miRTarBase - #MIRT457566


—
pre-miRNA Information
pre-miRNA hsa-mir-3179-1   
Genomic Coordinates chr16: 14901508 - 14901591
Description Homo sapiens miR-3179-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-2   
Genomic Coordinates chr16: 16300159 - 16300242
Description Homo sapiens miR-3179-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-3   
Genomic Coordinates chr16: 18411894 - 18411977
Description Homo sapiens miR-3179-3 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-4   
Genomic Coordinates chr16: 18494493 - 18494576
Description Homo sapiens miR-3179-4 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-3179
Sequence 52| AGAAGGGGUGAAAUUUAAACGU |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1351100204 1 dbSNP
rs1398613616 4 dbSNP
rs1340262765 20 dbSNP
rs1229893475 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZNF34   
Synonyms KOX32
Description zinc finger protein 34
Transcript NM_030580   
Expression
Putative miRNA Targets on ZNF34
3'UTR of ZNF34
(miRNA target sites are highlighted)		 
>ZNF34|NM_030580|3'UTR
   1 CAGTGGCGCGGTGTCCGAGGGCAGAGTCCAGCTGAGCACTTCCTGCATGCGCCCCCGGCACCTGACTCTGCCCTTTATGT
  81 ATTATCCACACGATGTTTTCACAGAGTGAAAGGACGTTTCTCATTAAACAAACCTCTTTTCTTAAATCAAAAGCAGTGCA
 161 TGTTCATTTTAGAGAAATTGAGACAGAAAAGTGGGCAAAAAAGAAGCTTCTGTGATCTCTCCCACTTAGAAAAAAAATTC
 241 ATTGCTGCTGATTTACGAATATTTTCGAGACATACTGGAGAGCATTTTAAAAAGAAAATACCGTAATGCTTGTCATTGCA
 321 GCACCTAGGATCTTCACTTTTGCTATTTCCTCAATATCAGAAAATTCACACTGAAGAGAGCACCATATATTTTAACATTT
 401 TTACATATTGTAAATTTAAAAGCATCGGCCAGGTGTGGTGGCTCATGCCTGTAATACCAGCATTTTGAGAGGCCAAGGTG
 481 GGTGGATCACTTGAGGTCAGGAGTTTGAGACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAATACAAAAAT
 561 TAGCCAGGTGTGGTGGTGGGTGCCTGTAATCCCAGCTACTCGGGAGGCTGAGGCAGGAGCATTGCTTGAACCTGGGAGGC
 641 GGAGGTTGCAGTGAGCCAAGACTGTGCCACTGTACTCCAGCCTGGGTGACAGAGCGAGACGCTGTCTCAAAAAATAAATG
 721 AAACAAACTTAACATTCATACTTTTTATGTCAATAGAGTTGAAGTTGCCTTTAACTGTGGTGAAATAACATAATATGAAA
 801 TTTACAATTTTAACCATTTTTAAGTGTACAATTCAGTGGCATTAAGTACATTCATGGTGTTGTGTAACCATCATCACTGT
 881 GTATTTCCAGAACTGTTTTATTACTCCAAACAGAAACCCTGTACCTATTAAATAATAACTCTTCATTTCCCCCTTCTCCC
 961 TACTGCTGGTAACCTCAATTCTATTTTCTGTCTCTTTGAATTTGCCTATTCTAGGAACATAAATATGTGTGGAATCATGC
1041 AAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugcAAAUUUAAAGUGGGGAAGa 5'
             | |  ||||| ||||||| 
Target 5' aacTCTTCATTTC-CCCCTTCt 3'
 937 - 957 158.00 -16.90
2 
miRNA  3' ugcAAAUUUAAAGUGGGGAAGa 5'
             |||:||||| :||: ||| 
Target 5' ctcTTTGAATTT-GCCTATTCt 3'
 992 - 1012 126.00 -9.60
3 
miRNA  3' ugcaAAUUUAAAGUGGGGAAGa 5'
              |||||    |||:|||: 
Target 5' ctcaTTAAA-CAAACCTCTTTt 3'
 120 - 140 121.00 -9.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31481371 7 COSMIC
COSN6917447 8 COSMIC
COSN28884022 9 COSMIC
COSN24385672 10 COSMIC
COSN27006032 33 COSMIC
COSN30522905 34 COSMIC
COSN31541674 45 COSMIC
COSN30495696 51 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs759494203 1 dbSNP
rs528096516 2 dbSNP
rs965527899 7 dbSNP
rs771974224 8 dbSNP
rs112189162 9 dbSNP
rs556311919 10 dbSNP
rs1448775721 12 dbSNP
rs760582025 16 dbSNP
rs199714684 17 dbSNP
rs779536969 19 dbSNP
rs1245110180 20 dbSNP
rs545967816 24 dbSNP
rs965487291 25 dbSNP
rs1021166851 28 dbSNP
rs1240940982 44 dbSNP
rs755834923 45 dbSNP
rs111939091 48 dbSNP
rs1382557032 49 dbSNP
rs201242886 50 dbSNP
rs1162013539 51 dbSNP
rs1382575615 52 dbSNP
rs1419468745 55 dbSNP
rs556768278 56 dbSNP
rs1011065894 57 dbSNP
rs1181752243 58 dbSNP
rs1450271223 61 dbSNP
rs1337519634 62 dbSNP
rs1000245254 68 dbSNP
rs1460018332 71 dbSNP
rs1312577105 79 dbSNP
rs1352574040 87 dbSNP
rs1224193602 90 dbSNP
rs774360334 91 dbSNP
rs1204420004 92 dbSNP
rs541647682 101 dbSNP
rs1461221674 106 dbSNP
rs1182301946 107 dbSNP
rs1259194506 111 dbSNP
rs1003342273 113 dbSNP
rs949866239 115 dbSNP
rs1470709640 116 dbSNP
rs748271789 117 dbSNP
rs146661160 134 dbSNP
rs1044978453 144 dbSNP
rs1012194493 148 dbSNP
rs939904147 150 dbSNP
rs113442835 152 dbSNP
rs377076255 152 dbSNP
rs909895544 153 dbSNP
rs930046569 158 dbSNP
rs553243493 162 dbSNP
rs143532699 165 dbSNP
rs1337523558 166 dbSNP
rs1442631083 170 dbSNP
rs1278776740 177 dbSNP
rs897197502 189 dbSNP
rs183437533 195 dbSNP
rs1384329698 207 dbSNP
rs1322222072 212 dbSNP
rs1201293577 214 dbSNP
rs558982542 249 dbSNP
rs944189060 250 dbSNP
rs9657506 253 dbSNP
rs1181489660 256 dbSNP
rs985666351 257 dbSNP
rs768981091 262 dbSNP
rs747298644 267 dbSNP
rs976768344 269 dbSNP
rs1468283583 275 dbSNP
rs1172966636 276 dbSNP
rs570143012 278 dbSNP
rs1021071668 293 dbSNP
rs914888935 295 dbSNP
rs548673145 301 dbSNP
rs989121713 302 dbSNP
rs758800958 303 dbSNP
rs1454118689 309 dbSNP
rs1032976691 336 dbSNP
rs956583011 337 dbSNP
rs1283511433 339 dbSNP
rs1030721178 340 dbSNP
rs1221121888 345 dbSNP
rs1271462442 347 dbSNP
rs35727050 349 dbSNP
rs981875382 358 dbSNP
rs192168836 367 dbSNP
rs905486514 370 dbSNP
rs1490942732 376 dbSNP
rs1223758633 380 dbSNP
rs779504132 399 dbSNP
rs1479600802 414 dbSNP
rs1195363731 422 dbSNP
rs1373739229 427 dbSNP
rs1022759093 432 dbSNP
rs1012160235 435 dbSNP
rs759692316 437 dbSNP
rs895678793 441 dbSNP
rs1036845877 442 dbSNP
rs566099996 446 dbSNP
rs994154717 448 dbSNP
rs1402745882 450 dbSNP
rs1351820243 453 dbSNP
rs939809744 457 dbSNP
rs888384989 458 dbSNP
rs1048756193 472 dbSNP
rs1291563226 475 dbSNP
rs897167382 478 dbSNP
rs369537356 485 dbSNP
rs548069654 495 dbSNP
rs377006682 502 dbSNP
rs944157968 514 dbSNP
rs921264163 515 dbSNP
rs1338064135 517 dbSNP
rs1041145287 520 dbSNP
rs539384620 530 dbSNP
rs1446495548 531 dbSNP
rs1316369067 536 dbSNP
rs944112536 537 dbSNP
rs563776460 538 dbSNP
rs551737399 540 dbSNP
rs1163930184 544 dbSNP
rs1398248820 548 dbSNP
rs1384397085 552 dbSNP
rs1049923963 567 dbSNP
rs1159938321 568 dbSNP
rs1319868239 568 dbSNP
rs554233610 573 dbSNP
rs958411516 575 dbSNP
rs925560913 580 dbSNP
rs1301010558 586 dbSNP
rs981428134 595 dbSNP
rs1426332625 601 dbSNP
rs530399587 602 dbSNP
rs1314730246 606 dbSNP
rs1022621706 612 dbSNP
rs202192249 620 dbSNP
rs914797109 624 dbSNP
rs959793135 628 dbSNP
rs1475117495 632 dbSNP
rs1371455108 634 dbSNP
rs563063004 635 dbSNP
rs989479847 636 dbSNP
rs1245067476 638 dbSNP
rs146488594 639 dbSNP
rs574579837 640 dbSNP
rs559281166 641 dbSNP
rs1313755226 654 dbSNP
rs1242536367 663 dbSNP
rs1421824506 666 dbSNP
rs1183778598 680 dbSNP
rs1268474822 684 dbSNP
rs142590770 690 dbSNP
rs1156254152 694 dbSNP
rs1048348021 695 dbSNP
rs1490945452 695 dbSNP
rs1293138747 696 dbSNP
rs997159374 700 dbSNP
rs1308202217 701 dbSNP
rs1336858735 703 dbSNP
rs981844290 704 dbSNP
rs1227544790 714 dbSNP
rs1265014875 729 dbSNP
rs970497234 733 dbSNP
rs1300904182 734 dbSNP
rs763633822 736 dbSNP
rs1041006204 753 dbSNP
rs1023468700 754 dbSNP
rs754600887 756 dbSNP
rs944019019 757 dbSNP
rs71520596 775 dbSNP
rs1418087584 780 dbSNP
rs188844199 780 dbSNP
rs1398588123 790 dbSNP
rs1431058431 794 dbSNP
rs1169675836 796 dbSNP
rs537464008 803 dbSNP
rs1478197520 806 dbSNP
rs576471609 807 dbSNP
rs1463999345 813 dbSNP
rs1299045196 815 dbSNP
rs925434690 826 dbSNP
rs1285420944 829 dbSNP
rs981073333 835 dbSNP
rs113024071 841 dbSNP
rs961391166 842 dbSNP
rs1281486484 851 dbSNP
rs1310314455 852 dbSNP
rs1481617738 854 dbSNP
rs1251603788 856 dbSNP
rs1247708504 857 dbSNP
rs1480184078 864 dbSNP
rs1204303235 867 dbSNP
rs1436524979 870 dbSNP
rs918148327 877 dbSNP
rs1275735318 879 dbSNP
rs536300841 882 dbSNP
rs574732920 884 dbSNP
rs992505328 901 dbSNP
rs1019609729 904 dbSNP
rs566308043 921 dbSNP
rs1280957617 924 dbSNP
rs1225018549 925 dbSNP
rs767160963 926 dbSNP
rs1278697779 933 dbSNP
rs959662852 941 dbSNP
rs1171729697 946 dbSNP
rs1373070718 949 dbSNP
rs1008264020 951 dbSNP
rs1015355834 953 dbSNP
rs1329461612 962 dbSNP
rs1366379839 973 dbSNP
rs889829666 975 dbSNP
rs1004369225 983 dbSNP
rs1049809378 984 dbSNP
rs952612853 988 dbSNP
rs1215307373 990 dbSNP
rs547663667 991 dbSNP
rs1296191464 994 dbSNP
rs1341427177 997 dbSNP
rs1027221426 999 dbSNP
rs1293700692 1004 dbSNP
rs1490395123 1008 dbSNP
rs893312031 1013 dbSNP
rs1244692212 1016 dbSNP
rs1174522863 1027 dbSNP
rs996799592 1029 dbSNP
rs1186651309 1030 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugcaaauuuAAAGUGGGGAAGa 5'
                   |||| ||||||| 
Target 5' ---------UUUC-CCCCUUCu 3'
 		1 - 12
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000343459.4 | 3UTR | UUUCCCCCUUCUCCCUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
133 hsa-miR-3179 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT102087 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT110061 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 6
MIRT112198 BTG2 BTG anti-proliferation factor 2 2 2
MIRT117668 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT146657 MINK1 misshapen like kinase 1 2 2
MIRT175505 ZBTB33 zinc finger and BTB domain containing 33 2 4
MIRT180535 TXNIP thioredoxin interacting protein 2 2
MIRT190624 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT190650 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT366902 NONO non-POU domain containing octamer binding 2 2
MIRT443554 ZFP3 ZFP3 zinc finger protein 2 2
MIRT445953 MLLT11 MLLT11, transcription factor 7 cofactor 2 2
MIRT446042 HMCN1 hemicentin 1 2 2
MIRT447968 MSH6 mutS homolog 6 2 2
MIRT448634 ONECUT1 one cut homeobox 1 2 2
MIRT449316 MRO maestro 2 2
MIRT451380 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT451547 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451807 CDCA3 cell division cycle associated 3 2 4
MIRT451916 ILK integrin linked kinase 2 2
MIRT451938 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT452189 KIAA1456 KIAA1456 2 2
MIRT452498 HMGXB3 HMG-box containing 3 2 2
MIRT452548 ZNF467 zinc finger protein 467 2 2
MIRT453844 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT454515 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT455363 KDM5C lysine demethylase 5C 2 2
MIRT455455 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455628 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 10
MIRT455639 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 10
MIRT455690 GLO1 glyoxalase I 2 2
MIRT456300 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT456784 MTHFSD methenyltetrahydrofolate synthetase domain containing 2 2
MIRT456819 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457566 ZNF34 zinc finger protein 34 2 2
MIRT457604 IDS iduronate 2-sulfatase 2 2
MIRT458236 NXPH3 neurexophilin 3 2 2
MIRT458313 TNFAIP8L3 TNF alpha induced protein 8 like 3 2 2
MIRT458350 NOC2L NOC2 like nucleolar associated transcriptional repressor 2 2
MIRT458670 GPR35 G protein-coupled receptor 35 2 2
MIRT459675 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT461126 RAB36 RAB36, member RAS oncogene family 2 2
MIRT461918 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT462301 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 2 2
MIRT463520 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT464378 URM1 ubiquitin related modifier 1 2 2
MIRT464614 UBE4B ubiquitination factor E4B 2 2
MIRT464711 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465520 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465974 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466058 TMEM189 transmembrane protein 189 2 2
MIRT466548 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT466647 TAGLN2 transgelin 2 2 2
MIRT467357 SP2 Sp2 transcription factor 2 2
MIRT468744 SDC2 syndecan 2 2 2
MIRT470244 PRRC2A proline rich coiled-coil 2A 2 2
MIRT471426 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT471732 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT472190 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT472450 NAV2 neuron navigator 2 2 6
MIRT474563 KLHDC3 kelch domain containing 3 2 2
MIRT474936 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT475165 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT475399 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT475426 ICK intestinal cell kinase 2 2
MIRT477090 FAM168A family with sequence similarity 168 member A 2 2
MIRT478458 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478953 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT480096 CALR calreticulin 2 2
MIRT481924 ANKRD33B ankyrin repeat domain 33B 2 2
MIRT483217 APOA1 apolipoprotein A1 2 6
MIRT483882 TGIF1 TGFB induced factor homeobox 1 2 2
MIRT483923 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 2 2
MIRT483942 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484209 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT484512 SYT7 synaptotagmin 7 2 2
MIRT484709 RNF11 ring finger protein 11 2 2
MIRT485356 MYO1C myosin IC 2 4
MIRT485615 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT486584 ZNF619 zinc finger protein 619 2 2
MIRT487013 C2orf82 chromosome 2 open reading frame 82 2 2
MIRT487621 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487801 GPR20 G protein-coupled receptor 20 2 4
MIRT488134 GPR107 G protein-coupled receptor 107 2 2
MIRT488773 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT488854 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT489783 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT490102 FN3K fructosamine 3 kinase 2 2
MIRT490389 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT490434 MYL9 myosin light chain 9 2 2
MIRT490451 GLUD1 glutamate dehydrogenase 1 2 2
MIRT490880 OSBP oxysterol binding protein 2 2
MIRT491037 ALPK3 alpha kinase 3 2 2
MIRT491250 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 2 2
MIRT491748 SEMA3F semaphorin 3F 2 2
MIRT492235 SLC48A1 solute carrier family 48 member 1 2 2
MIRT492490 RAPGEF1 Rap guanine nucleotide exchange factor 1 2 2
MIRT492505 RANBP10 RAN binding protein 10 2 4
MIRT492773 PDGFB platelet derived growth factor subunit B 2 2
MIRT492922 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT493459 ITFG3 family with sequence similarity 234 member A 2 2
MIRT493654 HDLBP high density lipoprotein binding protein 2 2
MIRT494011 DUSP9 dual specificity phosphatase 9 2 2
MIRT499412 PLCG2 phospholipase C gamma 2 2 4
MIRT499552 C15orf43 telomere repeat binding bouquet formation protein 2 2 2
MIRT501836 NCOA2 nuclear receptor coactivator 2 2 2
MIRT501950 MAT2A methionine adenosyltransferase 2A 2 10
MIRT504066 KCTD12 potassium channel tetramerization domain containing 12 2 4
MIRT504509 PPP1R9B protein phosphatase 1 regulatory subunit 9B 2 2
MIRT508466 HOXB6 homeobox B6 2 4
MIRT512373 CPM carboxypeptidase M 2 2
MIRT513578 EVX1 even-skipped homeobox 1 2 2
MIRT517763 ZNF366 zinc finger protein 366 2 4
MIRT519773 ZNF354B zinc finger protein 354B 2 8
MIRT523568 GGCX gamma-glutamyl carboxylase 2 4
MIRT532802 CLDN11 claudin 11 2 2
MIRT544299 TSPYL1 TSPY like 1 2 2
MIRT544862 MYH2 myosin heavy chain 2 2 4
MIRT556731 KLHL15 kelch like family member 15 2 4
MIRT564347 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT568924 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT569012 CXorf36 chromosome X open reading frame 36 2 2
MIRT569256 FAM129B family with sequence similarity 129 member B 2 2
MIRT569591 PRELP proline and arginine rich end leucine rich repeat protein 2 2
MIRT569779 SAMD14 sterile alpha motif domain containing 14 2 2
MIRT570034 FAM228A family with sequence similarity 228 member A 2 2
MIRT573803 FRMPD4 FERM and PDZ domain containing 4 2 2
MIRT574190 ZNF264 zinc finger protein 264 2 2
MIRT576153 Hmox1 heme oxygenase 1 2 2
MIRT611311 CA8 carbonic anhydrase 8 2 4
MIRT673429 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT674976 SH3BP2 SH3 domain binding protein 2 2 2
MIRT692712 MEAF6 MYST/Esa1 associated factor 6 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3179 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3179 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-3179 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-3179 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-3179 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission