miRTarBase - #MIRT457441


—
pre-miRNA Information
pre-miRNA hsa-mir-7515   
Genomic Coordinates chr2: 6650373 - 6650439
Description Homo sapiens miR-7515 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7515
Sequence 46| AGAAGGGAAGAUGGUGAC |63
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1451879371 1 dbSNP
rs576086800 3 dbSNP
rs753372632 5 dbSNP
rs1337497055 7 dbSNP
rs1405449301 9 dbSNP
rs1032296398 10 dbSNP
rs960195576 12 dbSNP
rs1470711310 14 dbSNP
Putative Targets

Gene Information
Gene Symbol NOL10   
Synonyms PQBP5
Description nucleolar protein 10
Transcript NM_024894   
Expression
Putative miRNA Targets on NOL10
3'UTR of NOL10
(miRNA target sites are highlighted)		 
>NOL10|NM_024894|3'UTR
   1 TTTGGGAAGTGGTCCTACCTGTGATTAGGGAGGGGTACGTCTCCCCCAAACTGATCATCGTTAGGGTGTTAAACACAGAC
  81 GAGGAAACACACGTTTTTAAAGTTCATGTACGTTCTTGTACACAGAGGTAAAGATTTGAAAACCTGTGCCTTGTGGGTTG
 161 GACTTTGAAGCTGGCCCCGCCGACGGCCACCGCACAGCCCCAGGGGTGTGCTTGCGAGTCGTTGCTCCCTGGAAACATTG
 241 TCCTTTCCCCACGGCTTTAATCATGAAAACCAGGCTGGGGTTTTTTTAATATTGTGAAATGTACACCATGAAATGAAAGG
 321 TTTATCCTGTGCCAGAAACCAAGGTTTATCATGCTCTAGGAACTTTTTTCTTACACTGCCTACCGCCATTCATGATTAAA
 401 CCATCCAGAAATACCATCCCTGTTTTACCTGGTGTCTGTGTATTGCCTGTGTTTGTGTTTATAAGTTTATGCTGATAGGT
 481 TTGTTCGGCTTGTTTATGTATTAGTTTGGGATTTGTTTTTAAATAATTTATACCAAGAGAGTATAATCTAATGGTGCAGG
 561 TTGAGAGCATCCCAAATCCGAAAATCTAAAACTGTTTGAGCACTGTATTTATCTGTTCTTGCACTGCTATAAAGAACTAC
 641 CTGAAACTGGGTAATTTATAAGTAAAGAAAAGAGGTTTAATTGACTCACAGTTCTACAGGTGGTACAGGAAGCATGGCTG
 721 TGGAGGCCCTGGGAAGCTTACAATCGTGGCAGAAGGTGAAGCGGAAGCAGGTATGTCCTGCGTGGCTAGAGCCAGAGGAG
 801 GAGGGCAAAGGGGCAGATGCTGCACACTTTCAAACACCAGATCTCCAAGAACTCACTAACACAGAATAGCAAGGGGGAAG
 881 TCTGCCCCCATGTTTCAGTCACCTCCCTCCAGGCCCCTCCTCCAACACCGAAGATTACAATTTGACATGAGATTTGTGTG
 961 GGGACACAGAGCAAAACCATATCAAGCACTGACATGACATTGGAGGAAAATGCTCATTAGAGCTTTTCAGGTTTTGGATT
1041 TTCAGATTTGGGATACTTGACTAGTAAATATAATACAGATATTCCAAAACACACAAAAAAACCAAAGTCTAAAAGACTTC
1121 TGGTCCCAAGCATTTCAGATAAGGGATACCCAACCTGTAATAATGGGAAACAAGCAGTAGAGGCTGTTGGTTAATCTTGG
1201 CACAAGTTTAATTACAGGTTTTTTTTTTTTCCTGTTTCTTAAGTACAGTCAAACATAAACTTACTGGAGGAAACATTTAT
1281 AAAAATAAATATACTTTCATTTGAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cagUGGUAGAAGGGAAGa 5'
             | |||: |||:||| 
Target 5' ggaAACATTGTCCTTTCc 3'
 231 - 248 139.00 -10.40
2 
miRNA  3' caGU-GGUAGAAGGGAAGa 5'
            || :|| | ||||| | 
Target 5' ttCAGTCA-CCTCCCTCCa 3'
 894 - 911 115.00 -13.62
3 
miRNA  3' caGUGGUAGAAGGGAaga 5'
            :||||   |||||   
Target 5' aaTACCA---TCCCTgtt 3'
 410 - 424 109.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31520352 2 COSMIC
COSN31498289 20 COSMIC
COSN30545041 21 COSMIC
COSN24387589 39 COSMIC
COSN26541609 39 COSMIC
COSN30455139 47 COSMIC
COSN31778242 50 COSMIC
COSN31491521 52 COSMIC
COSN5779113 60 COSMIC
COSN30512986 79 COSMIC
COSN31602344 81 COSMIC
COSN22543234 84 COSMIC
COSN30503838 127 COSMIC
COSN30166162 142 COSMIC
COSN31541930 156 COSMIC
COSN20090503 181 COSMIC
COSN20221358 215 COSMIC
COSN18941453 275 COSMIC
COSN20096321 280 COSMIC
COSN20578377 335 COSMIC
COSN9854563 376 COSMIC
COSN17839929 683 COSMIC
COSN32062681 765 COSMIC
COSN32062680 768 COSMIC
COSN17735713 929 COSMIC
COSN31959767 1102 COSMIC
COSN27487536 1218 COSMIC
COSN20096320 1219 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1159355716 2 dbSNP
rs751488054 3 dbSNP
rs766320732 5 dbSNP
rs757265241 7 dbSNP
rs753950428 10 dbSNP
rs758339848 16 dbSNP
rs760931077 17 dbSNP
rs767917303 19 dbSNP
rs1182237943 33 dbSNP
rs774941114 34 dbSNP
rs771569216 37 dbSNP
rs762509042 38 dbSNP
rs371980513 39 dbSNP
rs769233955 45 dbSNP
rs539733755 49 dbSNP
rs1310435777 57 dbSNP
rs1379539395 60 dbSNP
rs150203535 60 dbSNP
rs866668539 66 dbSNP
rs534280257 74 dbSNP
rs1379545395 80 dbSNP
rs371353117 84 dbSNP
rs1468874058 90 dbSNP
rs566939574 92 dbSNP
rs1051797525 93 dbSNP
rs907800905 93 dbSNP
rs983341581 96 dbSNP
rs1369531478 111 dbSNP
rs1308154492 112 dbSNP
rs1431063885 116 dbSNP
rs1166321729 121 dbSNP
rs1367261145 124 dbSNP
rs1461416800 136 dbSNP
rs73165928 146 dbSNP
rs1402976708 147 dbSNP
rs1030028709 149 dbSNP
rs1179410384 154 dbSNP
rs1443380603 162 dbSNP
rs376939867 166 dbSNP
rs530358467 178 dbSNP
rs780846253 179 dbSNP
rs569420731 181 dbSNP
rs754512288 182 dbSNP
rs1011081990 184 dbSNP
rs187087506 185 dbSNP
rs532638249 187 dbSNP
rs1263617860 191 dbSNP
rs999762075 192 dbSNP
rs182762938 199 dbSNP
rs1479472785 200 dbSNP
rs570769023 204 dbSNP
rs1045596 210 dbSNP
rs1418013195 215 dbSNP
rs1045597 216 dbSNP
rs757831619 217 dbSNP
rs969054253 219 dbSNP
rs1038164740 220 dbSNP
rs941894766 221 dbSNP
rs1328625208 224 dbSNP
rs1353075486 225 dbSNP
rs561285641 228 dbSNP
rs1045598 233 dbSNP
rs1354978433 235 dbSNP
rs983269391 236 dbSNP
rs958342595 240 dbSNP
rs1341415569 250 dbSNP
rs1031664288 252 dbSNP
rs999690010 255 dbSNP
rs10172924 256 dbSNP
rs1266979326 258 dbSNP
rs1472445459 261 dbSNP
rs1030383244 271 dbSNP
rs1045600 275 dbSNP
rs200330278 278 dbSNP
rs202188221 279 dbSNP
rs200941743 280 dbSNP
rs3832140 288 dbSNP
rs529349447 288 dbSNP
rs59554839 288 dbSNP
rs200257641 289 dbSNP
rs1174586021 291 dbSNP
rs1375089532 304 dbSNP
rs1045601 305 dbSNP
rs1184540819 319 dbSNP
rs544921460 323 dbSNP
rs900520323 325 dbSNP
rs974408053 327 dbSNP
rs1431654796 329 dbSNP
rs1327070238 344 dbSNP
rs964695847 348 dbSNP
rs1266836663 353 dbSNP
rs1006622429 356 dbSNP
rs888409252 363 dbSNP
rs577425569 364 dbSNP
rs1046975469 374 dbSNP
rs1280704534 375 dbSNP
rs1346729794 376 dbSNP
rs1021387157 384 dbSNP
rs552618153 385 dbSNP
rs929801990 392 dbSNP
rs866445700 397 dbSNP
rs1206618905 398 dbSNP
rs1455922900 402 dbSNP
rs752896147 414 dbSNP
rs1394815489 416 dbSNP
rs1433138512 417 dbSNP
rs1160492260 418 dbSNP
rs1046196625 419 dbSNP
rs1268372574 425 dbSNP
rs1400187314 429 dbSNP
rs1316227737 431 dbSNP
rs947851432 437 dbSNP
rs759282115 442 dbSNP
rs916301336 449 dbSNP
rs1300048019 451 dbSNP
rs1231682438 455 dbSNP
rs767892214 464 dbSNP
rs1350860266 480 dbSNP
rs999647512 486 dbSNP
rs936333310 487 dbSNP
rs140933517 488 dbSNP
rs534433132 489 dbSNP
rs906798662 490 dbSNP
rs978282568 508 dbSNP
rs1214830455 509 dbSNP
rs1252816495 534 dbSNP
rs1452950552 545 dbSNP
rs566902120 548 dbSNP
rs974864952 553 dbSNP
rs759810859 559 dbSNP
rs964854216 573 dbSNP
rs1389926162 578 dbSNP
rs1012261030 579 dbSNP
rs1393527568 580 dbSNP
rs1384854743 585 dbSNP
rs776428021 599 dbSNP
rs1464777805 602 dbSNP
rs895113146 608 dbSNP
rs554980385 609 dbSNP
rs1037692068 610 dbSNP
rs1199717959 616 dbSNP
rs1237835498 620 dbSNP
rs942141630 621 dbSNP
rs1434935259 623 dbSNP
rs1336272327 624 dbSNP
rs1234502099 638 dbSNP
rs1273104365 639 dbSNP
rs1287898191 642 dbSNP
rs1467473062 647 dbSNP
rs1197939757 648 dbSNP
rs1251627750 650 dbSNP
rs886519463 652 dbSNP
rs1047636660 658 dbSNP
rs1259754783 662 dbSNP
rs1186524995 666 dbSNP
rs1464381717 668 dbSNP
rs1475567205 668 dbSNP
rs1248472323 676 dbSNP
rs1206646986 678 dbSNP
rs373110297 680 dbSNP
rs78613840 681 dbSNP
rs933102187 686 dbSNP
rs1396909301 689 dbSNP
rs1390511212 695 dbSNP
rs1305783783 697 dbSNP
rs1356890796 698 dbSNP
rs1414874322 700 dbSNP
rs12998328 703 dbSNP
rs906428185 721 dbSNP
rs1230209392 726 dbSNP
rs140231332 727 dbSNP
rs58615432 728 dbSNP
rs1296049466 729 dbSNP
rs1339110183 732 dbSNP
rs1194348637 737 dbSNP
rs947871685 741 dbSNP
rs115660874 743 dbSNP
rs773329756 746 dbSNP
rs13028945 751 dbSNP
rs571883557 762 dbSNP
rs187539892 763 dbSNP
rs762802549 768 dbSNP
rs748658416 771 dbSNP
rs1173321914 774 dbSNP
rs1195211202 778 dbSNP
rs528621452 781 dbSNP
rs561250610 782 dbSNP
rs1166412926 784 dbSNP
rs1309211997 785 dbSNP
rs1376906655 795 dbSNP
rs1434897125 798 dbSNP
rs970839501 800 dbSNP
rs1041484296 801 dbSNP
rs1168019253 817 dbSNP
rs549149263 826 dbSNP
rs1248531528 831 dbSNP
rs1195097901 833 dbSNP
rs1326275738 847 dbSNP
rs1012934341 860 dbSNP
rs199929673 864 dbSNP
rs748112277 873 dbSNP
rs1200608356 874 dbSNP
rs1278352691 879 dbSNP
rs1206897979 890 dbSNP
rs933598310 898 dbSNP
rs923512720 900 dbSNP
rs974973831 903 dbSNP
rs1396615498 906 dbSNP
rs773141233 909 dbSNP
rs895389115 919 dbSNP
rs1172599564 922 dbSNP
rs1016714672 923 dbSNP
rs1271923503 924 dbSNP
rs1454889097 925 dbSNP
rs530829383 929 dbSNP
rs985250507 930 dbSNP
rs1433479734 938 dbSNP
rs12616863 940 dbSNP
rs1243091085 947 dbSNP
rs1233916944 954 dbSNP
rs1299464220 961 dbSNP
rs1318892887 972 dbSNP
rs1216609526 997 dbSNP
rs1260166235 998 dbSNP
rs35551831 1000 dbSNP
rs1206704663 1001 dbSNP
rs1335272549 1003 dbSNP
rs1002859627 1013 dbSNP
rs1047810907 1018 dbSNP
rs577389753 1025 dbSNP
rs997364890 1029 dbSNP
rs901654041 1031 dbSNP
rs1038847910 1032 dbSNP
rs943314525 1036 dbSNP
rs1192693436 1038 dbSNP
rs559150174 1051 dbSNP
rs1420442357 1058 dbSNP
rs1398064281 1071 dbSNP
rs1054531177 1080 dbSNP
rs1362679859 1083 dbSNP
rs78463923 1085 dbSNP
rs924375629 1092 dbSNP
rs1395767121 1093 dbSNP
rs1430438089 1101 dbSNP
rs1292094164 1102 dbSNP
rs780569241 1102 dbSNP
rs894941372 1103 dbSNP
rs1471690037 1107 dbSNP
rs143019848 1110 dbSNP
rs1226555837 1117 dbSNP
rs62128622 1125 dbSNP
rs1335320336 1130 dbSNP
rs1156456076 1145 dbSNP
rs1220573541 1146 dbSNP
rs192459264 1147 dbSNP
rs1481435220 1149 dbSNP
rs536598951 1153 dbSNP
rs1249276185 1154 dbSNP
rs1471321606 1155 dbSNP
rs990997410 1159 dbSNP
rs959931848 1164 dbSNP
rs1461337464 1166 dbSNP
rs1016478521 1170 dbSNP
rs902254309 1174 dbSNP
rs575996412 1182 dbSNP
rs375436962 1187 dbSNP
rs950667554 1195 dbSNP
rs1443262880 1199 dbSNP
rs78773114 1217 dbSNP
rs62128621 1219 dbSNP
rs1348778962 1220 dbSNP
rs868731958 1221 dbSNP
rs80006092 1230 dbSNP
rs1227645565 1231 dbSNP
rs1335414264 1231 dbSNP
rs1416703551 1231 dbSNP
rs34895208 1231 dbSNP
rs397869862 1231 dbSNP
rs77324976 1231 dbSNP
rs1275732079 1232 dbSNP
rs1309026637 1233 dbSNP
rs1208652513 1234 dbSNP
rs1356241488 1238 dbSNP
rs1481837981 1249 dbSNP
rs1189475967 1251 dbSNP
rs1285203883 1255 dbSNP
rs1257560361 1258 dbSNP
rs539338754 1260 dbSNP
rs1235487677 1265 dbSNP
rs1348893922 1266 dbSNP
rs1287909806 1267 dbSNP
rs1472779818 1273 dbSNP
rs923525927 1280 dbSNP
rs185884808 1292 dbSNP
rs901920604 1294 dbSNP
rs1410531347 1299 dbSNP
rs547248903 1308 dbSNP
rs535112626 1312 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' caGUGGU-A-GAAGGGAAga 5'
            | |:| | | ||||||  
Target 5' ucCCCUACUCCCUCCCUU-- 3'
 		2 - 19
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000345985.3 | 3UTR | UUCCCCUACUCCCUCCCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
116 hsa-miR-7515 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT063460 SKI SKI proto-oncogene 2 4
MIRT089615 MAT2A methionine adenosyltransferase 2A 2 10
MIRT100238 PRR3 proline rich 3 2 4
MIRT159239 NRBP1 nuclear receptor binding protein 1 2 2
MIRT183526 BTG2 BTG anti-proliferation factor 2 2 2
MIRT266866 SLC25A44 solute carrier family 25 member 44 2 2
MIRT304116 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 4
MIRT331077 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT350659 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT438442 MET MET proto-oncogene, receptor tyrosine kinase 3 1
MIRT443555 ZFP3 ZFP3 zinc finger protein 2 2
MIRT447969 MSH6 mutS homolog 6 2 2
MIRT448635 ONECUT1 one cut homeobox 1 2 2
MIRT451778 USP36 ubiquitin specific peptidase 36 2 2
MIRT452615 REPIN1 replication initiator 1 2 2
MIRT453433 GLG1 golgi glycoprotein 1 2 2
MIRT454015 ALKBH5 alkB homolog 5, RNA demethylase 2 2
MIRT454961 TPM2 tropomyosin 2 2 2
MIRT455364 KDM5C lysine demethylase 5C 2 2
MIRT455434 ID3 inhibitor of DNA binding 3, HLH protein 2 2
MIRT455456 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455595 TAF12 TATA-box binding protein associated factor 12 2 2
MIRT455689 GLO1 glyoxalase I 2 2
MIRT455949 CYP4A22 cytochrome P450 family 4 subfamily A member 22 2 2
MIRT456135 SAMD10 sterile alpha motif domain containing 10 2 2
MIRT456821 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457441 NOL10 nucleolar protein 10 2 2
MIRT458048 TSEN54 tRNA splicing endonuclease subunit 54 2 2
MIRT458237 NXPH3 neurexophilin 3 2 2
MIRT458671 GPR35 G protein-coupled receptor 35 2 2
MIRT458741 CES2 carboxylesterase 2 2 2
MIRT459102 CYP4A11 cytochrome P450 family 4 subfamily A member 11 2 2
MIRT459676 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459776 IDH3A isocitrate dehydrogenase 3 (NAD(+)) alpha 2 2
MIRT461975 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT462267 TPI1 triosephosphate isomerase 1 2 2
MIRT463296 ZFP91 ZFP91 zinc finger protein 2 2
MIRT463446 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT464379 URM1 ubiquitin related modifier 1 2 2
MIRT465552 TOB2 transducer of ERBB2, 2 2 2
MIRT467359 SP2 Sp2 transcription factor 2 2
MIRT467638 SLC7A5 solute carrier family 7 member 5 2 2
MIRT467795 SLC2A14 solute carrier family 2 member 14 2 2
MIRT468466 SET SET nuclear proto-oncogene 2 4
MIRT468725 SDC4 syndecan 4 2 2
MIRT468784 SCAMP5 secretory carrier membrane protein 5 2 2
MIRT469154 RNF121 ring finger protein 121 2 2
MIRT473436 MDM4 MDM4, p53 regulator 2 2
MIRT473636 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT474242 LCLAT1 lysocardiolipin acyltransferase 1 2 2
MIRT474654 KLF13 Kruppel like factor 13 2 2
MIRT475384 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475400 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT476369 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT478017 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT478459 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478791 CRTC2 CREB regulated transcription coactivator 2 2 2
MIRT478952 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT480412 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT481455 ARRB2 arrestin beta 2 2 2
MIRT481556 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT481740 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT483592 SLC26A9 solute carrier family 26 member 9 2 2
MIRT484423 SNX19 sorting nexin 19 2 2
MIRT484727 HOXB8 homeobox B8 2 6
MIRT487419 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT487622 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT488048 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 2
MIRT488064 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT488587 ST7L suppression of tumorigenicity 7 like 2 2
MIRT488696 NAT9 N-acetyltransferase 9 (putative) 2 2
MIRT489175 ANKRD45 ankyrin repeat domain 45 2 4
MIRT490435 MYL9 myosin light chain 9 2 2
MIRT490452 GLUD1 glutamate dehydrogenase 1 2 2
MIRT490704 FSTL4 follistatin like 4 2 2
MIRT491038 ALPK3 alpha kinase 3 2 2
MIRT491249 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 2 2
MIRT491632 SEMA4G semaphorin 4G 2 2
MIRT492491 RAPGEF1 Rap guanine nucleotide exchange factor 1 2 2
MIRT492506 RANBP10 RAN binding protein 10 2 4
MIRT493917 FAM127B retrotransposon Gag like 8A 2 4
MIRT494012 DUSP9 dual specificity phosphatase 9 2 2
MIRT499188 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT499813 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT501837 NCOA2 nuclear receptor coactivator 2 2 2
MIRT504067 KCTD12 potassium channel tetramerization domain containing 12 2 4
MIRT505313 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT511829 H2AFX H2A histone family member X 2 4
MIRT515497 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT518629 NONO non-POU domain containing octamer binding 2 2
MIRT519774 ZNF354B zinc finger protein 354B 2 8
MIRT521806 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522621 MAP7D1 MAP7 domain containing 1 2 4
MIRT532803 CLDN11 claudin 11 2 2
MIRT533783 TMEM119 transmembrane protein 119 2 2
MIRT536433 KMT2B lysine methyltransferase 2B 2 6
MIRT538700 CASP16 caspase 16, pseudogene 2 4
MIRT544603 DCAF5 DDB1 and CUL4 associated factor 5 2 2
MIRT556730 KLHL15 kelch like family member 15 2 4
MIRT560587 LCE1B late cornified envelope 1B 2 2
MIRT560617 ANKRD36 ankyrin repeat domain 36 2 2
MIRT564348 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT568925 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT570946 CPE carboxypeptidase E 2 2
MIRT571235 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT573805 FRMPD4 FERM and PDZ domain containing 4 2 2
MIRT574149 MARVELD1 MARVEL domain containing 1 2 2
MIRT575772 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 2 2
MIRT576154 Hmox1 heme oxygenase 1 2 2
MIRT611312 CA8 carbonic anhydrase 8 2 4
MIRT615891 MT1A metallothionein 1A 2 2
MIRT669589 AK2 adenylate kinase 2 2 2
MIRT687186 PRKAR1A protein kinase cAMP-dependent type I regulatory subunit alpha 2 2
MIRT692711 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT701346 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT701997 MIER3 MIER family member 3 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-7 Berbamine derivative(BBMD3) NULL NULL Illumina HiSeq2000 brain 24732116 2014 down-regulated
miR-7 Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 down-regulated
miR-7 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miR-7 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
miR-7 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 up-regulated
miR-7 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-7 Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 up-regulated
miR-7 Interleukin 13 (IL-13) NULL NULL Quantitative real-time PCR bronchial epithelial cells 22453679 2012 down-regulated
miR-7 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-7 Goserelin approved 47725 Microarray prostate 22674191 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-7515 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-7515 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-7515 Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-7515 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)

Error report submission