>OLIG3|NM_175747|3'UTR
   1 GCAGCGGGCGGGCCCGGCTGCCAAGGAGGAGGGAGAGCGGCGGGAGGGGCCGCGGTGCCGGGCCGGGAGGGAAGAGGGAG
  81 GCTGCACGCTCGGCCCACGGGAGGGCAGGCTCCGGGGCCCGCAGCCTCCCACGCTGTCTGAGAGATCTCAGACTCCACTT
 161 GACCCCCGGAGGGAAAGGACCAAAATCAAACCGCAATTTCTAGGTGGTAGCAAAGGGGGACTCGAACCAGATGTCGTGTG
 241 TTTTGCATGCATGCTTCTTTTCCCCATGCCGCGCCAGTATTTTTCACTGCCATATGCTCTTGTCAAAACTGCATTTGTTG
 321 TATAAAGATGGGATCGGTGTAGTTAAAAACTTGCGAAGGGACTTTTGAGTTGGCTTTCTCTGACTCTGTGTTCTCGCTTT
 401 GGAAAAAGACGGCCATCCCTTTTGTGCAAAACAAATGTAAATATTTTCTTGAGATGGATGCGATTATGATTGTCTCTGTC
 481 CTTGCCACAGTTTTTCTAGAGACAATGGAGAGAGAAAGAGAGAGAGAGCGCGAGAGAGATCAAGACCCAAGTTTTGAATC
 561 TCAACCGAGGTCCAGGGCATGACACCTCCTATGTGGGTTTTCCTTTCGACGCAGTGTAGGTCAAAAGAATGCATGCACGC
 641 TTCTAAATGAATCTTGTCTGAATATGTCGTGCAGGCTGTGGTGCCGTTTTCCTTGTAACAAGGATTTATTAGTGAATTAT
 721 CCCAAGTACTCCATATATCTGTCTGTGGTTGTATGAAATGAAAAAAGGGGCAGAGTGCAAAGACCCACACTCACGCACAC
 801 GCGCTTCTTCTCCCACCCCCACCCCCTTCAAACTTTATTCGGAACCTTCCTTTGCTGTTCTGGGGCCGCTATTGTAAAAG
 881 CCTGGGCTCCCTCTAGTAGCTTGCGCCACCCCCCCTCGCTCAGTTATTCTGCATGCGGGGTTGGCTCTCTCTATTATCAG
 961 CTTTGAAAACTTATCCTGGTTTTGGGAGGGGTGCCGTTTTTATTTTCCTGAACATTTGCTTGAAATATTTTGTTAGGGCC
1041 TCAAAGACGATACCTGTCTTTATTTTTTATATATTCTTGATAACTATGATATATTTATTAATAACCAGTGTTTCTGGATG
1121 AGATTTCAAATAAAAAAGAACCTTTAAATCGTG

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aucGAAGGGUUGUCUAUUUACu 5' :|||::: ||||::||| Target 5' tatTTTCTTG--AGATGGATGc 3'	442 - 461	127.00	-10.70
2	miRNA 3' auCGAAGGGUUGUCUAUUUAcu 5' |||| |:|| ||:||| Target 5' acGCTT-CTAA---ATGAATct 3'	637 - 654	120.00	-6.40
3	miRNA 3' aucGAAGGGU-UGU-----CUAUU--UACu 5' :||:::| |:| ||||| ||| Target 5' ttaTTTTTTATATATTCTTGATAACTATGa 3'	1060 - 1089	111.00	-6.10

Mutant ID	Mutant Position	Mutant Source
COSN30571200	28	COSMIC
COSN24048841	113	COSMIC
COSN28188970	165	COSMIC
COSN19597943	236	COSMIC
COSN23869012	354	COSMIC
COSN31516210	448	COSMIC
COSN31481532	479	COSMIC
COSN31530806	516	COSMIC
COSN20500039	529	COSMIC
COSN30161623	608	COSMIC
COSN25819369	698	COSMIC
COSN25489104	917	COSMIC
COSN31515294	1076	COSMIC
COSN31529792	1138	COSMIC
COSN31529296	1150	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs778634424	5	dbSNP
rs757055725	6	dbSNP
rs1354496797	7	dbSNP
rs772851317	8	dbSNP
rs753762439	9	dbSNP
rs756159387	10	dbSNP
rs1385173200	13	dbSNP
rs752754521	14	dbSNP
rs184671382	15	dbSNP
rs551877447	16	dbSNP
rs774692106	18	dbSNP
rs766691820	22	dbSNP
rs1384063947	26	dbSNP
rs1161069713	28	dbSNP
rs192339722	35	dbSNP
rs773651981	37	dbSNP
rs770280744	39	dbSNP
rs1446753224	41	dbSNP
rs949096426	42	dbSNP
rs746527176	43	dbSNP
rs774943981	44	dbSNP
rs1041196942	45	dbSNP
rs1161249514	46	dbSNP
rs1291693120	47	dbSNP
rs945551517	50	dbSNP
rs1046842063	52	dbSNP
rs1327331507	55	dbSNP
rs914147746	56	dbSNP
rs1002367157	59	dbSNP
rs1308285629	60	dbSNP
rs906732165	64	dbSNP
rs566103312	65	dbSNP
rs920784210	67	dbSNP
rs973944594	69	dbSNP
rs943634727	73	dbSNP
rs1009297306	76	dbSNP
rs1335720503	87	dbSNP
rs770256722	88	dbSNP
rs187394049	89	dbSNP
rs1327179854	94	dbSNP
rs1457333237	98	dbSNP
rs1300917074	99	dbSNP
rs1251072971	100	dbSNP
rs987713715	108	dbSNP
rs1420821716	115	dbSNP
rs1385152294	117	dbSNP
rs954720707	118	dbSNP
rs369424037	120	dbSNP
rs1461614470	124	dbSNP
rs529567333	132	dbSNP
rs1304256488	133	dbSNP
rs866233973	134	dbSNP
rs936345906	140	dbSNP
rs1298261710	141	dbSNP
rs1376144613	150	dbSNP
rs1394867271	153	dbSNP
rs1409697009	157	dbSNP
rs369607107	167	dbSNP
rs1369275379	168	dbSNP
rs1169938776	171	dbSNP
rs1462823361	174	dbSNP
rs1235553065	175	dbSNP
rs569982765	181	dbSNP
rs899728282	182	dbSNP
rs1373280784	199	dbSNP
rs1317526378	215	dbSNP
rs550047651	216	dbSNP
rs1032184282	220	dbSNP
rs1430922567	221	dbSNP
rs1481573603	223	dbSNP
rs1270473052	232	dbSNP
rs1256519124	233	dbSNP
rs1002408535	236	dbSNP
rs1475386642	236	dbSNP
rs969192224	238	dbSNP
rs912409866	239	dbSNP
rs1199539766	241	dbSNP
rs987560836	243	dbSNP
rs1355814289	244	dbSNP
rs929348082	246	dbSNP
rs1302725832	248	dbSNP
rs537830705	249	dbSNP
rs1416937990	250	dbSNP
rs1249538108	252	dbSNP
rs77114882	261	dbSNP
rs1276715015	262	dbSNP
rs761579177	264	dbSNP
rs1013445175	269	dbSNP
rs886800503	270	dbSNP
rs973367452	271	dbSNP
rs139702467	277	dbSNP
rs1047148831	279	dbSNP
rs995272916	290	dbSNP
rs1255596701	293	dbSNP
rs1279476241	303	dbSNP
rs1033932402	312	dbSNP
rs981452667	313	dbSNP
rs564523459	314	dbSNP
rs898197633	322	dbSNP
rs1283954509	323	dbSNP
rs1409289218	333	dbSNP
rs1349105393	338	dbSNP
rs1331533844	341	dbSNP
rs151069394	354	dbSNP
rs1039451697	365	dbSNP
rs1392331188	373	dbSNP
rs1430909021	375	dbSNP
rs1174749248	387	dbSNP
rs1396153619	392	dbSNP
rs1437189326	393	dbSNP
rs1296733168	394	dbSNP
rs776464055	395	dbSNP
rs892178451	396	dbSNP
rs1032062471	408	dbSNP
rs1218659071	411	dbSNP
rs1304328746	425	dbSNP
rs1348494657	426	dbSNP
rs545129838	427	dbSNP
rs1283593969	436	dbSNP
rs1446162978	448	dbSNP
rs769043245	450	dbSNP
rs1216271859	451	dbSNP
rs943550392	467	dbSNP
rs910709797	470	dbSNP
rs1192452208	473	dbSNP
rs762339418	481	dbSNP
rs747392377	484	dbSNP
rs142853778	490	dbSNP
rs913916970	497	dbSNP
rs988513843	498	dbSNP
rs772464980	501	dbSNP
rs1008591011	503	dbSNP
rs745892182	505	dbSNP
rs184244241	509	dbSNP
rs980873536	510	dbSNP
rs542616501	515	dbSNP
rs1436107787	518	dbSNP
rs140515618	520	dbSNP
rs1024748153	527	dbSNP
rs1491327610	528	dbSNP
rs1037827907	529	dbSNP
rs1224075788	529	dbSNP
rs1349877373	529	dbSNP
rs941990685	530	dbSNP
rs926643659	534	dbSNP
rs191754419	536	dbSNP
rs1469382584	550	dbSNP
rs147180491	551	dbSNP
rs1232746639	553	dbSNP
rs1025308436	559	dbSNP
rs1412127834	564	dbSNP
rs1462768305	565	dbSNP
rs1264002738	566	dbSNP
rs988237260	577	dbSNP
rs1396998120	580	dbSNP
rs1464068923	581	dbSNP
rs995617310	583	dbSNP
rs571578254	585	dbSNP
rs1335082889	589	dbSNP
rs1281043143	591	dbSNP
rs956906059	591	dbSNP
rs1376769362	593	dbSNP
rs1232482954	604	dbSNP
rs1273384627	608	dbSNP
rs1336503965	612	dbSNP
rs1196150410	614	dbSNP
rs898152067	615	dbSNP
rs1327247962	618	dbSNP
rs1438863527	619	dbSNP
rs1207300359	620	dbSNP
rs1039887278	622	dbSNP
rs1006625273	627	dbSNP
rs1032051146	628	dbSNP
rs1189096397	631	dbSNP
rs1420218548	633	dbSNP
rs889306215	634	dbSNP
rs577813993	637	dbSNP
rs963735597	639	dbSNP
rs1310978502	640	dbSNP
rs116520417	649	dbSNP
rs914101493	651	dbSNP
rs535126639	654	dbSNP
rs1216451462	659	dbSNP
rs75989141	660	dbSNP
rs936702244	663	dbSNP
rs1456218582	664	dbSNP
rs925296642	667	dbSNP
rs980846864	671	dbSNP
rs1382204296	678	dbSNP
rs1485638863	681	dbSNP
rs1212025381	682	dbSNP
rs777902732	683	dbSNP
rs891002123	685	dbSNP
rs1487413273	686	dbSNP
rs1047045450	696	dbSNP
rs555751115	702	dbSNP
rs898354389	711	dbSNP
rs1393135378	728	dbSNP
rs535494099	729	dbSNP
rs569695426	731	dbSNP
rs917765600	736	dbSNP
rs550108977	737	dbSNP
rs1251605896	744	dbSNP
rs1037774494	747	dbSNP
rs1380332524	751	dbSNP
rs942078021	753	dbSNP
rs926744593	761	dbSNP
rs769230490	767	dbSNP
rs1228896106	769	dbSNP
rs143626162	770	dbSNP
rs1045429881	775	dbSNP
rs139809550	777	dbSNP
rs1235722995	782	dbSNP
rs1243975030	786	dbSNP
rs1208393957	789	dbSNP
rs951241273	790	dbSNP
rs918156905	794	dbSNP
rs1196835962	795	dbSNP
rs1252532438	802	dbSNP
rs1463586427	803	dbSNP
rs1396843097	805	dbSNP
rs35185005	807	dbSNP
rs1286375840	815	dbSNP
rs1205828690	818	dbSNP
rs1385206994	820	dbSNP
rs1356182108	821	dbSNP
rs1282959426	822	dbSNP
rs1248610634	823	dbSNP
rs1026013951	825	dbSNP
rs1384041952	827	dbSNP
rs1315281925	830	dbSNP
rs1433840203	834	dbSNP
rs1334517760	841	dbSNP
rs1238712805	845	dbSNP
rs974002822	860	dbSNP
rs962714814	867	dbSNP
rs1353111106	891	dbSNP
rs1324353148	895	dbSNP
rs547629382	896	dbSNP
rs1006658097	903	dbSNP
rs1468934889	904	dbSNP
rs1254748509	905	dbSNP
rs1417304367	908	dbSNP
rs1364205908	909	dbSNP
rs1400792480	910	dbSNP
rs188211517	912	dbSNP
rs890845643	913	dbSNP
rs1030507780	914	dbSNP
rs925483324	916	dbSNP
rs1391393255	917	dbSNP
rs979584192	917	dbSNP
rs997724395	930	dbSNP
rs182695476	934	dbSNP
rs892628634	936	dbSNP
rs1292826637	937	dbSNP
rs1335741352	939	dbSNP
rs964111352	943	dbSNP
rs1053147155	945	dbSNP
rs1249757525	947	dbSNP
rs1479599846	948	dbSNP
rs1008299317	951	dbSNP
rs1420615138	953	dbSNP
rs542728732	953	dbSNP
rs759622444	953	dbSNP
rs1416641396	955	dbSNP
rs1475366163	956	dbSNP
rs1166465623	965	dbSNP
rs1352308028	967	dbSNP
rs994112450	972	dbSNP
rs1299200543	973	dbSNP
rs898426183	974	dbSNP
rs903873508	976	dbSNP
rs1413257547	982	dbSNP
rs1312712088	986	dbSNP
rs1356331287	987	dbSNP
rs1045018677	996	dbSNP
rs948140044	1006	dbSNP
rs918039252	1015	dbSNP
rs992193913	1019	dbSNP
rs528922923	1022	dbSNP
rs749217385	1025	dbSNP
rs1293493673	1030	dbSNP
rs1306941100	1032	dbSNP
rs1001376852	1033	dbSNP
rs879420624	1037	dbSNP
rs962628694	1038	dbSNP
rs905244133	1039	dbSNP
rs563268605	1048	dbSNP
rs1225427694	1049	dbSNP
rs543778913	1051	dbSNP
rs985085296	1057	dbSNP
rs1375272249	1066	dbSNP
rs192702528	1076	dbSNP
rs955022838	1078	dbSNP
rs1274317053	1079	dbSNP
rs1433474540	1080	dbSNP
rs1312619860	1091	dbSNP
rs1226650167	1106	dbSNP
rs1336974282	1108	dbSNP
rs188929912	1109	dbSNP
rs1287294109	1117	dbSNP
rs1009970034	1119	dbSNP
rs1297894209	1122	dbSNP
rs1344225186	1125	dbSNP
rs1232047330	1129	dbSNP
rs1279319471	1141	dbSNP
rs769596014	1141	dbSNP
rs540837626	1148	dbSNP
rs1211975189	1150	dbSNP
rs1031138542	1152	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.