>MRPL12|NM_002949|3'UTR
   1 CCTCCAGCTCGGAGGACTTGTGTTCAGGGGTCCTGGGCCCCGGGCGAGGTCCCGCCCTCCCGTGGTCACTGGCTCCGCCC
  81 CCAGCACCAGGCGCCCAGTGGAGCCGTTTGGGAGAATTGCCTGCGCCACGCAGCGGGGCCGGACAGGCCGCACAGACCTA
 161 CTGTGGCGGGAGGGAGGGGCGGCTGCTGCCTGGTGACGGCACCCGGAGGCCCACCAGGACGCGCCACCGGTGAATGTGCC
 241 TCTGGTGGCTGCTGAGAAAAATACACTGTGCAGCTCAGTGTGTGGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' guGUGAGUACACCGGGGGUCGu 5' |||| : ||||||||| Target 5' gtCACTGGCTCCGCCCCCAGCa 3'	65 - 86	156.00	-24.90
2	miRNA 3' gugugaguacaccGGGGGUCGu 5' ||:||||| Target 5' -------------CCTCCAGCt 3'	1 - 9	129.00	-14.20
3	miRNA 3' guGUGAGUAC-----ACCGGGGGUCgu 5' :::||| | ||| ||||:| Target 5' tgTGTTCAGGGGTCCTGGGCCCCGGgc 3'	19 - 45	120.00	-21.10

Mutant ID	Mutant Position	Mutant Source
COSN28689841	12	COSMIC
COSN30709759	34	COSMIC
COSN13754655	55	COSMIC
COSN26985023	78	COSMIC
COSN31573538	115	COSMIC
COSN31612796	125	COSMIC
COSN30451114	137	COSMIC
COSN18861399	230	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1370899942	1	dbSNP
rs1476348611	3	dbSNP
rs1337560992	9	dbSNP
rs768058775	10	dbSNP
rs368081864	11	dbSNP
rs767193944	12	dbSNP
rs772984062	14	dbSNP
rs1377444077	16	dbSNP
rs1396890706	20	dbSNP
rs946604003	21	dbSNP
rs1317726562	27	dbSNP
rs34153169	32	dbSNP
rs397857693	32	dbSNP
rs1433472508	33	dbSNP
rs760518878	34	dbSNP
rs1450177060	35	dbSNP
rs1402117828	36	dbSNP
rs778329893	38	dbSNP
rs766244982	39	dbSNP
rs372335756	42	dbSNP
rs200543966	43	dbSNP
rs765254812	46	dbSNP
rs201232710	47	dbSNP
rs758663540	50	dbSNP
rs778210404	53	dbSNP
rs556830235	54	dbSNP
rs887214594	55	dbSNP
rs1192530373	58	dbSNP
rs1228945173	62	dbSNP
rs1264855948	76	dbSNP
rs574992244	77	dbSNP
rs541264959	78	dbSNP
rs11546284	91	dbSNP
rs1242510312	93	dbSNP
rs765562580	94	dbSNP
rs11546282	95	dbSNP
rs11546281	98	dbSNP
rs10560	106	dbSNP
rs1442076418	107	dbSNP
rs966816393	109	dbSNP
rs866613984	113	dbSNP
rs953016492	122	dbSNP
rs527875908	124	dbSNP
rs959768158	125	dbSNP
rs188153315	126	dbSNP
rs956414670	129	dbSNP
rs1248956279	130	dbSNP
rs915538758	131	dbSNP
rs1307778282	133	dbSNP
rs970001089	135	dbSNP
rs1289619864	136	dbSNP
rs973692662	138	dbSNP
rs115724660	139	dbSNP
rs1308487352	140	dbSNP
rs926583352	141	dbSNP
rs929161752	142	dbSNP
rs1370825072	145	dbSNP
rs112155716	146	dbSNP
rs367873299	150	dbSNP
rs370414182	151	dbSNP
rs1421190106	159	dbSNP
rs940073952	168	dbSNP
rs529902953	169	dbSNP
rs8073486	176	dbSNP
rs944761670	177	dbSNP
rs1427628859	179	dbSNP
rs952404394	181	dbSNP
rs548461555	182	dbSNP
rs776998963	185	dbSNP
rs1266929166	190	dbSNP
rs1195920127	195	dbSNP
rs997058902	196	dbSNP
rs566370124	198	dbSNP
rs1043989517	199	dbSNP
rs902772113	204	dbSNP
rs891412475	205	dbSNP
rs533723766	206	dbSNP
rs1322699712	207	dbSNP
rs1280872565	210	dbSNP
rs558260734	221	dbSNP
rs959835736	222	dbSNP
rs1014382462	223	dbSNP
rs1022635372	224	dbSNP
rs1330524527	226	dbSNP
rs1383450451	227	dbSNP
rs1009698392	229	dbSNP
rs970160640	230	dbSNP
rs1022082254	231	dbSNP
rs570177630	233	dbSNP
rs1173372869	240	dbSNP
rs1478197492	243	dbSNP
rs1261074267	247	dbSNP
rs920533198	260	dbSNP
rs968286564	261	dbSNP
rs1320947333	265	dbSNP
rs1484343457	268	dbSNP
rs1227646538	272	dbSNP
rs1259613933	273	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.