>ZDHHC6|NM_022494|3'UTR
   1 CTGCTGTTAAAACAAAATTATCCTTTAAGTCTGCTTAATTACTTGAAAATTGTACATATTACTAAAGAATTATGCAATGA
  81 GCCTACTCTGGTTAAGATGTTCTTTTCCTCAAAGGTGCCCTAGTGCCATGATTTAAATATTTTTATTACCATTTTGAAAT
 161 GGAGAAGCCATTCTGCATATGCCTTTGAATTCCTGCCCCTCTTTACCACCTCTTCCTCCCCCTCAAAGGAAAAACATTTC
 241 ATCCAAGTAAGTTAACGGCATTTTCTGTAGGATTTTCTTATGCACTGCACACTCTGGACCTCACCTGCAGATACAGTTCC
 321 CCCCTTGCCAGGAGCATCTGCATGTGGTACTTCTCTTTTCCCTCAGTTGATATTTCTTATATGATATTCTAGATACTATA
 401 GAACTCAATTTGTCAGATTCAGTATAACCTCAGATTTTGTTACCTGTCTTTTAAAAATGCAGATTTTGTCAAATCAAATA
 481 AAGATCAATGGATGTTGGGTATAATCAGTTTTTAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' acAAUU-ACG-AUUAUACAUCCUc 5' |||| || | | ||||||| Target 5' agTTAACGGCATTTTCTGTAGGAt 3'	250 - 273	152.00	-10.60

Mutant ID	Mutant Position	Mutant Source
COSN31598833	4	COSMIC
COSN27005628	34	COSMIC
COSN18713442	67	COSMIC
COSN31483780	88	COSMIC
COSN31492251	91	COSMIC
COSN30516638	99	COSMIC
COSN31610282	116	COSMIC
COSN30171337	121	COSMIC
COSN20077035	126	COSMIC
COSN15145345	164	COSMIC
COSN28700388	210	COSMIC
COSN31531999	257	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1300106949	1	dbSNP
rs766989139	1	dbSNP
rs1232246837	5	dbSNP
rs375107079	6	dbSNP
rs1452903816	15	dbSNP
rs1399238769	18	dbSNP
rs776962443	20	dbSNP
rs1212737231	23	dbSNP
rs568620484	26	dbSNP
rs948134506	27	dbSNP
rs747279719	29	dbSNP
rs777487530	33	dbSNP
rs1371794686	37	dbSNP
rs1279553660	46	dbSNP
rs367647882	56	dbSNP
rs1265917689	60	dbSNP
rs916622942	61	dbSNP
rs1056832176	69	dbSNP
rs773144559	71	dbSNP
rs1017966870	73	dbSNP
rs1416207712	80	dbSNP
rs1006630646	90	dbSNP
rs889282886	91	dbSNP
rs1451570311	92	dbSNP
rs1197423649	97	dbSNP
rs562459473	98	dbSNP
rs1043863234	100	dbSNP
rs1157668029	112	dbSNP
rs1248505964	115	dbSNP
rs946885255	120	dbSNP
rs892692416	125	dbSNP
rs1410044586	140	dbSNP
rs1410755629	145	dbSNP
rs375307258	149	dbSNP
rs1052708420	150	dbSNP
rs1389873504	162	dbSNP
rs939318309	164	dbSNP
rs769957832	168	dbSNP
rs1325495765	182	dbSNP
rs908099839	198	dbSNP
rs1408759804	201	dbSNP
rs183302243	209	dbSNP
rs2290965	210	dbSNP
rs1487422129	218	dbSNP
rs909962992	222	dbSNP
rs1292726516	225	dbSNP
rs1490516265	226	dbSNP
rs1216504127	234	dbSNP
rs983940914	245	dbSNP
rs1249834816	246	dbSNP
rs146904721	251	dbSNP
rs536622171	256	dbSNP
rs1231352556	257	dbSNP
rs2290964	270	dbSNP
rs2290963	271	dbSNP
rs1017942642	275	dbSNP
rs1428474920	280	dbSNP
rs529247233	280	dbSNP
rs1234765344	291	dbSNP
rs976667284	293	dbSNP
rs1305663394	304	dbSNP
rs1008286063	314	dbSNP
rs1287818655	317	dbSNP
rs1311638911	319	dbSNP
rs965007956	322	dbSNP
rs1017937160	323	dbSNP
rs1243079031	325	dbSNP
rs955305809	326	dbSNP
rs1360823545	327	dbSNP
rs1430764290	338	dbSNP
rs1346432511	339	dbSNP
rs1227712851	343	dbSNP
rs1006971989	348	dbSNP
rs1484104321	350	dbSNP
rs999382461	360	dbSNP
rs968465806	370	dbSNP
rs1440413870	373	dbSNP
rs1189379169	380	dbSNP
rs1322191694	387	dbSNP
rs1448823328	388	dbSNP
rs1166698141	395	dbSNP
rs1391471551	398	dbSNP
rs1021808374	402	dbSNP
rs1043945422	405	dbSNP
rs765302733	407	dbSNP
rs1399631951	422	dbSNP
rs1419107643	425	dbSNP
rs1167476744	428	dbSNP
rs1012338090	443	dbSNP
rs1228280121	449	dbSNP
rs369410198	450	dbSNP
rs576513496	450	dbSNP
rs1419024066	472	dbSNP
rs1187208063	476	dbSNP
rs1228250927	480	dbSNP
rs892653730	484	dbSNP
rs1486915673	487	dbSNP
rs1056485356	495	dbSNP
rs939303723	499	dbSNP
rs3180431	502	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.