>ARMCX6|NM_001009584|3'UTR
   1 ACGGCCCTCTCGAACACAATGGGACGGAATCCACCCACAACGCGCTTGGTTTGCAGATGTCAAAGAATCTGCAGAGGGTG
  81 CTACTGAAGATCCAGCCTTAGCCAATCACCACCTCATTGGGTGAAAGTTCCAGGGCTCAATCCAGGACCACACTCTTATT
 161 GGCCAGGCAGGGGCTCCCACAGAGCTTTGAGTAACTTCTTGGTTGTGCAGTCTGCAGGCAATGTTGGCATTGTAAATTCC
 241 TCCCTTGCAGCCTCCTTCATGTGGTGAGGGGATCACTTCAGCTGCCTGCTGTGGACAAAGAACATCAAATTACAGCATCA
 321 CGAGTGCTATTGTTGCCTGTGGTGGTCTCCCTGTCCAAGCGGGACCGCTTTGCAGAGACCAGAGGCATATCGCGGCTTGA
 401 GCTGAAAATGCATTTGTTGCAGCTTAGGTTGAATTATTTTTCGTTTGCTCTTTCTTCTACACGCGCCTGATGGATAGTGA
 481 ACCTATTCATCAAAAAAGTGCACTGCTCTTCTGTCTATTGTACCGACTTAACCTCTTCCACCCAAGTCCGCATCTGTGTG
 561 TATCATCAATAAAGTTGTGTGCTTTGATTGGCAGAAAAGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cuuGUAUUGUGCCU--AUUGGAGa 5' :|| ::|| || ||||||| Target 5' gtcTATTGTACCGACTTAACCTCt 3'	513 - 536	157.00	-11.60
2	miRNA 3' cuUGUAUUGUGCCU-AUUGGAGa 5' ||| |:| : || ||||:|| Target 5' ccACAGAGCTTTGAGTAACTTCt 3'	177 - 199	144.00	-11.60
3	miRNA 3' cuUGUAUUG--UGCCUAUUGGAGa 5' |::|::: : |||| ||:|| Target 5' tcATGTGGTGAGGGGATCACTTCa 3'	257 - 280	110.00	-9.90

Mutant ID	Mutant Position	Mutant Source
rs112814703	1	dbSNP
rs112269774	229	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.