| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4534 |
| Genomic Coordinates | chr22: 37988794 - 37988853 |
| Description | Homo sapiens miR-4534 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4534 | ||||||||||||
| Sequence | 36| GGAUGGAGGAGGGGUCU |52 | ||||||||||||
| Evidence | Experimental | ||||||||||||
| Experiments | Illumina | ||||||||||||
| SNPs in miRNA |
|
||||||||||||
| Putative Targets | |||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | POFUT2 | ||||||||||||||||||||
| Synonyms | C21orf80, FUT13 | ||||||||||||||||||||
| Description | protein O-fucosyltransferase 2 | ||||||||||||||||||||
| Transcript | NM_015227 | ||||||||||||||||||||
| Other Transcripts | NM_133635 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on POFUT2 | |||||||||||||||||||||
| 3'UTR of POFUT2 (miRNA target sites are highlighted) |
>POFUT2|NM_015227|3'UTR 1 GTCTCCTGTAGCATCTGGTTCAGTGTTTCCCTGGGCTGAAGTTAATTGTTCATCTTGCCCCTTTAGTTCTCATGCACAGA 81 ATTCCTCCATAGCAGGCTGTTGGCATAGCTGGCCTCGTCTCAGAACCTCTTCTTGTGTCGCATTTTCCCATCATTCCCGG 161 TTTCTGCCCCTGTCTGCCCCCTGCCCTGAGAGTTGCCCGTGCCCTGGACTTGGGCATGTCCTTGTTGCTGTGTTGTTGAG 241 CATCCGTGAGCGTCCCCGAGGCCGGGAGCGTGGGCCCTCGTGTGATCATTCTCGTGGGGCTGCCATGAGCGTCCCCAAGG 321 CTGGGAGCATGGGCCCTCGTGTGATCGTTCTTGTGGGGCTGCCGTGAGCGTCCCCGAGGCCGGGAGCGTGGGCCCTCGTG 401 TGATCATTCTCGTGGGGCTGCCGTGAGCGTCCCAGAGGCCGGGAGCGTGGGCCCTGCGTGCAGTCATTCCTCTGGGGTTG 481 CTGTGGGAGGTACGCCTGGGCCTCTGTTCCTCCAAAGACCTGCCTGCCCATCTGCATAGGAGATGAAGGCTGGGGTTAGG 561 GTGAAACGGTTTGAGTTAAATGGAAAATGAAAGTAGAGGGAATGATCTTCCCCGTGGTTAGCACTGTGCACACGCGTGCG 641 TCTCTGTGGGTTAGTCTGTCTCTCTCCTGCCCGAGGAATGCTGAGCGCCCTGAGCCGGTGCCTCTTCACACATCTGCTAT 721 TTCCTGTGGTGTTCTGGGCATGGTGTGTAAGACCCACAGAGGCTCCGGGTGATGCTGTCTGCTGGGTGTGGGTCCCTTTC 801 CCTGTTAAGCAGACAGGATGCAGCGCTGACTTCTTAGGTCAGGGCGGAGGTGTGCAGGAGCCCAGTTACGAACTCACCCC 881 TGCTTCTCAGGTGTGGCCTTGGGATTTTGACTGCGACCTTGGCGGTGCTGTCTCCGCAGCCCAGGAAGCCTGCTGTGGGG 961 AGGCTTCGCACTGAGCTCTCAGCCTCCTGCCCTCAGCTGCGCGAAGCGCTCGGCCCAGCTCACTGAAGCTGCCCTGCCTC 1041 CGGGCCGGCGCGGCCTGCTCTGGCAGGCCCCTGTGTGTGGGGTGGTGAGGGTCTCCCCACCAGTGCTGCACCCCGCAGCA 1121 GCATACAGGCCTGTGTGGCCTGCTGGCCCTGTGGCTCTGTGTACAGCGCTGTGCATGTTACATTTGCTCTGGAAACATCT 1201 CTGGGGTTTGCTTGTTCACGAAGTTCATGAAGTGCCGCTGGAGAGCCAGAGACCAGCTGCGCAGGAGCCGGAGGAACGGG 1281 CAGGCCGCTGACCTGAGGTCTGGAGAAACCCCTGGAGAAGGGTGTCCCCACCAGCCCATACAGCGTGTGTGTGGAGGGGG 1361 CCTTGACCTCCGTGATGTCTACTGTGCCTCAGGATAAGGACCCGCCATGCCCTGGCTAGACAGTGTGTGGTTAGTAGGAA 1441 TCTCTCATTGTTCACCATGTGACCCCCAGGAGGTATTCGACCTGCACTGGCGTGCCTGGCCTGGGATTTGGTGACGGAGA 1521 GGAGGGCTCCCAGGGGGACATGCGGTGGGACAGGAGCGTGGCGGCTGCTGACTGTGGGGTGTGGATGGGGCTGCAGCACC 1601 AGGCAGAGCCCCTCAGGGCGCCGATGTCGAGGGCACCTGAGCGAGGGGTGCCAGCAAGGGGGCGGCCGGCTGGTGGGTGC 1681 TCGGGGGACGGCCGTGTTGGTTCCATGTAACTGTGGAACTCATTTCACTCAGCTGCTCCTCTCAGTTCTCCCTGACTCTG 1761 GAACCTCTGTGACGCCAGTTCTCCCTGACTCTGGAACCTCTGTGATCCTTTGCAGGTTTTTTATTGGCACCTCAGTCTCA 1841 ACATTTTCTTTTCGGATTCATGAGGAAAGAGAAATCCTGGGGTTGGACCCCAAGACGACGTACAACAGGTTCTGCGGAGA 1921 CCAAGAGAAGGCGTGTGAGCAACCCACCCACTGGAAGATCACCTACTGAGGAGGATCCTCCAGGGCCGCTCCCCGGACCC 2001 GACAGGCGCGGGTGGATGCAGGTTCTGTCGCCGTGGAGTCACCGTCTACTGCCAGCCGGGAGCTGGGCGGACAGGACCGT 2081 CCCTCGCAGGGTCCCAGGCCCAGAAGAGGCCCCACGCCTCTAGAGCTGGGCTCCGTCCTCGGCGTTGCCAGCCGCCATGG 2161 CTGATGAAGAGGCTCCGCTGCTCTCGGGGGTGGCGGTTGTTTTCAGGCAGCGTCTGTGAACCCACAGCTCGGTTGCCAGC 2241 AGTGCCCGCGTGGTGACCCAGAAGCAGGAGTGTTTGTCAGGCTCCCGCTCTGGCCTTTCCAGCCACCTTTCATGTCTTCA 2321 TATTTTAAGTGCATTGAGGATAGATGCAGGCGGGTGAGCTGCCCTCCGTCAGGTGGACCCGGGCTGACATTTCCCTGGGA 2401 GCTGGTGCAAGGAGAAGCGTCATTTTAAATGTCTGCAGAGCGACCAGGGGCCTCATGAATCTCTCCGTTGCCCTCCGCGC 2481 AGCAGGAGGCTGCCTGTGTGTTTCCTCCTGGGATGCGTGCAAGGCAGACCTGGTGCTGCAAAGGAAAGGGCCTGAGGCCT 2561 CAGGGAGCCCCGTGGAGGGATGACAGTTCAGGCCCTACTGCTGGCACGTCAGAGCACTGGGAAGTTTTTCAGTGACGTCT 2641 CTGGGGCACTCAGTGGATTGTCTGTAGGAAACTTGCAGCTCTGCTCCTCACACCAGGCCCGGCTGGCCACCCACCCTCGC 2721 CCCCACTGGCCACCCCTCCCTCGCCCCGACTGCCCCGCCCCACCCTCACCCCGACTGCCCCGCCCTCGCCCGGCTGGCCG 2801 TCCCTGCCCTCGCCCCGGCTGGCAGGTGCACATGGGGCCTCCAGGTCTGCCATTCGCTATTGAGAACTAGAAATGAGGAA 2881 GGACAGTTACGCTAACTCCAAAAGGCTGTCTAGGATGAGCTGCTTTATCAGGGAGCTCCTTGTACCCATTTTACAGAAAT 2961 CATTTTTAGGTCTTTGTGCCACCACCACGAGGGGCATCTGCAAAGAGGGCAACGCTAGACACAGAATCCGTGGAAGGTGC 3041 AGCAGTGCCTCAGGGGTCCTCAGGGTCAGGGAGCCCCCCTCACCCTCTTGGCCCGTTACCCTTTGTGACTTTCCACCATG 3121 GTGTCGTGTGACCCTCAGTCAGGTTGGTGGGGGCTGAGTCCTCACTGAGCAGCCACTTTCCACATCTGCTAGAGGAACAG 3201 TGACATGGACACCTGTGACAGAGAGAGGACAGTTAGGAGGGACAGACAGCTCTTCCTTTCGGAGCCTGGCTAGTCTAGGA 3281 CATCACCTTGCTGTGTCTTCTCAAGCTTTTAAAATTGACCCTGAACGTGTGACAGGGTCCTATGGTGTTACTCAAAGCTG 3361 TGCAGGGTAAATGATGACATATTTATTCTTTTTCCATTTGTTCTAGAAACAGTGCCTTTTTCATCAGTTGCATTTTCCAG 3441 GCTGAGAGCTGTATAAAACATTTTGGACTGTGACCATGTACCTTCCTTTTTAAGAAAAATAAACTGCTTTATGGAAGTTG 3521 GTAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | TZM-bl | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HCT116 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000349485.5 | 3UTR | CUCACUGCAACCUCCAUCUCCUGGGUUCAAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
141 hsa-miR-4534 Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT087131 | CRKL | CRK like proto-oncogene, adaptor protein |  |
|
2 | 2 | ||||||
| MIRT179641 | CAPZA1 | capping actin protein of muscle Z-line alpha subunit 1 | |
|
2 | 2 | ||||||
| MIRT243304 | SLC25A36 | solute carrier family 25 member 36 | |
|
2 | 2 | ||||||
| MIRT325574 | HIATL1 | major facilitator superfamily domain containing 14B | |
|
2 | 4 | ||||||
| MIRT448776 | GNA13 | G protein subunit alpha 13 | |
|
2 | 2 | ||||||
| MIRT451456 | HSD11B1L | hydroxysteroid 11-beta dehydrogenase 1 like | |
|
2 | 2 | ||||||
| MIRT452150 | PPP2R1B | protein phosphatase 2 scaffold subunit Abeta | |
|
2 | 2 | ||||||
| MIRT454199 | HLA-A | major histocompatibility complex, class I, A | |
|
2 | 2 | ||||||
| MIRT455984 | ENPP5 | ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) | |
|
2 | 2 | ||||||
| MIRT456058 | SLC25A28 | solute carrier family 25 member 28 | |
|
2 | 2 | ||||||
| MIRT457082 | XPNPEP3 | X-prolyl aminopeptidase 3 | |
|
2 | 2 | ||||||
| MIRT457278 | ALDH9A1 | aldehyde dehydrogenase 9 family member A1 | |
|
2 | 2 | ||||||
| MIRT457361 | POFUT2 | protein O-fucosyltransferase 2 | |
|
2 | 2 | ||||||
| MIRT457396 | CAMK2A | calcium/calmodulin dependent protein kinase II alpha | |
|
2 | 2 | ||||||
| MIRT458817 | ZNF843 | zinc finger protein 843 | |
|
2 | 2 | ||||||
| MIRT459697 | VPS37C | VPS37C, ESCRT-I subunit | |
|
2 | 2 | ||||||
| MIRT460346 | ARL14EP | ADP ribosylation factor like GTPase 14 effector protein | |
|
2 | 2 | ||||||
| MIRT462713 | MAPK13 | mitogen-activated protein kinase 13 | |
|
2 | 2 | ||||||
| MIRT464278 | VASH1 | vasohibin 1 | |
|
2 | 2 | ||||||
| MIRT465634 | TNRC18P2 | trinucleotide repeat containing 18 pseudogene 2 | |
|
2 | 10 | ||||||
| MIRT465772 | TMOD3 | tropomodulin 3 | |
|
2 | 2 | ||||||
| MIRT466414 | TFDP1 | transcription factor Dp-1 | |
|
2 | 2 | ||||||
| MIRT467122 | SRGAP1 | SLIT-ROBO Rho GTPase activating protein 1 | |
|
2 | 8 | ||||||
| MIRT467475 | SMYD1 | SET and MYND domain containing 1 | |
|
2 | 4 | ||||||
| MIRT468462 | SET | SET nuclear proto-oncogene | |
|
2 | 2 | ||||||
| MIRT468618 | SUMO1 | small ubiquitin-like modifier 1 | |
|
2 | 2 | ||||||
| MIRT468835 | RRM2 | ribonucleotide reductase regulatory subunit M2 | |
|
2 | 4 | ||||||
| MIRT470890 | PLXND1 | plexin D1 | |
|
2 | 2 | ||||||
| MIRT473226 | SMCR7L | mitochondrial elongation factor 1 | |
|
2 | 4 | ||||||
| MIRT473858 | MAP2K4 | mitogen-activated protein kinase kinase 4 | |
|
2 | 2 | ||||||
| MIRT474975 | KCND3 | potassium voltage-gated channel subfamily D member 3 | |
|
2 | 2 | ||||||
| MIRT475858 | H6PD | hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase | |
|
2 | 2 | ||||||
| MIRT478569 | CTNND1 | catenin delta 1 | |
|
2 | 2 | ||||||
| MIRT479347 | CEP97 | centrosomal protein 97 | |
|
2 | 2 | ||||||
| MIRT479910 | CCDC117 | coiled-coil domain containing 117 | |
|
2 | 4 | ||||||
| MIRT480122 | CALR | calreticulin | |
|
2 | 2 | ||||||
| MIRT480892 | BCL9L | B-cell CLL/lymphoma 9 like | |
|
2 | 2 | ||||||
| MIRT481149 | AVL9 | AVL9 cell migration associated | |
|
2 | 6 | ||||||
| MIRT481527 | ARL5B | ADP ribosylation factor like GTPase 5B | |
|
2 | 10 | ||||||
| MIRT481896 | ANKRD40 | ankyrin repeat domain 40 | |
|
2 | 2 | ||||||
| MIRT490138 | FN3K | fructosamine 3 kinase | |
|
2 | 4 | ||||||
| MIRT490329 | ANK1 | ankyrin 1 | |
|
2 | 4 | ||||||
| MIRT491472 | TMEM214 | transmembrane protein 214 | |
|
2 | 2 | ||||||
| MIRT503552 | TIGIT | T-cell immunoreceptor with Ig and ITIM domains | |
|
2 | 4 | ||||||
| MIRT504413 | TUBA1B | tubulin alpha 1b | |
|
2 | 4 | ||||||
| MIRT508207 | SLC35E1 | solute carrier family 35 member E1 | |
|
2 | 2 | ||||||
| MIRT508333 | SLC37A4 | solute carrier family 37 member 4 | |
|
2 | 6 | ||||||
| MIRT516381 | TRAF3IP2 | TRAF3 interacting protein 2 | |
|
2 | 4 | ||||||
| MIRT518549 | ABCA6 | ATP binding cassette subfamily A member 6 | |
|
2 | 2 | ||||||
| MIRT522545 | MED28 | mediator complex subunit 28 | |
|
2 | 6 | ||||||
| MIRT522592 | MAPK1IP1L | mitogen-activated protein kinase 1 interacting protein 1 like | |
|
2 | 2 | ||||||
| MIRT522923 | KAT6A | lysine acetyltransferase 6A | |
|
2 | 4 | ||||||
| MIRT525937 | C11orf74 | chromosome 11 open reading frame 74 | |
|
2 | 2 | ||||||
| MIRT527021 | PABPN1L | poly(A) binding protein nuclear 1 like, cytoplasmic | |
|
2 | 2 | ||||||
| MIRT530396 | SULT1B1 | sulfotransferase family 1B member 1 | |
|
2 | 2 | ||||||
| MIRT530660 | TRIM56 | tripartite motif containing 56 | |
|
2 | 2 | ||||||
| MIRT531625 | TM4SF5 | transmembrane 4 L six family member 5 | |
|
2 | 4 | ||||||
| MIRT532703 | TCN2 | transcobalamin 2 | |
|
2 | 4 | ||||||
| MIRT540173 | MB21D1 | Mab-21 domain containing 1 | |
|
2 | 2 | ||||||
| MIRT540756 | UTP6 | UTP6, small subunit processome component | |
|
2 | 2 | ||||||
| MIRT541966 | ZNF485 | zinc finger protein 485 | |
|
2 | 2 | ||||||
| MIRT542738 | RAF1 | Raf-1 proto-oncogene, serine/threonine kinase | |
|
2 | 2 | ||||||
| MIRT543090 | KNSTRN | kinetochore localized astrin/SPAG5 binding protein | |
|
2 | 2 | ||||||
| MIRT550687 | YARS | tyrosyl-tRNA synthetase | |
|
2 | 2 | ||||||
| MIRT553466 | TNRC6A | trinucleotide repeat containing 6A | |
|
2 | 2 | ||||||
| MIRT559980 | RELA | RELA proto-oncogene, NF-kB subunit | |
|
2 | 2 | ||||||
| MIRT561084 | LLPH | LLP homolog, long-term synaptic facilitation | |
|
2 | 2 | ||||||
| MIRT561738 | PLAGL2 | PLAG1 like zinc finger 2 | |
|
2 | 2 | ||||||
| MIRT569872 | KLK10 | kallikrein related peptidase 10 | |
|
2 | 2 | ||||||
| MIRT570264 | ARPC3 | actin related protein 2/3 complex subunit 3 | |
|
2 | 2 | ||||||
| MIRT573431 | ALDOA | aldolase, fructose-bisphosphate A | |
|
2 | 2 | ||||||
| MIRT573874 | PRPS1L1 | phosphoribosyl pyrophosphate synthetase 1-like 1 | |
|
2 | 2 | ||||||
| MIRT576905 | Poteg | POTE ankyrin domain family, member G | |
|
2 | 2 | ||||||
| MIRT607934 | ANG | angiogenin | |
|
2 | 2 | ||||||
| MIRT609472 | RPL7L1 | ribosomal protein L7 like 1 | |
|
2 | 4 | ||||||
| MIRT612179 | EMC3 | ER membrane protein complex subunit 3 | |
|
2 | 2 | ||||||
| MIRT613428 | GALNT6 | polypeptide N-acetylgalactosaminyltransferase 6 | |
|
2 | 2 | ||||||
| MIRT613746 | GPR155 | G protein-coupled receptor 155 | |
|
2 | 2 | ||||||
| MIRT615034 | DIS3 | DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease | |
|
2 | 2 | ||||||
| MIRT615565 | JPH2 | junctophilin 2 | |
|
2 | 2 | ||||||
| MIRT615937 | MAP1LC3B | microtubule associated protein 1 light chain 3 beta | |
|
2 | 2 | ||||||
| MIRT616643 | LRAT | lecithin retinol acyltransferase | |
|
2 | 4 | ||||||
| MIRT630890 | SLC25A33 | solute carrier family 25 member 33 | |
|
2 | 2 | ||||||
| MIRT636542 | FAM126B | family with sequence similarity 126 member B | |
|
2 | 2 | ||||||
| MIRT641392 | NUBPL | nucleotide binding protein like | |
|
2 | 2 | ||||||
| MIRT641410 | SCN2B | sodium voltage-gated channel beta subunit 2 | |
|
2 | 2 | ||||||
| MIRT643184 | HYPK | huntingtin interacting protein K | |
|
2 | 2 | ||||||
| MIRT652600 | TIMM8A | translocase of inner mitochondrial membrane 8A | |
|
2 | 2 | ||||||
| MIRT653974 | SEMA7A | semaphorin 7A (John Milton Hagen blood group) | |
|
2 | 2 | ||||||
| MIRT655692 | NUDT3 | nudix hydrolase 3 | |
|
2 | 2 | ||||||
| MIRT660734 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | |
|
2 | 4 | ||||||
| MIRT661604 | C2orf15 | chromosome 2 open reading frame 15 | |
|
2 | 2 | ||||||
| MIRT663284 | ZNF675 | zinc finger protein 675 | |
|
2 | 2 | ||||||
| MIRT666337 | SKAP2 | src kinase associated phosphoprotein 2 | |
|
2 | 2 | ||||||
| MIRT666636 | RBMS2 | RNA binding motif single stranded interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT667125 | OCIAD2 | OCIA domain containing 2 | |
|
2 | 2 | ||||||
| MIRT670412 | ELP2 | elongator acetyltransferase complex subunit 2 | |
|
2 | 2 | ||||||
| MIRT671119 | ZNF573 | zinc finger protein 573 | |
|
2 | 2 | ||||||
| MIRT671152 | ANKRD9 | ankyrin repeat domain 9 | |
|
2 | 2 | ||||||
| MIRT671336 | FAM71F2 | family with sequence similarity 71 member F2 | |
|
2 | 2 | ||||||
| MIRT671867 | ZNF429 | zinc finger protein 429 | |
|
2 | 2 | ||||||
| MIRT671972 | IKZF3 | IKAROS family zinc finger 3 | |
|
2 | 2 | ||||||
| MIRT672062 | KIAA0930 | KIAA0930 | |
|
2 | 2 | ||||||
| MIRT672652 | SLC25A16 | solute carrier family 25 member 16 | |
|
2 | 4 | ||||||
| MIRT672671 | GTF2H5 | general transcription factor IIH subunit 5 | |
|
2 | 2 | ||||||
| MIRT672768 | UBE2V2 | ubiquitin conjugating enzyme E2 V2 | |
|
2 | 2 | ||||||
| MIRT672927 | LRRC2 | leucine rich repeat containing 2 | |
|
2 | 2 | ||||||
| MIRT673156 | C1orf50 | chromosome 1 open reading frame 50 | |
|
2 | 2 | ||||||
| MIRT673270 | RUNDC1 | RUN domain containing 1 | |
|
2 | 2 | ||||||
| MIRT673329 | THAP1 | THAP domain containing 1 | |
|
2 | 2 | ||||||
| MIRT673348 | SLC35F6 | solute carrier family 35 member F6 | |
|
2 | 2 | ||||||
| MIRT673664 | ZNF440 | zinc finger protein 440 | |
|
2 | 2 | ||||||
| MIRT673901 | DCTN6 | dynactin subunit 6 | |
|
2 | 2 | ||||||
| MIRT674399 | MYCBP | MYC binding protein | |
|
2 | 2 | ||||||
| MIRT674523 | PRR23A | proline rich 23A | |
|
2 | 2 | ||||||
| MIRT674831 | ADAMTS4 | ADAM metallopeptidase with thrombospondin type 1 motif 4 | |
|
2 | 2 | ||||||
| MIRT675064 | FGD6 | FYVE, RhoGEF and PH domain containing 6 | |
|
2 | 2 | ||||||
| MIRT675078 | CCR6 | C-C motif chemokine receptor 6 | |
|
2 | 2 | ||||||
| MIRT675123 | FSD2 | fibronectin type III and SPRY domain containing 2 | |
|
2 | 2 | ||||||
| MIRT679399 | IL10RB | interleukin 10 receptor subunit beta | |
|
2 | 2 | ||||||
| MIRT686608 | TMEM70 | transmembrane protein 70 | |
|
2 | 2 | ||||||
| MIRT690371 | ZSWIM7 | zinc finger SWIM-type containing 7 | |
|
2 | 2 | ||||||
| MIRT694464 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | |
|
2 | 2 | ||||||
| MIRT695706 | OLA1 | Obg like ATPase 1 | |
|
2 | 2 | ||||||
| MIRT696846 | WDR13 | WD repeat domain 13 | |
|
2 | 2 | ||||||
| MIRT700894 | PER2 | period circadian clock 2 | |
|
2 | 2 | ||||||
| MIRT701924 | MLLT1 | MLLT1, super elongation complex subunit | |
|
2 | 2 | ||||||
| MIRT704918 | CCDC36 | coiled-coil domain containing 36 | |
|
2 | 2 | ||||||
| MIRT706211 | ACOT9 | acyl-CoA thioesterase 9 | |
|
2 | 2 | ||||||
| MIRT706546 | GJD2 | gap junction protein delta 2 | |
|
2 | 2 | ||||||
| MIRT706727 | RFK | riboflavin kinase | |
|
2 | 2 | ||||||
| MIRT707366 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | |
|
2 | 2 | ||||||
| MIRT707416 | RRP7A | ribosomal RNA processing 7 homolog A | |
|
2 | 2 | ||||||
| MIRT710646 | GLUL | glutamate-ammonia ligase | |
|
2 | 2 | ||||||
| MIRT712298 | PGM2L1 | phosphoglucomutase 2 like 1 | |
|
2 | 2 | ||||||
| MIRT713709 | HIST3H2BB | histone cluster 3 H2B family member b | |
|
2 | 2 | ||||||
| MIRT713751 | SLC9A8 | solute carrier family 9 member A8 | |
|
2 | 2 | ||||||
| MIRT716423 | VPS53 | VPS53, GARP complex subunit | |
|
2 | 2 | ||||||
| MIRT717169 | UCHL3 | ubiquitin C-terminal hydrolase L3 | |
|
2 | 2 | ||||||
| MIRT718877 | PDIA3 | protein disulfide isomerase family A member 3 | |
|
2 | 2 | ||||||
| MIRT720096 | SPTLC3 | serine palmitoyltransferase long chain base subunit 3 | |
|
2 | 2 | ||||||
| miRNA-Drug Associations | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|