>LHPP|NM_001167880|3'UTR
   1 CGAGCACCATCCGGAAGTGAAGGCTGATGGGTACGTGGACAACCTCGCAGAGGCAGTGGACCTGCTGCTGCAGCACGCCG
  81 ACAAGTGATGGCCTCCTGGGAGAGCCCCGCCTCCTCCACCCCTGCCTCTCCTCCACCCCTGCCTCCCCTCCACCCCTGCC
 161 TCTCCTCCACCCGCCCAGGAGAGCCCCACCTCCTCCACCCCTGCCTCTCCTCCACCCCTGCCTCCCCTCCACCTGCCCCA
 241 GTGCCCAGACCAACCAAGGCCCTGACAGCCCTGCCTTCTGCCCTCTGCCCTGCATGGGCAGGCATTTGTTCCCTACCTGG
 321 GTGGCCTGCTCCCCTGCCTGGGCCCTGACTTCAGCTCCCTGTAGTGAAGTCCAGGAGGGTGGGACAGGCCTGTCAGGCCT
 401 CTGGGAATCTCCCAAATCCCAGAACTCACCACTCACCATGGGCCTTTAAATGCAGTAAACTCCACCTAACCAGATTCAGG
 481 GGCACTATGCCCACTGCCTCCTCTTCAGACTCTTTGCATTTCAGTGAAGAGCCTGGAAGAAACCCAGGGGCCTCCTATGC
 561 ACAGATCTTGCAGCCCAGAACCAAGTCAGCCTCCCTGCGACTGCCCAGGCACACTGCCCACCACCCCACCCCCGAAACAA
 641 TGCCAGCCCGCTGCTTTTTCTATCCTCCCAGTCACCTTTGCAGACAAAGACCAGGGGCAGCTCCCGAGGGCACTGTGAAG
 721 GCTCCCATGCCACACAGTGAGAACTGTAGCCTCTGCGTCCAAGGCACACAGGGTACTTTCTGGACCCACTGCTGGACAGA
 801 CTTGAAGGTGTCATGCCCGGTGTGTGCAGGAGGAAACTAACAGTTCAGTAAACTCTGCCTTGACCAGCAAAAAAAAAAAA
 881 AAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cgaGGUCAGAGCUGCAAGGGCCCc 5' | ||| :|:| |||:||| Target 5' cgaCAAGTGATGGC-CTCCTGGGa 3'	79 - 101	136.00	-17.00
2	miRNA 3' cgaGGUCAGAGCUG-CAAGGGCCCc 5' |||| |:| | ||||| | Target 5' agaCCAG---GGGCAGCTCCCGAGg 3'	688 - 709	118.00	-21.80
3	miRNA 3' cgagGUCAGAGCU------GCAAGGGCCcc 5' ||| ||:|| | | ||||| Target 5' tggaCAGACTTGAAGGTGTCATGCCCGGtg 3'	793 - 822	110.00	-20.40

Mutant ID	Mutant Position	Mutant Source
COSM8584218	2	COSMIC
COSM5925517	15	COSMIC
COSM7313488	20	COSMIC
COSM915817	23	COSMIC
COSM915818	33	COSMIC
COSM6700855	36	COSMIC
COSM4012443	65	COSMIC
COSM1297041	81	COSMIC
COSM7537695	82	COSMIC
COSN24312158	99	COSMIC
COSN30485358	101	COSMIC
COSN26982390	114	COSMIC
COSN30090001	119	COSMIC
COSN31870661	130	COSMIC
COSN20077088	147	COSMIC
COSN30504000	153	COSMIC
COSN18734871	169	COSMIC
COSN28633656	189	COSMIC
COSN23049433	219	COSMIC
COSN4712064	478	COSMIC
COSN7473614	759	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs561468599	2	dbSNP
rs528474716	3	dbSNP
rs990695292	4	dbSNP
rs749045694	10	dbSNP
rs376798947	13	dbSNP
rs148151742	14	dbSNP
rs1049050243	20	dbSNP
rs1278373726	29	dbSNP
rs771749288	32	dbSNP
rs760190285	35	dbSNP
rs771345389	36	dbSNP
rs1357354918	43	dbSNP
rs777137190	47	dbSNP
rs759876327	48	dbSNP
rs765577775	51	dbSNP
rs1382045693	53	dbSNP
rs752954218	53	dbSNP
rs765201424	55	dbSNP
rs763137488	57	dbSNP
rs1479684832	58	dbSNP
rs1179065530	66	dbSNP
rs764253824	71	dbSNP
rs1475036476	72	dbSNP
rs1163155155	73	dbSNP
rs1019137259	76	dbSNP
rs141944020	77	dbSNP
rs369550052	78	dbSNP
rs1353322776	79	dbSNP
rs753805295	80	dbSNP
rs373545055	81	dbSNP
rs1354419460	83	dbSNP
rs1412538397	93	dbSNP
rs1294853323	96	dbSNP
rs778823630	107	dbSNP
rs1269409515	108	dbSNP
rs747854343	109	dbSNP
rs771879863	110	dbSNP
rs138101243	111	dbSNP
rs999112410	111	dbSNP
rs1418687421	112	dbSNP
rs763253736	113	dbSNP
rs764352424	113	dbSNP
rs777415275	115	dbSNP
rs376638361	116	dbSNP
rs751403392	116	dbSNP
rs756960175	118	dbSNP
rs746511242	119	dbSNP
rs770456907	121	dbSNP
rs1485429475	126	dbSNP
rs777434012	126	dbSNP
rs914895934	129	dbSNP
rs200382546	130	dbSNP
rs750302364	130	dbSNP
rs767509832	130	dbSNP
rs1186115822	131	dbSNP
rs1259990268	137	dbSNP
rs777070835	138	dbSNP
rs1167742834	140	dbSNP
rs1417990821	141	dbSNP
rs1256995580	143	dbSNP
rs1426044406	145	dbSNP
rs1165779322	147	dbSNP
rs1410044062	147	dbSNP
rs892889010	147	dbSNP
rs1186114893	150	dbSNP
rs1012721753	153	dbSNP
rs1466532879	158	dbSNP
rs1173282087	159	dbSNP
rs1201383912	164	dbSNP
rs1022839129	167	dbSNP
rs544817587	169	dbSNP
rs1461192977	173	dbSNP
rs190348565	174	dbSNP
rs1403768164	180	dbSNP
rs1025641100	188	dbSNP
rs907117558	189	dbSNP
rs1222099911	190	dbSNP
rs1367434565	190	dbSNP
rs1002815395	198	dbSNP
rs536901546	200	dbSNP
rs969570628	201	dbSNP
rs556465458	205	dbSNP
rs1326326912	209	dbSNP
rs1464759506	209	dbSNP
rs1406393442	214	dbSNP
rs1340888862	215	dbSNP
rs1220165415	226	dbSNP
rs555140388	243	dbSNP
rs1316238679	244	dbSNP
rs1159068370	259	dbSNP
rs1471140930	260	dbSNP
rs1018373334	267	dbSNP
rs964452971	269	dbSNP
rs1461911635	271	dbSNP
rs990359067	276	dbSNP
rs1204144669	277	dbSNP
rs1202102257	279	dbSNP
rs927817918	287	dbSNP
rs1311959439	294	dbSNP
rs567490190	301	dbSNP
rs373927967	302	dbSNP
rs1306398590	321	dbSNP
rs1445449052	327	dbSNP
rs779910530	334	dbSNP
rs1338313346	341	dbSNP
rs967661643	343	dbSNP
rs1432479876	350	dbSNP
rs919200949	354	dbSNP
rs1358326463	360	dbSNP
rs534585375	362	dbSNP
rs1159619886	366	dbSNP
rs748965159	373	dbSNP
rs1405741377	384	dbSNP
rs1049552224	387	dbSNP
rs889094065	390	dbSNP
rs1257352141	396	dbSNP
rs553034180	397	dbSNP
rs1040443448	398	dbSNP
rs902020704	418	dbSNP
rs999060338	422	dbSNP
rs577786236	427	dbSNP
rs1176396428	430	dbSNP
rs1285939435	435	dbSNP
rs1316582381	436	dbSNP
rs893405174	436	dbSNP
rs1037572227	439	dbSNP
rs897652056	443	dbSNP
rs1289187430	482	dbSNP
rs1432643365	486	dbSNP
rs1464161577	489	dbSNP
rs1297489601	493	dbSNP
rs1425293666	496	dbSNP
rs34783860	501	dbSNP
rs1011820932	505	dbSNP
rs1022388999	512	dbSNP
rs558916569	513	dbSNP
rs1051642114	514	dbSNP
rs578102739	515	dbSNP
rs1188588222	516	dbSNP
rs1474641211	518	dbSNP
rs1008201830	534	dbSNP
rs543249708	536	dbSNP
rs1490996621	537	dbSNP
rs538755687	545	dbSNP
rs1218777140	547	dbSNP
rs1320670697	549	dbSNP
rs1034695380	550	dbSNP
rs1401788292	552	dbSNP
rs1296087713	555	dbSNP
rs1231367346	556	dbSNP
rs1338140370	563	dbSNP
rs960435801	567	dbSNP
rs1012068343	582	dbSNP
rs1367400044	594	dbSNP
rs1291820968	599	dbSNP
rs557150065	600	dbSNP
rs1172791951	603	dbSNP
rs1464327064	605	dbSNP
rs1301962586	619	dbSNP
rs1214193727	625	dbSNP
rs967546005	626	dbSNP
rs1314171893	630	dbSNP
rs1232106662	631	dbSNP
rs998994937	634	dbSNP
rs768945208	639	dbSNP
rs919079295	646	dbSNP
rs143582097	650	dbSNP
rs557235345	651	dbSNP
rs1261451381	668	dbSNP
rs1251452588	687	dbSNP
rs1206144260	693	dbSNP
rs1315732870	698	dbSNP
rs1257138271	706	dbSNP
rs910547276	707	dbSNP
rs1386201954	714	dbSNP
rs943318070	715	dbSNP
rs915553310	717	dbSNP
rs1485778430	721	dbSNP
rs1300015367	722	dbSNP
rs1040392953	723	dbSNP
rs963200312	728	dbSNP
rs1177515732	736	dbSNP
rs747494386	736	dbSNP
rs1268935561	741	dbSNP
rs1431105336	745	dbSNP
rs1172417709	747	dbSNP
rs575787713	752	dbSNP
rs11245317	757	dbSNP
rs145884633	758	dbSNP
rs929157465	762	dbSNP
rs1012258539	778	dbSNP
rs1023175496	780	dbSNP
rs1051523674	782	dbSNP
rs1237191491	791	dbSNP
rs911833570	798	dbSNP
rs904874105	801	dbSNP
rs760417660	817	dbSNP
rs776699491	819	dbSNP
rs138717918	820	dbSNP
rs1317466716	822	dbSNP
rs1309179141	828	dbSNP
rs1039741595	840	dbSNP
rs183360729	843	dbSNP
rs188519753	853	dbSNP
rs1454843581	857	dbSNP
rs1302724369	858	dbSNP
rs1011541404	859	dbSNP
rs1454717722	867	dbSNP
rs1366090378	870	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.