1310875756 1254 dbSNP
rs543609836 1261 dbSNP
rs1379990359 1262 dbSNP
rs1343280396 1268 dbSNP
rs1225873160 1271 dbSNP
rs1286416497 1274 dbSNP
rs1284470960 1275 dbSNP
rs933276532 1279 dbSNP
rs552738260 1289 dbSNP
rs1376626363 1296 dbSNP
rs921840358 1298 dbSNP
rs1467528616 1300 dbSNP
rs1044436615 1306 dbSNP
rs1244952400 1312 dbSNP
rs974406135 1320 dbSNP
rs1158958727 1321 dbSNP
rs941710763 1328 dbSNP
rs1129409 1329 dbSNP
rs1408916883 1330 dbSNP
rs1802379 1331 dbSNP
rs535985544 1332 dbSNP
rs370668561 1338 dbSNP
rs1404179662 1340 dbSNP
rs908850743 1346 dbSNP
rs768422800 1347 dbSNP
rs983614699 1350 dbSNP
rs1157152392 1352 dbSNP
rs1367513776 1355 dbSNP
rs1405674672 1355 dbSNP
rs917213841 1355 dbSNP
rs950458991 1359 dbSNP
rs1035899707 1360 dbSNP
rs1444752002 1371 dbSNP
rs1280516317 1377 dbSNP
rs1372074901 1380 dbSNP
rs1413963112 1381 dbSNP
rs1237491083 1388 dbSNP
rs761872931 1393 dbSNP
rs1293556920 1403 dbSNP
rs530360002 1406 dbSNP
rs56410431 1411 dbSNP
rs1221133339 1414 dbSNP
rs970325658 1421 dbSNP
rs1047722427 1427 dbSNP
rs1437791232 1428 dbSNP
rs1023203867 1436 dbSNP
rs1011806255 1439 dbSNP
rs563299706 1446 dbSNP
rs1437652997 1449 dbSNP
rs1176976128 1451 dbSNP
rs919809531 1452 dbSNP
rs893138574 1453 dbSNP
rs74111051 1454 dbSNP
rs1263836035 1460 dbSNP
rs1425335701 1463 dbSNP
rs781683950 1475 dbSNP
rs1162762264 1484 dbSNP
rs550229468 1488 dbSNP
rs973754898 1490 dbSNP
rs999345492 1500 dbSNP
rs759493161 1504 dbSNP
rs1330217154 1505 dbSNP
rs1354291460 1513 dbSNP
rs891205375 1514 dbSNP
rs1051577275 1517 dbSNP
rs997287286 1521 dbSNP
rs1292203844 1527 dbSNP
rs900322065 1528 dbSNP
rs1238575081 1529 dbSNP
rs530552622 1531 dbSNP
rs1196288767 1533 dbSNP
rs954448915 1537 dbSNP
rs1020758011 1546 dbSNP
rs571112299 1547 dbSNP
rs1245143859 1551 dbSNP
rs1038941537 1552 dbSNP
rs987800478 1558 dbSNP
rs941924291 1578 dbSNP
rs1366791935 1590 dbSNP
rs1476461272 1598 dbSNP
rs769181464 1601 dbSNP
rs1168970016 1607 dbSNP
rs17236120 1609 dbSNP
rs1464347463 1611 dbSNP
rs1365939793 1613 dbSNP
rs1406275866 1614 dbSNP
rs1395089871 1620 dbSNP
rs1047388701 1622 dbSNP
rs1327651610 1628 dbSNP
rs1227567302 1629 dbSNP
rs1435397170 1632 dbSNP
rs1316011880 1634 dbSNP
rs1225057997 1635 dbSNP
rs1263531094 1639 dbSNP
rs929080545 1646 dbSNP
rs1164985019 1648 dbSNP
rs928355612 1665 dbSNP
rs1417347940 1668 dbSNP
rs1033247611 1669 dbSNP
rs1254384215 1676 dbSNP
rs981629755 1682 dbSNP
rs1448770518 1687 dbSNP
rs1379572106 1694 dbSNP
rs1194021377 1696 dbSNP
rs532687105 1698 dbSNP
rs1477132505 1704 dbSNP
rs1441255521 1706 dbSNP
rs1265082211 1711 dbSNP
rs906003413 1717 dbSNP
rs916051162 1720 dbSNP
rs780657392 1723 dbSNP
rs1014252925 1726 dbSNP
rs115069908 1730 dbSNP
rs376103235 1737 dbSNP
rs770804893 1738 dbSNP
rs957603106 1741 dbSNP
rs1032126686 1742 dbSNP
rs998856787 1745 dbSNP
rs749127768 1746 dbSNP
rs1406691573 1748 dbSNP
rs1283912908 1753 dbSNP
rs150886240 1762 dbSNP
rs777266713 1763 dbSNP
rs530251979 1769 dbSNP
rs376782453 1770 dbSNP
rs542013070 1775 dbSNP
rs910352499 1777 dbSNP
rs1487384683 1793 dbSNP
rs1202204168 1797 dbSNP
rs1270281050 1798 dbSNP
rs1432921843 1804 dbSNP
rs181718082 1812 dbSNP
rs758949728 1813 dbSNP
rs987301431 1814 dbSNP
rs1453998469 1834 dbSNP
rs558637805 1836 dbSNP
rs1038804274 1838 dbSNP
rs964515486 1843 dbSNP
rs1426053855 1849 dbSNP
rs1303645747 1855 dbSNP
rs1366850268 1857 dbSNP
rs988322999 1858 dbSNP
rs1308890915 1860 dbSNP
rs1336201545 1864 dbSNP
rs1241138883 1875 dbSNP
rs1006591258 1877 dbSNP
rs190950060 1880 dbSNP
rs957705633 1883 dbSNP
rs887693081 1884 dbSNP
rs1298723189 1892 dbSNP
rs1032438723 1902 dbSNP
rs747605006 1904 dbSNP
rs1293072349 1912 dbSNP
rs1488446515 1919 dbSNP
rs1189772998 1920 dbSNP
rs745880260 1924 dbSNP
rs780738472 1927 dbSNP
rs1177599996 1929 dbSNP
rs970717612 1934 dbSNP
rs1023211549 1939 dbSNP
rs1349165479 1940 dbSNP
rs1456327538 1941 dbSNP
rs1299877273 1948 dbSNP
rs1396921642 1951 dbSNP
rs141569623 1955 dbSNP
rs572795705 1959 dbSNP
rs896014040 1962 dbSNP
rs1374978389 1964 dbSNP
rs552773395 1972 dbSNP
rs1313534567 1973 dbSNP
rs139302493 1975 dbSNP
rs1458464976 1976 dbSNP
rs994006723 1978 dbSNP
rs567097555 1981 dbSNP
rs899136499 1983 dbSNP
rs1482590224 1985 dbSNP
rs916082227 1989 dbSNP
rs990329599 1992 dbSNP
rs1421600166 2000 dbSNP
rs1376031830 2004 dbSNP
rs1314315099 2010 dbSNP
rs1284743336 2011 dbSNP
rs957888776 2013 dbSNP
rs889029854 2014 dbSNP
rs1398293157 2019 dbSNP
rs750890540 2046 dbSNP
rs879458292 2051 dbSNP
rs1303699545 2053 dbSNP
rs147326269 2054 dbSNP
rs544350115 2058 dbSNP
rs779421069 2059 dbSNP
rs1298308415 2063 dbSNP
rs1319231742 2067 dbSNP
rs1218335995 2069 dbSNP
rs1383831641 2070 dbSNP
rs8676 2088 dbSNP
rs1029585429 2089 dbSNP
rs571262744 2094 dbSNP
rs996890816 2096 dbSNP
rs8458 2097 dbSNP
rs1408097988 2102 dbSNP
rs1187784358 2108 dbSNP
rs1017889783 2113 dbSNP
rs924934096 2115 dbSNP
rs1424397322 2121 dbSNP
rs532870032 2123 dbSNP
rs1431137212 2132 dbSNP
rs1195355110 2134 dbSNP
rs1470169198 2141 dbSNP
rs1006039851 2146 dbSNP
rs3790681 2148 dbSNP
rs1445839002 2150 dbSNP
rs1290717101 2158 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgucggucgagaUGGGGGCGgu 5'
                      | |||||:  
Target 5' -----------cAGCCCCGUgg 3'
 		1 - 11
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 10451.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgucggucgagaUGGGGGCGgu 5'
                      | |||||:  
Target 5' ------------AGCCCCGUgg 3'
 		1 - 10
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760628. RNA binding protein: AGO2. Condition:AGO-CLIP-LAPC4_B PAR-CLIP data was present in SRX1760616. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3_A PAR-CLIP data was present in SRX1760618. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3_B PAR-CLIP data was present in SRX1760631. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_B ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000370056.4 | 3UTR | CAGCCCCGUGGACGCUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000370056.4 | 3UTR | AGCCCCGUGGACGCUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000370056.4 | 3UTR | AGCCCCGUGGACGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
90 hsa-miR-6787-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT449091 XPO6 exportin 6 2 2
MIRT449991 PSMG1 proteasome assembly chaperone 1 2 2
MIRT454608 MYADM myeloid associated differentiation marker 2 2
MIRT456116 VAV3 vav guanine nucleotide exchange factor 3 2 6
MIRT457064 TOR4A torsin family 4 member A 2 2
MIRT461023 SDF4 stromal cell derived factor 4 2 2
MIRT467197 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT471711 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT472566 NACC1 nucleus accumbens associated 1 2 2
MIRT476079 GRB2 growth factor receptor bound protein 2 2 2
MIRT480150 CALR calreticulin 2 2
MIRT483027 KHSRP KH-type splicing regulatory protein 2 4
MIRT483498 STMN3 stathmin 3 2 4
MIRT483728 THSD4 thrombospondin type 1 domain containing 4 2 2
MIRT484550 BARHL1 BarH like homeobox 1 2 6
MIRT484684 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT486059 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT486116 INO80E INO80 complex subunit E 2 2
MIRT486313 SIPA1 signal-induced proliferation-associated 1 2 2
MIRT486525 CLCN7 chloride voltage-gated channel 7 2 2
MIRT486857 DPF1 double PHD fingers 1 2 2
MIRT487352 PHF15 jade family PHD finger 2 1 1
MIRT487582 FAM83H family with sequence similarity 83 member H 2 4
MIRT487792 GPR20 G protein-coupled receptor 20 2 4
MIRT488104 POU3F1 POU class 3 homeobox 1 2 2
MIRT488786 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT489361 SYNGR1 synaptogyrin 1 2 4
MIRT489387 RAB11B RAB11B, member RAS oncogene family 2 2
MIRT489680 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT489731 GNAI2 G protein subunit alpha i2 2 4
MIRT489750 TACC3 transforming acidic coiled-coil containing protein 3 2 2
MIRT490029 PCSK4 proprotein convertase subtilisin/kexin type 4 2 2
MIRT490379 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT490580 SLC47A1 solute carrier family 47 member 1 2 2
MIRT490753 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT491187 JUND JunD proto-oncogene, AP-1 transcription factor subunit 2 4
MIRT491301 VGF VGF nerve growth factor inducible 2 2
MIRT491462 HOXB8 homeobox B8 2 2
MIRT491702 PDZD4 PDZ domain containing 4 2 2
MIRT491724 RTN4R reticulon 4 receptor 2 2
MIRT491737 SEMA3F semaphorin 3F 2 2
MIRT491984 UNK unkempt family zinc finger 2 2
MIRT492844 NRGN neurogranin 2 2
MIRT492936 NEUROD2 neuronal differentiation 2 2 4
MIRT493713 H2AFX H2A histone family member X 2 2
MIRT494623 ASB6 ankyrin repeat and SOCS box containing 6 2 4
MIRT494703 ARHGAP31 Rho GTPase activating protein 31 2 2
MIRT495602 NKX2-5 NK2 homeobox 5 2 2
MIRT495750 PDE4C phosphodiesterase 4C 2 4
MIRT500367 ZNF385A zinc finger protein 385A 2 2
MIRT501161 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501702 PCGF3 polycomb group ring finger 3 2 6
MIRT504922 PDRG1 p53 and DNA damage regulated 1 2 2
MIRT517945 TRIM59 tripartite motif containing 59 2 2
MIRT524212 DDI2 DNA damage inducible 1 homolog 2 2 6
MIRT531186 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531972 C12orf49 chromosome 12 open reading frame 49 2 2
MIRT558055 EVI5L ecotropic viral integration site 5 like 2 2
MIRT560482 LACE1 AFG1 like ATPase 2 2
MIRT563217 FXN frataxin 2 2
MIRT569095 FSCN1 fascin actin-bundling protein 1 2 2
MIRT569522 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 2
MIRT569531 CTTN cortactin 2 2
MIRT569848 RGS5 regulator of G protein signaling 5 2 2
MIRT570738 ANKRD52 ankyrin repeat domain 52 2 2
MIRT574140 MARVELD1 MARVEL domain containing 1 2 2
MIRT615994 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT628493 ZNF556 zinc finger protein 556 2 2
MIRT633451 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT649054 SLC1A2 solute carrier family 1 member 2 2 2
MIRT649340 HEXA hexosaminidase subunit alpha 2 2
MIRT670226 PTCHD1 patched domain containing 1 2 2
MIRT670666 KIAA1551 KIAA1551 2 2
MIRT671452 CDH7 cadherin 7 2 2
MIRT671729 ZNF451 zinc finger protein 451 2 2
MIRT690285 ZNF154 zinc finger protein 154 2 2
MIRT700575 PRSS22 protease, serine 22 2 2
MIRT701411 NKRF NFKB repressing factor 2 2
MIRT711877 VASP vasodilator stimulated phosphoprotein 2 2
MIRT712082 UNC13A unc-13 homolog A 2 2
MIRT712523 CYTH2 cytohesin 2 2 2
MIRT712751 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT714681 PRX periaxin 2 2
MIRT714718 VPS8 VPS8, CORVET complex subunit 2 2
MIRT717508 HRNR hornerin 2 2
MIRT717650 THBS2 thrombospondin 2 2 2
MIRT719592 PIAS4 protein inhibitor of activated STAT 4 2 2
MIRT720521 PTGR2 prostaglandin reductase 2 2 2
MIRT721295 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT724922 VPS18 VPS18, CORVET/HOPS core subunit 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6787 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6787-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-6787-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-6787-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-6787-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6787-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-6787-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-6787-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-6787-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-6787-5p Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission