miRTarBase - #MIRT457128


—
pre-miRNA Information
pre-miRNA hsa-mir-939   
Genomic Coordinates chr8: 144394149 - 144394230
Synonyms MIRN939, hsa-mir-939, MIR939
Description Homo sapiens miR-939 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-939-5p
Sequence 15| UGGGGAGCUGAGGCUCUGGGGGUG |38
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30593009 5 COSMIC
COSN30543331 16 COSMIC
COSN14667885 23 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1384036144 1 dbSNP
rs1395761717 5 dbSNP
rs1311227571 6 dbSNP
rs371302764 7 dbSNP
rs376683753 10 dbSNP
rs530381565 19 dbSNP
rs374825674 20 dbSNP
rs781946129 21 dbSNP
rs1327403764 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ASPH   
Synonyms AAH, BAH, CASQ2BP1, FDLAB, HAAH, JCTN, junctin
Description aspartate beta-hydroxylase
Transcript NM_001164750   
Other Transcripts NM_001164751 , NM_001164752 , NM_001164753 , NM_001164754 , NM_001164755 , NM_001164756 , NM_004318 , NM_020164 , NM_032466 , NM_032467 , NM_032468   
Expression
Putative miRNA Targets on ASPH
3'UTR of ASPH
(miRNA target sites are highlighted)		 
>ASPH|NM_001164750|3'UTR
   1 CATGAATTCATGCAAGCTTGGGAAACTCTGGAGAGAGGCTGCCTTTCTGGTTCCATCTCCTTGGGTGTGAGGATAGAATT
  81 TCGAACACCAAGAGTCAATTCCCTTGACTTGCAGCCCGAGTAATTCAAAGCCTCCTCCTAGGGTCAGAAGACACTAAAGG
 161 GAATATTTGCCTCGCTGCAATTCATTTAGGAAACACCCTGCTGTGTGTCATCTCATGACAGCACTGGTCTTCTGCCAGTA
 241 TTTAAGGTGAACATTTGATAGCTTCTACCTTACCAGCCAAAGATATTTTTTCCACATAGAATAGGTCTAATTCAATGTAT
 321 AATGAGAACATATGTAGAAACTGTGAATGGATTGCTTTAGTTTGTAATTTTTCTATGCAGTTATATTTTTCTAGTGTAGC
 401 TAGACTATTTTGTCATCATGTACCACTACATTTTTGTTTATTTTAATGACAAGCTGTATAAATGCTTTACTTCTAGCTAT
 481 TTAATGGTAGCATTACTGGGGAACTCAGACTTCCCTCTTTTAATTCTTCTTAGTAAAAGATACTCATGAAAAAAGCAGTT
 561 TTATTTTCCTAACAAAAAAGAAAGAGCTCATTATGTCAGTGTCTATGAACTGTACCCATCCCAACTCTCAAATCGTTTGG
 641 TTTTTTTTATCTTGATTGAGATCCTCTTCTCACTATGCTAGTGGTGGAGATATTGACAAAATCCTATTTCTTTCAAAGAG
 721 GAACTTTTCACACCGAAAAAAGAGCATGGAATTATTTTATATTGTTATAAAAATCCCAGATGCAAATTTTTTTAATGCCA
 801 ATTATTAGAGCTTCTGGGGAAAAAGTATAGTTCACGGAAATAAAACTATGTTCTTTCAGGGTTGGGTGGATAGGTGGCTG
 881 CTAGGGTGTCTGGCTCCTGGCGGCTTTGCCATCCATGAGGCAAGGGCTGGGAACACAGTGTCTTTGCCTATGGTAGATCC
 961 ATGTGAATGTCAGGAAGCCAGCTCTTCAGTCTTGGAGATGATTTCTGCTACAATTCTGTAGAAAGATTAAGGATGGCAGA
1041 GTAAAAGGTTACCAAGAATGCCAGGATGTTTTTCTTGGGCGTAGGAGGTCCAGATTACTTTCCTTTTTGATGAAAGAGTT
1121 TGGAAGACTGTCCCATCTCTCTGGCTTGAGAAATCTCTGCCATTTTAAACATCACTGTGAAATAGCAATTATTATCATCT
1201 GTATTTAGTTTTAACATTACCCACAACATAGAAATAATAGGTAAAAATCGTCTTGCCTACTCATTCCAAAGATGATCAAG
1281 TCATTAATCTAGCAAAGTATTCATGTATCAGATTTTGTATATTTTGAATCAAAGCTAACTAGGAATGTTAGATATAAGAA
1361 TGTAATGATATTCATGCACTGAATTCTAAGCCAATATGAACAAAAATGCTGCATGAATGGCACATATAGGTCACCAAAGT
1441 TCATTCACAGGTAGAAAAAACTTGTGCTTTCTTTTCCATCTAAAAACAAAAGGAGACTTTCTTTATCTCATTTAAAGAAC
1521 AGCTCTTTGAAATTGAAATTGACCCTTTTTGCTTGACCTTAAGGAGATTAGCTTCCAGTAGATGAGTTTGCAAAATACTT
1601 TTCCTGTTCTTTTGTTTTGCTGGTATTGAAAACATCCCACTAAATCAGATGAAGAGGCATGGGAGGAAAAATATCCAAAT
1681 TAATTACTAAAATCGAGAAGAGAAGGCAAACTCTTGAAAAGTAAAAAGGTGTTTGTGACCTTCAGTATTTATTGAACAGA
1761 GGAAATAACTGACAAGGGCAATACAATTCAATGTTCATGTAGTAACATTCATGTCACTTGTTGAATTTGGTTCTCATATG
1841 TATATTGCATACACATAAATTCAAACTATAAGTCGTCATTTTTGAGCCATCATCTTACATTCATGTAATGAAATTATGGA
1921 AGAGAGTAAAAACTAGCTCTTAACTTAGTAAATATAATATGGTATTTAAAATCAGGTCACTACAGTAAGGTTCTAAGTAT
2001 TGCCAATTGAAAAGCTAGAAATGGTATTACTGTTGCAAAGTGTTGTCAATAATTGACTCCAATAGCATTGTAAATACTTG
2081 TATCCCACAACTATTTTAAACCCAAGCAATAAAATGGATTTTCTAATTCACTTCAATTCTTTATTTCTCTTACCTATCTA
2161 TGTCTTGGTACATAAGAAAAGTGTTTCCATCACTGCATTGGTAGAATTATTTCAGTGTTATTATTTTTGTGATTTCGTAT
2241 GTCTACACAAAAATGAATTAGTTTAATTTATATTGTGATACAGTTGTTTGAGAAATATTTTTAATTCTGTTTCAACTTTA
2321 TTTCTCCAAGTGTATAATATAAAAATTACTTCTGTTATTGTTCTCTACCAATAGGGGAAAAAATTAAAACATTAGATCCA
2401 TTGAGAAAGAGATGATGTAATAAATAATTAAGATTAGTAATAATATTATCAGGGGTGATTATGACCAGTTGAATAATCTC
2481 TTTCCCTTGAATTATTTAGCTAACAAATTAACTCTCCCAAATATTTAAAATAATGTAAAATCATATTTTACTGCCCATTA
2561 TTAACTAAAATATTTTTGTTTGACTTTGAGCACCAACTGGTAATACTAATAAATACCCATGTCATGCAGATGGCTGGGCG
2641 AATAAGAGATGTCTAAAAATATGCACTGGTCTTGGAAAACATGGCACAAGTAAGGATATCATATATGATGTCTGTTTATT
2721 TTATGTCTGATTTCTTTTGAATGAGTAGTTGGGGACTCCATTTCTAAGGAGACTAGGTAAATAAAATGACCTTTGACATT
2801 TCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guGGGGGUCUCGGAG-UCGAGGGgu 5'
            |: |:||:|: || :|||||:  
Target 5' ggCTGCTAGGGTGTCTGGCTCCTgg 3'
 876 - 900 130.00 -23.90
2 
miRNA  3' gugggGGUC--UCGGAGUCGAGGGGu 5'
               :|||  |||  ||||||::| 
Target 5' gaatgTCAGGAAGC--CAGCTCTTCa 3'
 965 - 988 129.00 -19.60
3 
miRNA  3' guGGGGGUCUCGGAGUCGAGGGgu 5'
            ||:: ||:   |:||||:||  
Target 5' gaCCTTAAGGAGATTAGCTTCCag 3'
 1555 - 1578 126.00 -20.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30181478 17 COSMIC
COSN31511023 20 COSMIC
COSN30106110 45 COSMIC
COSN21918611 63 COSMIC
COSN15705028 71 COSMIC
COSN30126654 82 COSMIC
COSN30485940 101 COSMIC
COSN31497615 118 COSMIC
COSN30164307 137 COSMIC
COSN30532752 140 COSMIC
COSN6600970 174 COSMIC
COSN217019 1446 COSMIC
COSN20091818 1560 COSMIC
COSN9663616 1695 COSMIC
COSN8094228 1929 COSMIC
COSN7675035 2092 COSMIC
COSN7675034 2220 COSMIC
COSN32063535 2681 COSMIC
COSN32064461 2695 COSMIC
COSN32063041 2714 COSMIC
COSN32063040 2716 COSMIC
COSN20609025 2718 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs913588621 8 dbSNP
rs1210742912 10 dbSNP
rs148842811 10 dbSNP
rs565702848 11 dbSNP
rs1443465097 12 dbSNP
rs879109191 13 dbSNP
rs1274139106 17 dbSNP
rs1185046073 19 dbSNP
rs758059271 20 dbSNP
rs902998636 21 dbSNP
rs750235785 31 dbSNP
rs1157727169 36 dbSNP
rs765178021 37 dbSNP
rs761535939 41 dbSNP
rs1447843588 42 dbSNP
rs957678746 45 dbSNP
rs547793272 61 dbSNP
rs532649507 63 dbSNP
rs1401147346 64 dbSNP
rs1389549675 67 dbSNP
rs1171248973 75 dbSNP
rs1310856645 76 dbSNP
rs1474862101 80 dbSNP
rs1246014942 82 dbSNP
rs980478644 86 dbSNP
rs1327487170 91 dbSNP
rs138880716 94 dbSNP
rs570626763 94 dbSNP
rs756700934 98 dbSNP
rs901216214 103 dbSNP
rs1039716873 108 dbSNP
rs1257858454 111 dbSNP
rs1231898102 113 dbSNP
rs1202033446 117 dbSNP
rs10087488 118 dbSNP
rs1258190417 121 dbSNP
rs1213594344 128 dbSNP
rs1023526607 133 dbSNP
rs888738621 135 dbSNP
rs1014528736 146 dbSNP
rs896081989 163 dbSNP
rs1015786492 167 dbSNP
rs1307639769 168 dbSNP
rs1004205447 173 dbSNP
rs149655833 174 dbSNP
rs1048464260 190 dbSNP
rs930173553 196 dbSNP
rs531991836 197 dbSNP
rs1230473310 201 dbSNP
rs73259383 205 dbSNP
rs1345079789 207 dbSNP
rs899676419 208 dbSNP
rs1041252951 210 dbSNP
rs1483918581 214 dbSNP
rs552446861 217 dbSNP
rs1277949514 222 dbSNP
rs554762017 226 dbSNP
rs1178106645 253 dbSNP
rs139456482 257 dbSNP
rs913847323 259 dbSNP
rs949831100 276 dbSNP
rs916949967 285 dbSNP
rs1368885232 287 dbSNP
rs187475706 299 dbSNP
rs1392282778 305 dbSNP
rs182973118 307 dbSNP
rs1405690968 310 dbSNP
rs1407019746 316 dbSNP
rs544997567 319 dbSNP
rs1385638620 324 dbSNP
rs778254639 324 dbSNP
rs980559707 330 dbSNP
rs1312337518 336 dbSNP
rs1226945036 354 dbSNP
rs958356003 355 dbSNP
rs1343795287 363 dbSNP
rs1205649927 368 dbSNP
rs1175088272 372 dbSNP
rs1264682602 375 dbSNP
rs1441219390 375 dbSNP
rs1487371262 379 dbSNP
rs1192916633 383 dbSNP
rs1032949684 384 dbSNP
rs577848094 391 dbSNP
rs1267891251 395 dbSNP
rs556467979 396 dbSNP
rs1238240771 397 dbSNP
rs969521266 418 dbSNP
rs146437871 440 dbSNP
rs1431901512 450 dbSNP
rs978691165 456 dbSNP
rs1169439281 460 dbSNP
rs371991000 468 dbSNP
rs993435291 471 dbSNP
rs573534927 492 dbSNP
rs1020120853 500 dbSNP
rs73259382 511 dbSNP
rs1433748242 526 dbSNP
rs901292858 529 dbSNP
rs1366704255 539 dbSNP
rs1228750499 552 dbSNP
rs1311555685 579 dbSNP
rs1004380994 582 dbSNP
rs1018772943 586 dbSNP
rs1223421185 586 dbSNP
rs1225658577 586 dbSNP
rs538026702 587 dbSNP
rs952720533 588 dbSNP
rs191891846 590 dbSNP
rs1438720038 606 dbSNP
rs1413263298 612 dbSNP
rs1422452549 616 dbSNP
rs899938832 617 dbSNP
rs1295177728 618 dbSNP
rs1351007915 619 dbSNP
rs751868558 622 dbSNP
rs1457214903 629 dbSNP
rs866616573 631 dbSNP
rs569421009 635 dbSNP
rs73259381 640 dbSNP
rs1046566239 645 dbSNP
rs527303065 648 dbSNP
rs1229852424 649 dbSNP
rs539387497 649 dbSNP
rs949574171 649 dbSNP
rs1421136633 650 dbSNP
rs187663086 654 dbSNP
rs1226557400 658 dbSNP
rs1269935203 659 dbSNP
rs1172646054 663 dbSNP
rs1466315151 665 dbSNP
rs947735747 666 dbSNP
rs917694900 669 dbSNP
rs1482378900 675 dbSNP
rs1055531869 676 dbSNP
rs1451974969 679 dbSNP
rs1183786068 680 dbSNP
rs1268875316 683 dbSNP
rs1192249078 684 dbSNP
rs1485853734 693 dbSNP
rs144136864 694 dbSNP
rs925630054 698 dbSNP
rs1400803237 718 dbSNP
rs139448833 724 dbSNP
rs967297717 734 dbSNP
rs1449835278 735 dbSNP
rs1303050574 737 dbSNP
rs1349713511 738 dbSNP
rs908680712 741 dbSNP
rs1329723110 742 dbSNP
rs913134482 742 dbSNP
rs952940463 744 dbSNP
rs1278059427 754 dbSNP
rs976652889 764 dbSNP
rs965568825 767 dbSNP
rs1258486168 772 dbSNP
rs1482940018 773 dbSNP
rs753410684 784 dbSNP
rs1254631020 785 dbSNP
rs1018389457 786 dbSNP
rs567829137 787 dbSNP
rs952774204 793 dbSNP
rs1415677401 794 dbSNP
rs964069116 794 dbSNP
rs1020156003 795 dbSNP
rs1026944355 801 dbSNP
rs1309579413 824 dbSNP
rs892318317 828 dbSNP
rs1435738737 830 dbSNP
rs1401558405 833 dbSNP
rs117041285 835 dbSNP
rs897437741 836 dbSNP
rs903803036 843 dbSNP
rs1432518963 850 dbSNP
rs1203242972 853 dbSNP
rs1277269044 856 dbSNP
rs1047082030 857 dbSNP
rs765787477 862 dbSNP
rs1198860191 864 dbSNP
rs527338572 871 dbSNP
rs12550520 881 dbSNP
rs1245419350 885 dbSNP
rs1176226333 901 dbSNP
rs749166802 902 dbSNP
rs937078708 903 dbSNP
rs896112804 915 dbSNP
rs1389202583 916 dbSNP
rs1427467994 923 dbSNP
rs868729723 924 dbSNP
rs1170076232 932 dbSNP
rs1417909449 938 dbSNP
rs560232562 940 dbSNP
rs552367493 946 dbSNP
rs1404550291 950 dbSNP
rs1488798978 951 dbSNP
rs1257308169 953 dbSNP
rs1208974887 955 dbSNP
rs1484394142 956 dbSNP
rs146233277 962 dbSNP
rs773058530 963 dbSNP
rs945702065 990 dbSNP
rs1410746896 993 dbSNP
rs1443232740 1000 dbSNP
rs1203829836 1001 dbSNP
rs1196870620 1007 dbSNP
rs1226540618 1010 dbSNP
rs913172709 1018 dbSNP
rs1340503814 1026 dbSNP
rs16918879 1031 dbSNP
rs1288377361 1047 dbSNP
rs1220421774 1051 dbSNP
rs1453794244 1051 dbSNP
rs982935544 1052 dbSNP
rs761714095 1053 dbSNP
rs1447122135 1056 dbSNP
rs931468519 1061 dbSNP
rs1292498449 1064 dbSNP
rs920204939 1066 dbSNP
rs562623815 1072 dbSNP
rs544065947 1075 dbSNP
rs911072193 1080 dbSNP
rs985221148 1081 dbSNP
rs1412527793 1082 dbSNP
rs1403995345 1083 dbSNP
rs1461937008 1087 dbSNP
rs1319788362 1089 dbSNP
rs964399911 1102 dbSNP
rs1019583959 1103 dbSNP
rs1432904022 1108 dbSNP
rs1320547618 1109 dbSNP
rs1327193605 1110 dbSNP
rs986901418 1117 dbSNP
rs1282835041 1132 dbSNP
rs1337382689 1143 dbSNP
rs573619981 1144 dbSNP
rs1234500993 1148 dbSNP
rs1268050401 1150 dbSNP
rs1463166070 1171 dbSNP
rs1303070744 1172 dbSNP
rs1262028519 1185 dbSNP
rs1460994572 1187 dbSNP
rs1408498915 1188 dbSNP
rs1184927585 1207 dbSNP
rs1370030197 1207 dbSNP
rs1352284124 1208 dbSNP
rs1475410277 1216 dbSNP
rs1173419577 1220 dbSNP
rs73685072 1228 dbSNP
rs1417573929 1231 dbSNP
rs1385723670 1233 dbSNP
rs1395718098 1236 dbSNP
rs1332420735 1237 dbSNP
rs375007692 1249 dbSNP
rs994167277 1250 dbSNP
rs1000736514 1251 dbSNP
rs1241762271 1256 dbSNP
rs540047416 1258 dbSNP
rs961656321 1260 dbSNP
rs1025252518 1265 dbSNP
rs73685071 1273 dbSNP
rs763253460 1275 dbSNP
rs1176857421 1289 dbSNP
rs1343653914 1294 dbSNP
rs879182685 1297 dbSNP
rs1198435701 1299 dbSNP
rs1023978169 1302 dbSNP
rs1485884238 1310 dbSNP
rs1033858256 1312 dbSNP
rs72657080 1317 dbSNP
rs1260124495 1319 dbSNP
rs769729745 1322 dbSNP
rs538636340 1327 dbSNP
rs896152474 1335 dbSNP
rs577998542 1337 dbSNP
rs1056107256 1353 dbSNP
rs78410879 1355 dbSNP
rs1377444047 1361 dbSNP
rs1272315020 1363 dbSNP
rs1435756805 1364 dbSNP
rs34898205 1365 dbSNP
rs886217915 1367 dbSNP
rs1348989548 1372 dbSNP
rs1393702568 1373 dbSNP
rs1308329937 1376 dbSNP
rs1330006425 1377 dbSNP
rs1048789769 1383 dbSNP
rs781568408 1395 dbSNP
rs1042809888 1396 dbSNP
rs538491219 1399 dbSNP
rs1348103889 1402 dbSNP
rs1203963786 1411 dbSNP
rs931519321 1413 dbSNP
rs1481485326 1417 dbSNP
rs945761699 1423 dbSNP
rs1177778688 1424 dbSNP
rs891469085 1426 dbSNP
rs1266508819 1430 dbSNP
rs1342057719 1449 dbSNP
rs1196790155 1461 dbSNP
rs1312929003 1479 dbSNP
rs1390502897 1481 dbSNP
rs1397154411 1488 dbSNP
rs182998141 1500 dbSNP
rs1369161028 1501 dbSNP
rs1299255410 1505 dbSNP
rs942944160 1505 dbSNP
rs767353398 1506 dbSNP
rs150177803 1513 dbSNP
rs753025743 1520 dbSNP
rs1305040207 1521 dbSNP
rs116819712 1525 dbSNP
rs985293411 1527 dbSNP
rs1294940058 1529 dbSNP
rs931144450 1530 dbSNP
rs1309045262 1537 dbSNP
rs1269872494 1539 dbSNP
rs1459721616 1542 dbSNP
rs11539105 1544 dbSNP
rs973213056 1545 dbSNP
rs1215457445 1551 dbSNP
rs1417612692 1564 dbSNP
rs1468959491 1564 dbSNP
rs1240091620 1568 dbSNP
rs1188167761 1569 dbSNP
rs117301546 1573 dbSNP
rs551487162 1576 dbSNP
rs1430686747 1586 dbSNP
rs1171514383 1594 dbSNP
rs1025400417 1596 dbSNP
rs1468097632 1612 dbSNP
rs754677049 1613 dbSNP
rs1328504280 1625 dbSNP
rs1394668917 1633 dbSNP
rs1023437004 1635 dbSNP
rs370995098 1650 dbSNP
rs960679136 1651 dbSNP
rs1311796906 1653 dbSNP
rs753461719 1654 dbSNP
rs190471538 1658 dbSNP
rs1237860794 1660 dbSNP
rs1273657944 1670 dbSNP
rs1351138226 1671 dbSNP
rs1208131660 1672 dbSNP
rs1240612891 1674 dbSNP
rs886103583 1679 dbSNP
rs1446802015 1686 dbSNP
rs1255973164 1688 dbSNP
rs749891075 1694 dbSNP
rs777208207 1702 dbSNP
rs994567903 1709 dbSNP
rs1456273803 1713 dbSNP
rs1156270877 1728 dbSNP
rs1346426172 1746 dbSNP
rs898678182 1753 dbSNP
rs1301890210 1755 dbSNP
rs1376701166 1761 dbSNP
rs904010698 1762 dbSNP
rs1021105013 1767 dbSNP
rs1416329915 1771 dbSNP
rs1293852325 1789 dbSNP
rs1322097521 1791 dbSNP
rs1226462797 1794 dbSNP
rs562476969 1797 dbSNP
rs1318799220 1798 dbSNP
rs868239001 1813 dbSNP
rs1216860502 1817 dbSNP
rs1010420957 1829 dbSNP
rs912848529 1830 dbSNP
rs148522536 1835 dbSNP
rs1258870430 1840 dbSNP
rs1472575829 1848 dbSNP
rs186183945 1852 dbSNP
rs1409604598 1867 dbSNP
rs1158414457 1869 dbSNP
rs573347088 1870 dbSNP
rs1174927504 1871 dbSNP
rs1373187437 1872 dbSNP
rs1313301060 1874 dbSNP
rs767022760 1874 dbSNP
rs561689909 1875 dbSNP
rs761070128 1876 dbSNP
rs1407981739 1878 dbSNP
rs979522848 1884 dbSNP
rs1375626336 1892 dbSNP
rs1224355548 1899 dbSNP
rs1278215065 1903 dbSNP
rs1041116531 1909 dbSNP
rs1453821277 1910 dbSNP
rs1213252022 1915 dbSNP
rs1281559657 1916 dbSNP
rs1482927881 1917 dbSNP
rs540036932 1918 dbSNP
rs1203036538 1924 dbSNP
rs761838917 1934 dbSNP
rs1470216379 1935 dbSNP
rs968134395 1939 dbSNP
rs1392686997 1947 dbSNP
rs751106847 1948 dbSNP
rs1196636671 1953 dbSNP
rs1453313165 1959 dbSNP
rs1173861807 1961 dbSNP
rs1369793629 1962 dbSNP
rs1407937619 1965 dbSNP
rs1267785226 1971 dbSNP
rs1354990015 1981 dbSNP
rs1443065904 1982 dbSNP
rs181143951 1984 dbSNP
rs1487192337 1991 dbSNP
rs1368852337 1993 dbSNP
rs1304353633 1997 dbSNP
rs889738433 1997 dbSNP
rs1287654953 1998 dbSNP
rs1213123916 2000 dbSNP
rs1275755166 2006 dbSNP
rs1438938765 2007 dbSNP
rs1240459500 2016 dbSNP
rs189983781 2017 dbSNP
rs1461884978 2018 dbSNP
rs1049612541 2022 dbSNP
rs1193884294 2024 dbSNP
rs931175107 2026 dbSNP
rs1474317865 2032 dbSNP
rs1236058055 2041 dbSNP
rs751460684 2047 dbSNP
rs746421878 2055 dbSNP
rs1004716877 2057 dbSNP
rs1323797191 2062 dbSNP
rs763957697 2065 dbSNP
rs1443115258 2070 dbSNP
rs1326851367 2077 dbSNP
rs1318255684 2080 dbSNP
rs1225475165 2084 dbSNP
rs1272337281 2086 dbSNP
rs1228318856 2091 dbSNP
rs1398480076 2091 dbSNP
rs878892803 2095 dbSNP
rs1362871635 2096 dbSNP
rs1298989846 2098 dbSNP
rs545453009 2099 dbSNP
rs534218312 2101 dbSNP
rs578051800 2102 dbSNP
rs1400141448 2108 dbSNP
rs994892963 2127 dbSNP
rs556553226 2129 dbSNP
rs1194850508 2134 dbSNP
rs74612764 2136 dbSNP
rs940110580 2139 dbSNP
rs529789079 2140 dbSNP
rs1162714202 2143 dbSNP
rs1419875518 2143 dbSNP
rs773688491 2145 dbSNP
rs1165797241 2147 dbSNP
rs918003686 2147 dbSNP
rs1039187544 2154 dbSNP
rs1380800477 2156 dbSNP
rs772526554 2156 dbSNP
rs992608689 2158 dbSNP
rs1378074880 2159 dbSNP
rs1327394060 2161 dbSNP
rs1051357249 2162 dbSNP
rs1234406038 2162 dbSNP
rs1292004529 2162 dbSNP
rs370206297 2162 dbSNP
rs544444776 2162 dbSNP
rs891261473 2162 dbSNP
rs959343396 2163 dbSNP
rs574382670 2167 dbSNP
rs1192408247 2174 dbSNP
rs935542305 2177 dbSNP
rs1476693383 2179 dbSNP
rs1284441558 2181 dbSNP
rs531008812 2182 dbSNP
rs1033961505 2186 dbSNP
rs1485176461 2193 dbSNP
rs1043771245 2198 dbSNP
rs1475521718 2210 dbSNP
rs1181344113 2217 dbSNP
rs979694391 2218 dbSNP
rs553492483 2220 dbSNP
rs960573313 2221 dbSNP
rs1434523638 2225 dbSNP
rs1201610095 2226 dbSNP
rs1377632869 2227 dbSNP
rs754249957 2235 dbSNP
rs1306915272 2236 dbSNP
rs927766965 2237 dbSNP
rs968266408 2239 dbSNP
rs1240498232 2241 dbSNP
rs1279799064 2243 dbSNP
rs983351002 2254 dbSNP
rs1208246548 2260 dbSNP
rs1270078644 2261 dbSNP
rs1282271744 2261 dbSNP
rs1217371361 2266 dbSNP
rs1021543289 2270 dbSNP
rs1248255403 2271 dbSNP
rs1417427453 2271 dbSNP
rs556122590 2272 dbSNP
rs1342738283 2273 dbSNP
rs950659922 2281 dbSNP
rs536450674 2286 dbSNP
rs774066499 2289 dbSNP
rs1009704030 2290 dbSNP
rs200531883 2291 dbSNP
rs1171995918 2301 dbSNP
rs1414391512 2303 dbSNP
rs1377722390 2311 dbSNP
rs1435658513 2314 dbSNP
rs956016581 2316 dbSNP
rs1357574777 2319 dbSNP
rs1393611319 2319 dbSNP
rs1329000187 2320 dbSNP
rs1019357628 2321 dbSNP
rs1231708547 2323 dbSNP
rs1305087937 2324 dbSNP
rs867729252 2325 dbSNP
rs763305301 2326 dbSNP
rs1348340623 2332 dbSNP
rs1226358885 2335 dbSNP
rs889435871 2336 dbSNP
rs185868074 2337 dbSNP
rs1249579363 2341 dbSNP
rs1049354372 2347 dbSNP
rs113710971 2353 dbSNP
rs1415059853 2354 dbSNP
rs898386576 2357 dbSNP
rs1037309786 2358 dbSNP
rs1238933785 2360 dbSNP
rs939868999 2365 dbSNP
rs1191995600 2368 dbSNP
rs545567480 2371 dbSNP
rs964731287 2372 dbSNP
rs1170234592 2374 dbSNP
rs1371675830 2381 dbSNP
rs1017358502 2384 dbSNP
rs1009031460 2385 dbSNP
rs1464040379 2387 dbSNP
rs756333602 2388 dbSNP
rs1371226294 2393 dbSNP
rs551704952 2396 dbSNP
rs1056539592 2403 dbSNP
rs1228150845 2403 dbSNP
rs1235332417 2405 dbSNP
rs1334280205 2412 dbSNP
rs1211847307 2416 dbSNP
rs1254929281 2417 dbSNP
rs1488955602 2417 dbSNP
rs1186131334 2418 dbSNP
rs1189218597 2419 dbSNP
rs1442457316 2422 dbSNP
rs1271726635 2429 dbSNP
rs1197279492 2432 dbSNP
rs762357243 2432 dbSNP
rs1459443357 2437 dbSNP
rs938050361 2439 dbSNP
rs1394549214 2444 dbSNP
rs878865237 2446 dbSNP
rs1320702465 2450 dbSNP
rs1259271609 2452 dbSNP
rs1382522004 2452 dbSNP
rs926628163 2454 dbSNP
rs1232992217 2455 dbSNP
rs1044359428 2458 dbSNP
rs979388491 2468 dbSNP
rs1377459064 2473 dbSNP
rs1275186468 2479 dbSNP
rs946776945 2480 dbSNP
rs895098572 2483 dbSNP
rs1055223392 2484 dbSNP
rs767643456 2495 dbSNP
rs1474541615 2502 dbSNP
rs1190680914 2505 dbSNP
rs1417936910 2507 dbSNP
rs759590717 2507 dbSNP
rs1156515272 2508 dbSNP
rs1449080164 2509 dbSNP
rs1454152750 2512 dbSNP
rs968297214 2513 dbSNP
rs148048456 2514 dbSNP
rs939408980 2522 dbSNP
rs1293757793 2524 dbSNP
rs1223244133 2526 dbSNP
rs914150846 2526 dbSNP
rs1305169761 2527 dbSNP
rs181087874 2530 dbSNP
rs1318995996 2534 dbSNP
rs567328032 2534 dbSNP
rs988753674 2535 dbSNP
rs1484894152 2548 dbSNP
rs1213651504 2549 dbSNP
rs1171318332 2559 dbSNP
rs1238500631 2560 dbSNP
rs928035231 2561 dbSNP
rs966218782 2563 dbSNP
rs1174934698 2564 dbSNP
rs1409477160 2566 dbSNP
rs1411397686 2569 dbSNP
rs1172561558 2570 dbSNP
rs1393116714 2573 dbSNP
rs1164609678 2577 dbSNP
rs1436341746 2581 dbSNP
rs1334808679 2582 dbSNP
rs1353825982 2583 dbSNP
rs572448086 2583 dbSNP
rs1472950611 2587 dbSNP
rs765253006 2590 dbSNP
rs1241154215 2593 dbSNP
rs1176162140 2598 dbSNP
rs1346235529 2600 dbSNP
rs1019809740 2605 dbSNP
rs1236922170 2610 dbSNP
rs73685070 2611 dbSNP
rs1381242657 2616 dbSNP
rs1234123721 2617 dbSNP
rs1457820991 2624 dbSNP
rs1192687271 2625 dbSNP
rs1250731082 2630 dbSNP
rs973691100 2631 dbSNP
rs748828747 2632 dbSNP
rs1239268097 2633 dbSNP
rs34833311 2636 dbSNP
rs1418469776 2638 dbSNP
rs1408152115 2640 dbSNP
rs1213649462 2650 dbSNP
rs1320257087 2653 dbSNP
rs964418763 2654 dbSNP
rs1402629446 2662 dbSNP
rs1447589651 2665 dbSNP
rs1325536459 2669 dbSNP
rs1017662324 2673 dbSNP
rs576789401 2674 dbSNP
rs73685069 2676 dbSNP
rs1339071801 2691 dbSNP
rs1027945604 2695 dbSNP
rs550151793 2696 dbSNP
rs1275708635 2697 dbSNP
rs4507756 2698 dbSNP
rs561627923 2699 dbSNP
rs902679874 2700 dbSNP
rs1449018789 2701 dbSNP
rs771491905 2703 dbSNP
rs1241309820 2704 dbSNP
rs1474300560 2705 dbSNP
rs546525365 2706 dbSNP
rs1056678065 2707 dbSNP
rs769699906 2711 dbSNP
rs895161454 2711 dbSNP
rs201416786 2714 dbSNP
rs200668110 2716 dbSNP
rs1326274240 2718 dbSNP
rs1407303603 2718 dbSNP
rs148273510 2718 dbSNP
rs553943290 2718 dbSNP
rs59691966 2718 dbSNP
rs770185483 2718 dbSNP
rs926659148 2720 dbSNP
rs1347881330 2725 dbSNP
rs1280695549 2726 dbSNP
rs1341715806 2729 dbSNP
rs1325348849 2730 dbSNP
rs879648785 2730 dbSNP
rs1233157860 2733 dbSNP
rs1055559787 2737 dbSNP
rs777955398 2737 dbSNP
rs1405743776 2738 dbSNP
rs1210133190 2739 dbSNP
rs190359574 2740 dbSNP
rs1043782335 2742 dbSNP
rs1445113506 2743 dbSNP
rs946695744 2744 dbSNP
rs1263575967 2745 dbSNP
rs1474850179 2745 dbSNP
rs1156479304 2746 dbSNP
rs1415860683 2747 dbSNP
rs1440955721 2752 dbSNP
rs564281291 2754 dbSNP
rs1380418090 2755 dbSNP
rs1399137057 2759 dbSNP
rs747498217 2764 dbSNP
rs757129456 2766 dbSNP
rs1487822455 2768 dbSNP
rs914161787 2769 dbSNP
rs1248810656 2770 dbSNP
rs35458405 2770 dbSNP
rs988396036 2776 dbSNP
rs939341891 2781 dbSNP
rs1387324570 2785 dbSNP
rs1414713252 2785 dbSNP
rs752800147 2786 dbSNP
rs1341804114 2787 dbSNP
rs779198308 2788 dbSNP
rs184558557 2790 dbSNP
rs1348133503 2791 dbSNP
rs1284090514 2793 dbSNP
rs1242629494 2799 dbSNP
rs1047802219 2802 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166 , TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000356457.5 | 3UTR | CUCCUGCUCCCCUCUCCCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000356457.5 | 3UTR | CCUGCUCCCCUCUCCCCUCAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000356457.5 | 3UTR | ACCCAUUAACCAUCUUCACCUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.79 2.2e-6 -0.754 1.0e-5 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.682 4.6e-4 0.729 1.3e-4 20 Click to see details
GSE26953 Aortic valvular endothelial cells -0.373 3.6e-2 -0.438 1.6e-2 24 Click to see details
GSE19536 Breast cancer -0.166 4.9e-2 -0.157 5.9e-2 100 Click to see details
GSE42095 Differentiated embryonic stem cells 0.323 6.6e-2 0.349 5.1e-2 23 Click to see details
GSE17498 Multiple myeloma 0.212 9.5e-2 0.288 3.6e-2 40 Click to see details
GSE19783 ER- ER- breast cancer -0.143 1.0e-1 -0.124 1.4e-1 79 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.26 1.0e-1 -0.325 5.6e-2 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.281 1.2e-1 -0.289 1.1e-1 20 Click to see details
GSE19350 CNS germ cell tumors 0.306 1.7e-1 0.383 1.1e-1 12 Click to see details
GSE32688 Pancreatic cancer 0.122 2.5e-1 0.078 3.4e-1 32 Click to see details
GSE21032 Prostate cancer -0.056 3.1e-1 -0.034 3.8e-1 83 Click to see details
GSE28260 Renal cortex and medulla -0.151 3.1e-1 -0.192 2.6e-1 13 Click to see details
GSE21687 Ependynoma primary tumors -0.022 4.3e-1 0.060 3.2e-1 64 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.026 4.5e-1 0.300 7.3e-2 25 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.034 4.7e-1 -0.283 2.3e-1 9 Click to see details
GSE38226 Liver fibrosis 0.008 4.9e-1 -0.161 2.4e-1 21 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC 0.516 0.02 0.471 0.03 16 Click to see details
BLCA -0.569 0.02 -0.533 0.03 13 Click to see details
KICH 0.354 0.05 0.260 0.12 22 Click to see details
LIHC 0.235 0.07 0.144 0.18 42 Click to see details
KIRP 0.26 0.11 0.310 0.07 24 Click to see details
CESC -0.892 0.15 -1.000 0.5 3 Click to see details
STAD 0.168 0.2 0.063 0.38 27 Click to see details
THCA 0.116 0.21 0.198 0.08 50 Click to see details
ESCA -0.305 0.21 -0.667 0.02 9 Click to see details
BRCA 0.078 0.27 0.052 0.34 64 Click to see details
CHOL 0.35 0.28 0.800 0.05 5 Click to see details
PAAD -0.586 0.3 -0.500 0.33 3 Click to see details
KIRC -0.094 0.33 -0.116 0.29 24 Click to see details
PCPG 0.113 0.46 0.500 0.33 3 Click to see details
LUSC 0.015 0.47 -0.047 0.4 34 Click to see details
PRAD -0.025 0.47 -0.049 0.44 12 Click to see details
HNSC 0.013 0.47 -0.023 0.45 37 Click to see details
LUAD -0.023 0.48 -0.167 0.35 8 Click to see details
COAD 0.014 0.49 -0.095 0.41 8 Click to see details
COAD 0.014 0.49 -0.095 0.41 8 Click to see details
COAD 0.014 0.49 -0.095 0.41 8 Click to see details
137 hsa-miR-939-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016026 IL6 interleukin 6 1 1
MIRT036634 SH3BP2 SH3 domain binding protein 2 1 1
MIRT036636 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT168693 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT189766 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT443840 RGS6 regulator of G protein signaling 6 2 2
MIRT446198 GTPBP4 GTP binding protein 4 2 2
MIRT448037 SFRP1 secreted frizzled related protein 1 2 2
MIRT451304 LGALS3BP galectin 3 binding protein 2 2
MIRT452319 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT453237 FTSJ3 FtsJ RNA methyltransferase homolog 3 2 2
MIRT453499 ARRB1 arrestin beta 1 2 2
MIRT453539 PRR12 proline rich 12 2 2
MIRT454899 SEPT8 septin 8 2 16
MIRT456442 TMEM81 transmembrane protein 81 2 2
MIRT456682 LDB1 LIM domain binding 1 2 2
MIRT457128 ASPH aspartate beta-hydroxylase 2 2
MIRT457177 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT457597 IDS iduronate 2-sulfatase 2 2
MIRT458303 TNFAIP8L3 TNF alpha induced protein 8 like 3 2 2
MIRT458441 RPRM reprimo, TP53 dependent G2 arrest mediator homolog 2 2
MIRT460644 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT461453 SLC19A3 solute carrier family 19 member 3 2 2
MIRT462767 ZNF8 zinc finger protein 8 2 2
MIRT462989 ZNF740 zinc finger protein 740 2 2
MIRT463678 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464110 VPS35 VPS35, retromer complex component 2 2
MIRT464412 UNC13A unc-13 homolog A 2 6
MIRT468613 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469602 RALGAPA2 Ral GTPase activating protein catalytic alpha subunit 2 2 2
MIRT469653 RAC1 Rac family small GTPase 1 2 2
MIRT473286 MFRP membrane frizzled-related protein 2 2
MIRT473602 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT473659 MARCKSL1 MARCKS like 1 2 2
MIRT474691 KIF5A kinesin family member 5A 2 2
MIRT475660 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT477622 EFNA1 ephrin A1 2 2
MIRT478123 DIRAS1 DIRAS family GTPase 1 2 2
MIRT478439 DAZAP2 DAZ associated protein 2 2 4
MIRT478948 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT479969 CARD10 caspase recruitment domain family member 10 2 2
MIRT480400 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT482807 TRAF6 TNF receptor associated factor 6 2 2
MIRT482943 ZNF561 zinc finger protein 561 2 6
MIRT483651 QSOX2 quiescin sulfhydryl oxidase 2 2 4
MIRT485374 MSN moesin 2 4
MIRT485761 B4GALT5 beta-1,4-galactosyltransferase 5 2 2
MIRT485923 PGPEP1 pyroglutamyl-peptidase I 2 4
MIRT486240 FASTK Fas activated serine/threonine kinase 2 2
MIRT486844 SLC9A3R2 SLC9A3 regulator 2 2 2
MIRT486931 DTX2 deltex E3 ubiquitin ligase 2 2 2
MIRT487110 SCARF2 scavenger receptor class F member 2 2 2
MIRT487183 NFASC neurofascin 2 4
MIRT487208 HMX1 H6 family homeobox 1 2 2
MIRT487317 UBFD1 ubiquitin family domain containing 1 2 4
MIRT487809 PER3 period circadian clock 3 2 2
MIRT487828 CLSTN1 calsyntenin 1 2 4
MIRT488184 MAT1A methionine adenosyltransferase 1A 2 2
MIRT488637 HAND2 heart and neural crest derivatives expressed 2 2 2
MIRT488844 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT489101 ABCC5 ATP binding cassette subfamily C member 5 2 4
MIRT489220 ASCL2 achaete-scute family bHLH transcription factor 2 2 4
MIRT489354 SYNGR1 synaptogyrin 1 2 4
MIRT489729 GNAI2 G protein subunit alpha i2 2 4
MIRT489770 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT490573 SLC47A1 solute carrier family 47 member 1 2 2
MIRT490776 PSMD3 proteasome 26S subunit, non-ATPase 3 2 2
MIRT491529 HDAC5 histone deacetylase 5 2 2
MIRT492276 SHISA6 shisa family member 6 2 4
MIRT492700 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT493311 LIMD2 LIM domain containing 2 2 2
MIRT493541 ICOSLG inducible T-cell costimulator ligand 2 4
MIRT494326 CASKIN1 CASK interacting protein 1 2 2
MIRT494828 ADCY9 adenylate cyclase 9 2 2
MIRT496769 ADAMTS14 ADAM metallopeptidase with thrombospondin type 1 motif 14 2 2
MIRT496971 RPS6KA2 ribosomal protein S6 kinase A2 2 2
MIRT497036 DYRK1B dual specificity tyrosine phosphorylation regulated kinase 1B 2 2
MIRT498911 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT500012 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT502228 HOXC6 homeobox C6 2 2
MIRT504105 FLOT1 flotillin 1 2 2
MIRT506428 NAGK N-acetylglucosamine kinase 2 6
MIRT507334 FAM168A family with sequence similarity 168 member A 2 2
MIRT507779 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT510060 C12orf49 chromosome 12 open reading frame 49 2 4
MIRT511183 MAPRE1 microtubule associated protein RP/EB family member 1 2 2
MIRT511933 FAM127B retrotransposon Gag like 8A 2 2
MIRT513516 YIPF4 Yip1 domain family member 4 2 6
MIRT527160 ADRA2B adrenoceptor alpha 2B 2 2
MIRT535348 PFN1 profilin 1 2 2
MIRT536732 IER5 immediate early response 5 2 4
MIRT539177 AP1G1 adaptor related protein complex 1 gamma 1 subunit 2 2
MIRT544641 PHF8 PHD finger protein 8 2 4
MIRT553365 TRIM44 tripartite motif containing 44 2 2
MIRT568465 ARMC12 armadillo repeat containing 12 2 2
MIRT568969 CACNA1C calcium voltage-gated channel subunit alpha1 C 2 2
MIRT569007 CXorf36 chromosome X open reading frame 36 2 2
MIRT569035 IL21R interleukin 21 receptor 2 2
MIRT569719 GPR173 G protein-coupled receptor 173 2 2
MIRT569865 KLK10 kallikrein related peptidase 10 2 2
MIRT569912 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT570010 COL1A2 collagen type I alpha 2 chain 2 2
MIRT570058 CPNE2 copine 2 2 2
MIRT570305 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT570723 CELSR2 cadherin EGF LAG seven-pass G-type receptor 2 2 2
MIRT570980 RGS19 regulator of G protein signaling 19 2 2
MIRT571194 C9orf62 chromosome 9 open reading frame 62 2 2
MIRT572263 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT573213 NAT10 N-acetyltransferase 10 2 2
MIRT574021 RIMBP3C RIMS binding protein 3C 2 2
MIRT574392 TMEM109 transmembrane protein 109 2 2
MIRT574631 LPCAT3 lysophosphatidylcholine acyltransferase 3 2 2
MIRT574688 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 2 2
MIRT606795 BICD2 BICD cargo adaptor 2 2 2
MIRT613843 SHB SH2 domain containing adaptor protein B 2 2
MIRT621599 USF2 upstream transcription factor 2, c-fos interacting 2 2
MIRT631042 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT631301 CBS cystathionine-beta-synthase 2 2
MIRT647748 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT649337 HEXA hexosaminidase subunit alpha 2 2
MIRT649992 MSI1 musashi RNA binding protein 1 2 2
MIRT661784 NLRC3 NLR family CARD domain containing 3 2 2
MIRT665990 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT667175 NR2F6 nuclear receptor subfamily 2 group F member 6 2 4
MIRT667384 MOB1B MOB kinase activator 1B 2 2
MIRT669205 CBX8 chromobox 8 2 2
MIRT680927 EVC EvC ciliary complex subunit 1 2 2
MIRT691868 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT693256 HBS1L HBS1 like translational GTPase 2 2
MIRT693488 MOB3A MOB kinase activator 3A 2 2
MIRT699479 SLC10A6 solute carrier family 10 member 6 2 2
MIRT717095 PXDC1 PX domain containing 1 2 2
MIRT717120 SOWAHA sosondowah ankyrin repeat domain family member A 2 2
MIRT717641 HLX H2.0 like homeobox 2 2
MIRT722583 THBS2 thrombospondin 2 2 2
MIRT736292 IGF1R insulin like growth factor 1 receptor 3 0
MIRT737162 NOS2 nitric oxide synthase 2 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-939 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-939 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-939 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-939 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-939-5p -d-xylose 24203222 NSC727221 sensitive
hsa-miR-939-5p (-)7,8-dihydrocalanolide a 383107 NSC682400 sensitive
hsa-miR-939-5p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-939-5p (2E)-2-[2-(4-bromophenyl)-2-oxoethylidene]-5-(2,4-dimethylphenyl)furan-3-one 5468713 NSC674919 sensitive
hsa-miR-939-5p (nz)-n-[1-[4-[(4-imidazol-1-ylquinolin-2-yl)amino]phenyl]ethylidene]hydroxylamine 24204871 NSC733301 sensitive
hsa-miR-939-5p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-939-5p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-939-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-939-5p [[5-[(4-bromophenyl)diazenyl]-2-hydroxyphenyl]-[2-[3-(2-chloroanilino)-3-oxopropanoyl]hydrazinyl]methyl]phosphonous acid 377940 NSC659608 sensitive
hsa-miR-939-5p [2-amino-9-[3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-1H-purin-6-ylidene]sulfanium;(2-hydroxy-5-nitrophenyl)mercury 135403618 NSC321239 sensitive
hsa-miR-939-5p [bis(aminomethyl)diethylsilane]dichloroplatinum (ii) NSC645351 sensitive
hsa-miR-939-5p [dibutyl-(2,6-difluorobenzoyl)oxy-stannyl] 2,6-difluorobenzoate 16683188 NSC643841 sensitive
hsa-miR-939-5p 1-[2-(2,4-dinitrophenyl)sulfonyl-1-methylene-allyl]sulfonyl-2,4-dinitro-benzene 361138 NSC623970 sensitive
hsa-miR-939-5p 1h-benzo[a]carbazole-1,4(11h)-dione, 11-methyl- 261066 NSC92937 sensitive
hsa-miR-939-5p 1h-imidazole-4-carboxamide, 5-(3-methyl-1-tetrazenyl)- 135493930 NSC684047 sensitive
hsa-miR-939-5p 2-(4-methylphenyl)-5-(2-naphthyl)-1,3,4-oxadiazole 260000 NSC90810 sensitive
hsa-miR-939-5p 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxamide 24204601 NSC732287 resistant
hsa-miR-939-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-939-5p 2-[[(2-aminobenzoyl)oxy-dibutyl-stannyl]amino]benzoic acid 16684416 NSC628572 sensitive
hsa-miR-939-5p 2-[3-chloro-3-(4-chloro-phenyl)-allylidene]-malononitrile 5473313 NSC725048 sensitive
hsa-miR-939-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-939-5p 2-methyl-1-(2,3,4,5,6-pentafluorobenzoyl)-1h-benzimidazole 383504 NSC671889 sensitive
hsa-miR-939-5p 2-nitro-1-phenylpropan-1-ol 226118 NSC16258 sensitive
hsa-miR-939-5p 2,5-cyclohexadiene-1,4-dione, 2,3-dimethoxy-5-(2-naphthalenylthio)- 314728 NSC234214 sensitive
hsa-miR-939-5p 3-iodoacetamido-benzoic acid ethyl ester 398530 NSC708445 sensitive
hsa-miR-939-5p 3,4,5-trimethoxy-n-(4h-pyrrolo[2,1-c][1,4]benzoxazin-1-ylmethyl)aniline 403776 NSC719249 sensitive
hsa-miR-939-5p 3,4,8-trimethyl-7-((2-methyl-4-methylene-5-oxotetrahydro-2-furanyl)methoxy)-2h-chromen-2-one 381508 NSC668264 sensitive
hsa-miR-939-5p 4-(6-thioguanine)-7-nitro-2,1,3-benzoxadiazole 3246652 NSC348401 sensitive
hsa-miR-939-5p 4-[(2Z)-2-[1-amino-3-(methylamino)-1,3-bis(sulfanylidene)propan-2-ylidene]hydrazinyl]-1H-imidazole-5-carboxamide 5466293 NSC684046 sensitive
hsa-miR-939-5p 4-[(6-sulfanylidene-3,7-dihydropurin-8-yl)diazenyl]benzenesulfonamide 3246283 NSC75140 sensitive
hsa-miR-939-5p 4-[(z)-indolo[1,2-b]indazol-11-ylidenemethyl]-n,n-dimethylaniline 5472473 NSC719163 sensitive
hsa-miR-939-5p 5,7-bis(dibromomethyl)-3-nitropyrazolo[1,5-a]pyrimidin-2-amine 384486 NSC674312 sensitive
hsa-miR-939-5p 7-benzyl-3-[(e)-3-oxo-3-phenylprop-1-enyl]-16-thia-2,4,5,7-tetrazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10(15)-tetraen-8-one 45028585 NSC743396 sensitive
hsa-miR-939-5p 7-chloro-10,11-dimethoxy-2,8-diazatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene-3,4-dione 397794 NSC706232 sensitive
hsa-miR-939-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-939-5p 8(5h)-quinolinone, 7-chloro-5-[[4-(diethylamino)-2-methylphenyl]imino]- 363174 NSC627778 sensitive
hsa-miR-939-5p Aplidazole c . tfa 362402 NSC626167 sensitive
hsa-miR-939-5p Artelasticin 5471311 NSC710342 sensitive
hsa-miR-939-5p Benzene, 1,1'-[(1,3-butadiene-1,4-diyl)sulfonyl]bis 5468033 NSC662781 sensitive
hsa-miR-939-5p Benzo[1,2-c:4,5-c']dipyrrole-1,3,5,7(2h,6h)-tetraimine 359178 NSC619860 sensitive
hsa-miR-939-5p Carbon monoxide;iridium;1-phenyldiazenylnaphthalen-2-olate 6711627 NSC632877 sensitive
hsa-miR-939-5p Cps49 9905583 NSC726796 sensitive
hsa-miR-939-5p Dacarbazine 5351166 NSC45388 approved sensitive
hsa-miR-939-5p Eh00008 354026 NSC603974 sensitive
hsa-miR-939-5p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 resistant
hsa-miR-939-5p Herveline o 5459269 NSC676002 sensitive
hsa-miR-939-5p Incarnal 131851 NSC648322 sensitive
hsa-miR-939-5p Leinamycin 5459203 NSC645777 sensitive
hsa-miR-939-5p M-232 403374 NSC718170 sensitive
hsa-miR-939-5p Melampodinin 5359028 NSC294600 sensitive
hsa-miR-939-5p Methyl (1S,4S)-6,11-dioxo-4-[3,4,5-triacetyloxy-6-(acetyloxymethyl)oxan-2-yl]oxy-1,4-dihydropyridazino[1,2-b]phthalazine-1-carboxylate 385569 NSC676858 sensitive
hsa-miR-939-5p Mp 317 16683647 NSC30916 sensitive
hsa-miR-939-5p N-(((2-methoxy-5-(trifluoromethyl)anilino)carbonyl)oxy)butanimidoyl chloride 9556202 NSC672059 sensitive
hsa-miR-939-5p N-(2-aminophenyl)-4-[3-(3-methyl-2,5-dioxoimidazolidin-1-yl)prop-1-en-2-yl]benzamide 11682081 NSC736099 sensitive
hsa-miR-939-5p Niveusin a 5477575 NSC331121 sensitive
hsa-miR-939-5p NSC621339 NSC621339 sensitive
hsa-miR-939-5p Pc 287 239486 NSC44580 sensitive
hsa-miR-939-5p Phenethyl 3-(3,4-dihydroxyphenyl)propanoate 380847 NSC666586 sensitive
hsa-miR-939-5p Prumycin 5458561 NSC278619 resistant
hsa-miR-939-5p Stk673848 403091 NSC717563 resistant
hsa-miR-939-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-939-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-939-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-939-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-939-5p Bortezomib 387447 NSC681239 approved resistant High Multiple Myeloma cell line
hsa-miR-939-5p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor tissue
hsa-miR-939-5p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-939-5p Capecitabine + Oxaliplatin resistant High Colon Adenocarcinoma tissue
hsa-miR-939-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (AGS, BGC-823, HGC-27, MGC-803, MNK-45, SGC-7901)
hsa-miR-939-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116, HT-29)
hsa-miR-939-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-939-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-939-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-939-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-939-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-939-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-939-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-939-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-939-5p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-939-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-939-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission