miRTarBase - #MIRT457961


—
pre-miRNA Information
pre-miRNA hsa-mir-873   
Genomic Coordinates chr9: 28888879 - 28888955
Synonyms MIRN873, hsa-mir-873, MIR873
Description Homo sapiens miR-873 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-873-3p
Sequence 46| GGAGACUGAUGAGUUCCCGGGA |67
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760528397 3 dbSNP
rs773403294 9 dbSNP
rs1273846238 13 dbSNP
rs1339396073 15 dbSNP
rs1247999695 18 dbSNP
rs377380148 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ABCC5   
Synonyms ABC33, EST277145, MOAT-C, MOATC, MRP5, SMRP, pABC11
Description ATP binding cassette subfamily C member 5
Transcript NM_005688   
Other Transcripts NM_001023587   
Expression
Putative miRNA Targets on ABCC5
3'UTR of ABCC5
(miRNA target sites are highlighted)		 
>ABCC5|NM_005688|3'UTR
   1 CTCCTCCCTGTTGACGAAGTCTCTTTTCTTTAGAGCATTGCCATTCCCTGCCTGGGGCGGGCCCCTCATCGCGTCCTCCT
  81 ACCGAAACCTTGCCTTTCTCGATTTTATCTTTCGCACAGCAGTTCCGGATTGGCTTGTGTGTTTCACTTTTAGGGAGAGT
 161 CATATTTTGATTATTGTATTTATTCCATATTCATGTAAACAAAATTTAGTTTTTGTTCTTAATTGCACTCTAAAAGGTTC
 241 AGGGAACCGTTATTATAATTGTATCAGAGGCCTATAATGAAGCTTTATACGTGTAGCTATATCTATATATAATTCTGTAC
 321 ATAGCCTATATTTACAGTGAAAATGTAAGCTGTTTATTTTATATTAAAATAAGCACTGTGCTAATAACAGTGCATATTCC
 401 TTTCTATCATTTTTGTACAGTTTGCTGTACTAGAGATCTGGTTTTGCTATTAGACTGTAGGAAGAGTAGCATTTCATTCT
 481 TCTCTAGCTGGTGGTTTCACGGTGCCAGGTTTTCTGGGTGTCCAAAGGAAGACGTGTGGCAATAGTGGGCCCTCCGACAG
 561 CCCCCTCTGCCGCCTCCCCACGGCCGCTCCAGGGGTGGCTGGAGACGGGTGGGCGGCTGGAGACCATGCAGAGCGCCGTG
 641 AGTTCTCAGGGCTCCTGCCTTCTGTCCTGGTGTCACTTACTGTTTCTGTCAGGAGAGCAGCGGGGCGAAGCCCAGGCCCC
 721 TTTTCACTCCCTCCATCAAGAATGGGGATCACAGAGACATTCCTCCGAGCCGGGGAGTTTCTTTCCTGCCTTCTTCTTTT
 801 TGCTGTTGTTTCTAAACAAGAATCAGTCTATCCACAGAGAGTCCCACTGCCTCAGGTTCCTATGGCTGGCCACTGCACAG
 881 AGCTCTCCAGCTCCAAGACCTGTTGGTTCCAAGCCCTGGAGCCAACTGCTGCTTTTTGAGGTGGCACTTTTTCATTTGCC
 961 TATTCCCACACCTCCACAGTTCAGTGGCAGGGCTCAGGATTTCGTGGGTCTGTTTTCCTTTCTCACCGCAGTCGTCGCAC
1041 AGTCTCTCTCTCTCTCTCCCCTCAAAGTCTGCAACTTTAAGCAGCTCTTGCTAATCAGTGTCTCACACTGGCGTAGAAGT
1121 TTTTGTACTGTAAAGAGACCTACCTCAGGTTGCTGGTTGCTGTGTGGTTTGGTGTGTTCCCGCAAACCCCCTTTGTGCTG
1201 TGGGGCTGGTAGCTCAGGTGGGCGTGGTCACTGCTGTCATCAATTGAATGGTCAGCGTTGCATGTCGTGACCAACTAGAC
1281 ATTCTGTCGCCTTAGCATGTTTGCTGAACACCTTGTGGAAGCAAAAATCTGAAAATGTGAATAAAATTATTTTGGATTTT
1361 GTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agggccCUUGAGUA----GUCAGAGg 5'
                | | ||:|    ||||||| 
Target 5' ctcaccGCAGTCGTCGCACAGTCTCt 3'
 1022 - 1047 146.00 -16.20
2 
miRNA  3' agggcccuugagUAGUCAGAgg 5'
                      ||||||||  
Target 5' ttctaaacaagaATCAGTCTat 3'
 810 - 831 130.00 -9.90
3 
miRNA  3' agggcccuUGAGUAGUCAGAGg 5'
                  :|| |||||| || 
Target 5' cagctcttGCTAATCAGTGTCt 3'
 1082 - 1103 126.00 -13.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30475637 6 COSMIC
COSN30456954 7 COSMIC
COSN7839824 8 COSMIC
COSN14050347 16 COSMIC
COSN30111504 22 COSMIC
COSN28655206 28 COSMIC
COSN30483052 54 COSMIC
COSN18728092 56 COSMIC
COSN31581471 58 COSMIC
COSN30466917 70 COSMIC
COSN14050345 71 COSMIC
COSN14050344 73 COSMIC
COSN30520809 78 COSMIC
COSN31481578 101 COSMIC
COSN31602416 113 COSMIC
COSN31589484 128 COSMIC
COSN31482782 157 COSMIC
COSN28657602 303 COSMIC
COSN31589474 466 COSMIC
COSN7628276 500 COSMIC
COSN31538685 572 COSMIC
COSN19664754 582 COSMIC
COSN30173866 620 COSMIC
COSN31482663 627 COSMIC
COSN26566658 658 COSMIC
COSN31486017 701 COSMIC
COSN31488024 707 COSMIC
COSN31962206 781 COSMIC
COSN31488693 837 COSMIC
COSN26640222 944 COSMIC
COSN31532322 998 COSMIC
COSN28657980 1017 COSMIC
COSN505844 1043 COSMIC
COSN30544928 1116 COSMIC
COSN31546592 1123 COSMIC
COSN31539279 1181 COSMIC
COSN26554487 1229 COSMIC
COSN31522123 1260 COSMIC
COSN26555599 1329 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1346777097 1 dbSNP
rs1257996873 8 dbSNP
rs960139633 12 dbSNP
rs764932902 15 dbSNP
rs529958391 16 dbSNP
rs1451085735 20 dbSNP
rs753358451 21 dbSNP
rs764559849 23 dbSNP
rs761232566 29 dbSNP
rs772210207 31 dbSNP
rs375714369 33 dbSNP
rs1315393541 38 dbSNP
rs1458503398 41 dbSNP
rs767877223 43 dbSNP
rs1303140209 49 dbSNP
rs1367005219 58 dbSNP
rs3749444 59 dbSNP
rs1420103392 61 dbSNP
rs545085611 68 dbSNP
rs921546094 70 dbSNP
rs944287777 71 dbSNP
rs1469376814 72 dbSNP
rs547860723 72 dbSNP
rs139248707 79 dbSNP
rs777587853 84 dbSNP
rs531457381 100 dbSNP
rs1268666590 101 dbSNP
rs755929232 103 dbSNP
rs556373968 113 dbSNP
rs899431132 114 dbSNP
rs1016493357 117 dbSNP
rs537638154 120 dbSNP
rs567576799 126 dbSNP
rs1409934831 127 dbSNP
rs1456760401 130 dbSNP
rs1035343466 137 dbSNP
rs889324041 142 dbSNP
rs1160613887 146 dbSNP
rs1051929132 147 dbSNP
rs1002980073 152 dbSNP
rs781528534 153 dbSNP
rs1302576446 156 dbSNP
rs1378001247 162 dbSNP
rs1396320839 174 dbSNP
rs1294734417 187 dbSNP
rs1348141648 189 dbSNP
rs933092733 193 dbSNP
rs1288946004 194 dbSNP
rs1022784402 201 dbSNP
rs892195084 211 dbSNP
rs1014611185 219 dbSNP
rs555210838 223 dbSNP
rs959981252 225 dbSNP
rs1052065558 226 dbSNP
rs536260735 228 dbSNP
rs1386339815 236 dbSNP
rs1483451109 240 dbSNP
rs1031375023 248 dbSNP
rs565694716 249 dbSNP
rs998487646 253 dbSNP
rs925210699 261 dbSNP
rs1410823907 263 dbSNP
rs1454595186 266 dbSNP
rs780984960 278 dbSNP
rs1175975236 290 dbSNP
rs144490627 291 dbSNP
rs1436948175 295 dbSNP
rs947993370 301 dbSNP
rs1042802337 304 dbSNP
rs1455968158 307 dbSNP
rs149253198 309 dbSNP
rs1197537279 315 dbSNP
rs759596756 317 dbSNP
rs562310476 335 dbSNP
rs1312606034 339 dbSNP
rs1236180408 351 dbSNP
rs1431004808 378 dbSNP
rs766234553 391 dbSNP
rs1272788094 393 dbSNP
rs1482822059 400 dbSNP
rs181237216 410 dbSNP
rs1205968268 415 dbSNP
rs900025930 417 dbSNP
rs1487540361 418 dbSNP
rs367954029 420 dbSNP
rs189588485 430 dbSNP
rs539705036 431 dbSNP
rs960419786 432 dbSNP
rs1455881014 433 dbSNP
rs1487810964 447 dbSNP
rs1283641224 461 dbSNP
rs1212855754 465 dbSNP
rs550384045 466 dbSNP
rs1047054821 469 dbSNP
rs1329114571 476 dbSNP
rs931291847 491 dbSNP
rs1433645590 495 dbSNP
rs751684760 496 dbSNP
rs1274232611 500 dbSNP
rs972070195 501 dbSNP
rs766475000 504 dbSNP
rs969482008 505 dbSNP
rs763190518 516 dbSNP
rs531791406 525 dbSNP
rs1016272195 533 dbSNP
rs773327218 534 dbSNP
rs1297930519 535 dbSNP
rs1400851546 536 dbSNP
rs184225181 543 dbSNP
rs953639936 548 dbSNP
rs1470176700 553 dbSNP
rs1030938342 555 dbSNP
rs1450461974 556 dbSNP
rs997668734 556 dbSNP
rs1031551812 560 dbSNP
rs892223647 563 dbSNP
rs193274857 564 dbSNP
rs1403124813 565 dbSNP
rs1172550894 566 dbSNP
rs1052099625 570 dbSNP
rs1476735440 571 dbSNP
rs371222947 572 dbSNP
rs560145406 579 dbSNP
rs73884807 581 dbSNP
rs3749445 582 dbSNP
rs1364258876 584 dbSNP
rs560762291 585 dbSNP
rs997022088 586 dbSNP
rs562430579 589 dbSNP
rs1272179366 595 dbSNP
rs1260676254 596 dbSNP
rs947989692 602 dbSNP
rs1189770733 604 dbSNP
rs1377191983 606 dbSNP
rs777271644 607 dbSNP
rs1290600381 610 dbSNP
rs540965702 615 dbSNP
rs745352135 616 dbSNP
rs1198683618 619 dbSNP
rs1207455217 625 dbSNP
rs187737115 634 dbSNP
rs1465661952 635 dbSNP
rs1041619675 637 dbSNP
rs919346065 638 dbSNP
rs1008357991 641 dbSNP
rs1801744 642 dbSNP
rs887380392 648 dbSNP
rs972183327 655 dbSNP
rs1418027026 656 dbSNP
rs1219396300 661 dbSNP
rs963450878 670 dbSNP
rs1156910616 682 dbSNP
rs1387767777 685 dbSNP
rs1401099288 688 dbSNP
rs909240419 693 dbSNP
rs1047276795 697 dbSNP
rs1416980602 698 dbSNP
rs986129213 702 dbSNP
rs542868769 706 dbSNP
rs533787704 719 dbSNP
rs757020241 724 dbSNP
rs1357502152 728 dbSNP
rs998100486 733 dbSNP
rs572797603 747 dbSNP
rs11552529 750 dbSNP
rs956855624 757 dbSNP
rs1170770219 762 dbSNP
rs1207271358 765 dbSNP
rs1464691678 766 dbSNP
rs1031126119 767 dbSNP
rs553788268 770 dbSNP
rs1000604468 771 dbSNP
rs538640581 772 dbSNP
rs903596291 773 dbSNP
rs1044729521 775 dbSNP
rs1411165696 779 dbSNP
rs1011886476 781 dbSNP
rs896402049 785 dbSNP
rs1278920244 790 dbSNP
rs1413675787 799 dbSNP
rs376672120 799 dbSNP
rs796498279 799 dbSNP
rs1056345995 803 dbSNP
rs1313760200 806 dbSNP
rs929882724 807 dbSNP
rs1377462032 814 dbSNP
rs1185237989 825 dbSNP
rs897025891 826 dbSNP
rs1038198776 832 dbSNP
rs1439484295 834 dbSNP
rs942115228 835 dbSNP
rs977363490 837 dbSNP
rs1344804057 841 dbSNP
rs968602053 842 dbSNP
rs1021337754 844 dbSNP
rs4148595 845 dbSNP
rs1202417156 862 dbSNP
rs964139167 863 dbSNP
rs1256355708 872 dbSNP
rs986548884 874 dbSNP
rs1183962499 890 dbSNP
rs1375828849 898 dbSNP
rs770380498 902 dbSNP
rs1477592087 919 dbSNP
rs1008826836 923 dbSNP
rs748926097 926 dbSNP
rs1427987576 931 dbSNP
rs923521236 932 dbSNP
rs1168190485 941 dbSNP
rs976399388 955 dbSNP
rs956944227 966 dbSNP
rs1031154034 969 dbSNP
rs1393185424 974 dbSNP
rs979547975 978 dbSNP
rs1025750832 989 dbSNP
rs995754963 996 dbSNP
rs1357426188 1002 dbSNP
rs1305999271 1004 dbSNP
rs967784854 1007 dbSNP
rs1340478288 1019 dbSNP
rs73044694 1022 dbSNP
rs538449659 1024 dbSNP
rs114133046 1027 dbSNP
rs1035092260 1028 dbSNP
rs549703085 1033 dbSNP
rs528040857 1034 dbSNP
rs897055146 1036 dbSNP
rs150079849 1037 dbSNP
rs1166576295 1042 dbSNP
rs752260148 1057 dbSNP
rs111657478 1059 dbSNP
rs1463614133 1059 dbSNP
rs150303978 1059 dbSNP
rs767239318 1059 dbSNP
rs776394998 1059 dbSNP
rs924460652 1059 dbSNP
rs1390651930 1061 dbSNP
rs887868094 1064 dbSNP
rs1328504157 1066 dbSNP
rs1161225466 1070 dbSNP
rs1471066252 1075 dbSNP
rs1434782110 1085 dbSNP
rs1380809840 1086 dbSNP
rs184559648 1090 dbSNP
rs1050493592 1091 dbSNP
rs369518015 1104 dbSNP
rs755741842 1112 dbSNP
rs532761265 1113 dbSNP
rs1274941625 1118 dbSNP
rs1463404343 1119 dbSNP
rs1185669809 1123 dbSNP
rs1289506708 1125 dbSNP
rs796764222 1129 dbSNP
rs1262716980 1130 dbSNP
rs1430456203 1135 dbSNP
rs1185685905 1137 dbSNP
rs976475347 1140 dbSNP
rs963719536 1171 dbSNP
rs1353324945 1181 dbSNP
rs1167784993 1182 dbSNP
rs143330011 1190 dbSNP
rs1240076014 1191 dbSNP
rs1289756775 1193 dbSNP
rs1385224335 1199 dbSNP
rs924167876 1200 dbSNP
rs191957272 1205 dbSNP
rs537922268 1208 dbSNP
rs1354322867 1214 dbSNP
rs1233325040 1215 dbSNP
rs35543804 1217 dbSNP
rs1025803127 1224 dbSNP
rs995598478 1234 dbSNP
rs781082097 1241 dbSNP
rs562 1243 dbSNP
rs561594029 1245 dbSNP
rs1486717597 1257 dbSNP
rs1198999343 1262 dbSNP
rs540027454 1277 dbSNP
rs990621076 1288 dbSNP
rs1190095822 1289 dbSNP
rs1410418886 1294 dbSNP
rs1418933727 1299 dbSNP
rs960725492 1311 dbSNP
rs1464837025 1313 dbSNP
rs546356591 1315 dbSNP
rs1300752662 1326 dbSNP
rs1157919751 1327 dbSNP
rs1437754690 1328 dbSNP
rs896513145 1329 dbSNP
rs572834774 1336 dbSNP
rs1396885520 1355 dbSNP
rs556712854 1357 dbSNP
rs3805114 1366 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agggcccuugaGUAGUCAGAGg 5'
                     || ||||||| 
Target 5' -----------CA-CAGUCUCu 3'
 		1 - 10
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agggcccuuGAGUAGUCAGAGg 5'
                   ||| ||  |||| 
Target 5' --------uCUC-UCUCUCUCu 3'
 		1 - 13
Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000334444.6 | 3UTR | UCUCUCUCUCUCUCUCCCCUCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000334444.6 | 3UTR | CACAGUCUCUCUCUCUCUCUCCCCUCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-873-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081178 MIDN midnolin 2 4
MIRT109809 ZFX zinc finger protein, X-linked 2 4
MIRT242383 TMC5 transmembrane channel like 5 2 4
MIRT444003 METRN meteorin, glial cell differentiation regulator 2 4
MIRT444097 SEPHS1 selenophosphate synthetase 1 2 2
MIRT446158 RPL12 ribosomal protein L12 2 2
MIRT446859 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT447275 FZD5 frizzled class receptor 5 2 2
MIRT447391 TMPRSS15 transmembrane protease, serine 15 2 2
MIRT448817 FKBP1A FK506 binding protein 1A 2 4
MIRT450582 HIST1H2BG histone cluster 1 H2B family member g 2 2
MIRT451776 USP36 ubiquitin specific peptidase 36 2 2
MIRT457961 ABCC5 ATP binding cassette subfamily C member 5 2 4
MIRT458424 KLHL38 kelch like family member 38 2 4
MIRT461383 SLFN12L schlafen family member 12 like 2 2
MIRT467793 SLC2A14 solute carrier family 2 member 14 2 2
MIRT476517 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT480290 C7orf73 short transmembrane mitochondrial protein 1 2 4
MIRT482745 HES7 hes family bHLH transcription factor 7 2 10
MIRT483189 HIST1H2AH histone cluster 1 H2A family member h 2 6
MIRT486545 DCTN4 dynactin subunit 4 2 2
MIRT486581 ZNF619 zinc finger protein 619 2 2
MIRT492604 POLR3E RNA polymerase III subunit E 2 2
MIRT494130 DCAF7 DDB1 and CUL4 associated factor 7 2 6
MIRT496023 ZBED3 zinc finger BED-type containing 3 2 2
MIRT497121 NBEAL1 neurobeachin like 1 2 2
MIRT497400 TMEM245 transmembrane protein 245 2 2
MIRT501410 RANBP10 RAN binding protein 10 2 2
MIRT510947 PPTC7 PTC7 protein phosphatase homolog 2 6
MIRT512494 ARID2 AT-rich interaction domain 2 2 2
MIRT512595 ZNF783 zinc finger family member 783 2 2
MIRT512612 CNTN4 contactin 4 2 2
MIRT517808 UGDH UDP-glucose 6-dehydrogenase 2 6
MIRT520686 TMED7 transmembrane p24 trafficking protein 7 2 4
MIRT526179 HEPH hephaestin 2 2
MIRT532568 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT533979 TADA2A transcriptional adaptor 2A 2 2
MIRT538622 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539703 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT539806 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT540422 FAM83F family with sequence similarity 83 member F 2 2
MIRT540506 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT540619 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT542423 ZNF331 zinc finger protein 331 2 2
MIRT542454 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT543383 CC2D2A coiled-coil and C2 domain containing 2A 2 2
MIRT544777 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 4
MIRT544923 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 2
MIRT549768 ZNF611 zinc finger protein 611 2 4
MIRT551242 COLEC10 collectin subfamily member 10 2 2
MIRT560474 ENSA endosulfine alpha 2 2
MIRT569738 GPR173 G protein-coupled receptor 173 2 2
MIRT571297 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT572345 CKAP2L cytoskeleton associated protein 2 like 2 2
MIRT573112 ERBB2IP erbb2 interacting protein 2 2
MIRT607744 ANGPT4 angiopoietin 4 2 2
MIRT607903 SPRYD4 SPRY domain containing 4 2 2
MIRT611744 SERPING1 serpin family G member 1 2 4
MIRT615101 BNC2 basonuclin 2 2 2
MIRT619124 CD40LG CD40 ligand 2 2
MIRT625572 ANKRD42 ankyrin repeat domain 42 2 2
MIRT629038 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT633986 SLC35E2 solute carrier family 35 member E2 2 2
MIRT635675 COX18 COX18, cytochrome c oxidase assembly factor 2 4
MIRT637471 DEFB105B defensin beta 105B 2 4
MIRT637503 DEFB105A defensin beta 105A 2 4
MIRT639735 MAP2K2 mitogen-activated protein kinase kinase 2 2 2
MIRT640730 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT645364 C9orf47 chromosome 9 open reading frame 47 2 2
MIRT647938 RNF152 ring finger protein 152 2 2
MIRT649400 SH2D4A SH2 domain containing 4A 2 2
MIRT656860 KIN Kin17 DNA and RNA binding protein 2 2
MIRT663470 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT663507 NKAPL NFKB activating protein like 2 4
MIRT667690 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT677403 PCNP PEST proteolytic signal containing nuclear protein 2 2
MIRT678682 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT678789 NUPL2 nucleoporin like 2 2 2
MIRT680649 KIAA1456 KIAA1456 2 2
MIRT682450 MTX3 metaxin 3 2 2
MIRT682740 CA6 carbonic anhydrase 6 2 2
MIRT684421 TUFT1 tuftelin 1 2 2
MIRT690535 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT690595 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT690771 PLA2G2C phospholipase A2 group IIC 2 2
MIRT692233 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT693667 MXRA7 matrix remodeling associated 7 2 2
MIRT695551 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT695870 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT696214 LYZ lysozyme 2 2
MIRT698368 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT700795 PHTF2 putative homeodomain transcription factor 2 2 2
MIRT701640 MYLK3 myosin light chain kinase 3 2 2
MIRT702989 HERPUD2 HERPUD family member 2 2 2
MIRT703627 FBXL3 F-box and leucine rich repeat protein 3 2 2
MIRT703783 FAM102B family with sequence similarity 102 member B 2 2
MIRT704293 DDX19B DEAD-box helicase 19B 2 2
MIRT704828 CDC73 cell division cycle 73 2 2
MIRT705014 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT708480 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT710770 PHF7 PHD finger protein 7 2 2
MIRT718918 TRIM66 tripartite motif containing 66 2 2
MIRT720390 ZNF549 zinc finger protein 549 2 2
MIRT720593 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT723515 SIGLEC8 sialic acid binding Ig like lectin 8 2 2
MIRT724458 PRKX protein kinase, X-linked 2 2
MIRT737267 UMAD1 UBAP1-MVB12-associated (UMA) domain containing 1 3 0
MIRT737356 ZIC2 Zic family member 2 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-873 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-873 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-873 Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-873 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-873-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-873-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission