>NOC2L|NM_015658|3'UTR
   1 GGCAGCCCATCTGGGGGGCCTGTAGGGGCTGCCGGGCTGGTGGCCAGTGTTTCCACCTCCCTGGCAGTCAGGCCTAGAGG
  81 CTGGCGTCTGTGCAGTTGGGGGAGGCAGTAGACACGGGACAGGCTTTATTATTTATTTTTCAGCATGAAAGACCAAACGT
 161 ATCGAGAGCTGGGCTGGGCTGGGCTGGTGTGGCTGCTGAAGCCCCACAGCTGTGGGCTGCTGAAGTCAGCTCCGCGGGGG
 241 AGCTGACCCTGACGTCAGCAGACCGAGACCAGTCCCAGTTCCAGGGGGAGGCCTGCAGGCCCCTGGCCCCTTCCACCACC
 321 TCTGCCCTCCGTCTGCAGACCTCGTCCATCTGCACCAGGCTCTGCCTTCACTCCCCCAAGTCTTTGAAAATTTGTTCCTT
 401 TCCTTTGAAGTCACATTTTCTTTTAAAATTTTTTGTTTTGCATCCGAAACCGAAAGAAATAAAGCGGTGGGAGGCAGGGC
 481 CATTGTGTTGAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aacAGGUGAAGAAGGACGGGAc 5' ||||| | | ||||||| Target 5' cctTCCACCACCT-CTGCCCTc 3'	309 - 329	158.00	-17.90
2	miRNA 3' aaCAGGU-GAAGAAG-----GACGGGAc 5' ||||| || | | |||||:| Target 5' tcGTCCATCTGCACCAGGCTCTGCCTTc 3'	342 - 369	136.00	-17.90
3	miRNA 3' aacaggUGAAGAAGGACGGGAc 5' |:|| ||||| :||| Target 5' ttgaaaATTTGTTCCTTTCCTt 3'	384 - 405	120.00	-13.20

Mutant ID	Mutant Position	Mutant Source
COSN26986694	34	COSMIC
COSN28668657	141	COSMIC
COSN5378874	156	COSMIC
COSN1109620	275	COSMIC
COSN15632811	387	COSMIC
COSN15632525	398	COSMIC
COSN30501227	410	COSMIC
COSN20055200	434	COSMIC
COSN30120904	446	COSMIC
COSN32063187	451	COSMIC
COSN26986693	452	COSMIC
COSN31526048	456	COSMIC
COSN26986695	466	COSMIC
COSN26993718	492	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs778302720	1	dbSNP
rs528505070	3	dbSNP
rs1300307343	7	dbSNP
rs747804978	8	dbSNP
rs371686413	10	dbSNP
rs1298468652	11	dbSNP
rs375282480	11	dbSNP
rs367583489	13	dbSNP
rs750163964	16	dbSNP
rs1313087445	17	dbSNP
rs559360650	18	dbSNP
rs771621065	19	dbSNP
rs1170274968	20	dbSNP
rs1428982743	21	dbSNP
rs574127762	23	dbSNP
rs775840047	23	dbSNP
rs770740247	26	dbSNP
rs765209891	27	dbSNP
rs759700388	29	dbSNP
rs374807183	31	dbSNP
rs771514064	32	dbSNP
rs372226726	33	dbSNP
rs772630272	34	dbSNP
rs1206317267	36	dbSNP
rs1456430133	40	dbSNP
rs1321561748	42	dbSNP
rs1288329173	44	dbSNP
rs1200827365	45	dbSNP
rs747784865	46	dbSNP
rs1230575983	47	dbSNP
rs778672292	48	dbSNP
rs749294677	49	dbSNP
rs1311343884	53	dbSNP
rs1353795555	56	dbSNP
rs1310889512	59	dbSNP
rs1242882103	61	dbSNP
rs182573722	62	dbSNP
rs1328557885	67	dbSNP
rs1301283372	72	dbSNP
rs1396999215	72	dbSNP
rs1434405051	73	dbSNP
rs781115545	74	dbSNP
rs996754095	75	dbSNP
rs898517365	76	dbSNP
rs968533206	79	dbSNP
rs1329304690	81	dbSNP
rs563519373	85	dbSNP
rs940111853	86	dbSNP
rs1394878775	93	dbSNP
rs1443900114	93	dbSNP
rs1166860387	96	dbSNP
rs543643620	99	dbSNP
rs1488420798	101	dbSNP
rs908631610	105	dbSNP
rs577769610	111	dbSNP
rs1056669116	113	dbSNP
rs1368156810	114	dbSNP
rs939495711	115	dbSNP
rs1007459917	116	dbSNP
rs1311096126	116	dbSNP
rs1417961916	117	dbSNP
rs926788553	118	dbSNP
rs1384409644	122	dbSNP
rs555566246	128	dbSNP
rs981443040	129	dbSNP
rs918998831	130	dbSNP
rs1036136023	132	dbSNP
rs1178505466	134	dbSNP
rs1264914211	134	dbSNP
rs1445883791	135	dbSNP
rs1290048238	136	dbSNP
rs1210940183	138	dbSNP
rs1260752921	139	dbSNP
rs1469321965	139	dbSNP
rs747146693	139	dbSNP
rs557847793	141	dbSNP
rs751141349	143	dbSNP
rs914240731	144	dbSNP
rs1353790297	145	dbSNP
rs763727197	146	dbSNP
rs1239128345	151	dbSNP
rs1318133859	153	dbSNP
rs1325918911	153	dbSNP
rs28453979	155	dbSNP
rs1222501448	156	dbSNP
rs540640621	158	dbSNP
rs992303418	159	dbSNP
rs1371683832	161	dbSNP
rs143853699	163	dbSNP
rs553373622	164	dbSNP
rs1390273712	166	dbSNP
rs1028130679	167	dbSNP
rs997175541	168	dbSNP
rs1246719898	170	dbSNP
rs1455551356	171	dbSNP
rs1021445189	172	dbSNP
rs988214710	172	dbSNP
rs898378523	173	dbSNP
rs1318999087	176	dbSNP
rs966546422	178	dbSNP
rs1038374232	179	dbSNP
rs1338987466	180	dbSNP
rs1018750482	181	dbSNP
rs1455059711	182	dbSNP
rs1007405956	188	dbSNP
rs534332180	188	dbSNP
rs536992898	189	dbSNP
rs1397479264	190	dbSNP
rs1168285448	197	dbSNP
rs1197179800	205	dbSNP
rs1027612525	208	dbSNP
rs1451457376	209	dbSNP
rs1262868307	213	dbSNP
rs1193545338	216	dbSNP
rs1458619104	220	dbSNP
rs567518523	222	dbSNP
rs1202903479	223	dbSNP
rs1205297956	225	dbSNP
rs1279578145	226	dbSNP
rs977384679	226	dbSNP
rs1221196749	228	dbSNP
rs1345815439	229	dbSNP
rs1302839665	233	dbSNP
rs1004162819	234	dbSNP
rs557087154	235	dbSNP
rs1056968766	236	dbSNP
rs1441235786	238	dbSNP
rs1359575358	239	dbSNP
rs1238849341	240	dbSNP
rs950065608	240	dbSNP
rs1374264722	245	dbSNP
rs1158731527	246	dbSNP
rs769725768	248	dbSNP
rs1348479390	253	dbSNP
rs1056550704	254	dbSNP
rs1176039833	254	dbSNP
rs938223834	260	dbSNP
rs537257169	261	dbSNP
rs939422702	264	dbSNP
rs905366888	265	dbSNP
rs946972060	268	dbSNP
rs1304756525	274	dbSNP
rs1384094699	275	dbSNP
rs1358908316	277	dbSNP
rs1297630125	278	dbSNP
rs1379616567	280	dbSNP
rs571374089	281	dbSNP
rs1045194992	282	dbSNP
rs913881084	284	dbSNP
rs946988897	284	dbSNP
rs145942386	285	dbSNP
rs759425460	287	dbSNP
rs915487000	289	dbSNP
rs989841479	292	dbSNP
rs1157553764	294	dbSNP
rs1400699755	295	dbSNP
rs551875464	296	dbSNP
rs1183967148	299	dbSNP
rs924278409	300	dbSNP
rs1194714337	302	dbSNP
rs986970731	305	dbSNP
rs955119642	307	dbSNP
rs1478582115	308	dbSNP
rs113000356	310	dbSNP
rs1322262681	311	dbSNP
rs1260655853	312	dbSNP
rs1231252968	313	dbSNP
rs1215244536	314	dbSNP
rs1278408608	315	dbSNP
rs1401538340	316	dbSNP
rs1028577797	320	dbSNP
rs1320418172	321	dbSNP
rs1133980	322	dbSNP
rs370888751	325	dbSNP
rs975214363	326	dbSNP
rs1198611888	329	dbSNP
rs1344259648	330	dbSNP
rs368317021	331	dbSNP
rs547844970	331	dbSNP
rs1270518427	333	dbSNP
rs1016794850	338	dbSNP
rs539086356	340	dbSNP
rs566101256	343	dbSNP
rs758798279	344	dbSNP
rs1248363428	347	dbSNP
rs1211788412	348	dbSNP
rs3196153	350	dbSNP
rs549000335	360	dbSNP
rs1415628434	362	dbSNP
rs1305405090	365	dbSNP
rs1360904860	366	dbSNP
rs529152760	369	dbSNP
rs774685381	374	dbSNP
rs1055495964	377	dbSNP
rs1454017731	380	dbSNP
rs563583263	380	dbSNP
rs1394187349	382	dbSNP
rs938171165	386	dbSNP
rs2839	387	dbSNP
rs1464445899	389	dbSNP
rs1371579853	390	dbSNP
rs1170069715	394	dbSNP
rs1433814265	397	dbSNP
rs6605067	398	dbSNP
rs564003453	401	dbSNP
rs914148908	402	dbSNP
rs541154315	403	dbSNP
rs571936168	405	dbSNP
rs1250385815	406	dbSNP
rs988150957	413	dbSNP
rs561771231	414	dbSNP
rs1300700985	415	dbSNP
rs1232667176	417	dbSNP
rs1441746704	423	dbSNP
rs911961517	424	dbSNP
rs1273695182	428	dbSNP
rs1200297054	431	dbSNP
rs1315758479	433	dbSNP
rs1297820936	440	dbSNP
rs1466798160	441	dbSNP
rs1257202287	444	dbSNP
rs1453678370	445	dbSNP
rs1380862829	446	dbSNP
rs541429037	446	dbSNP
rs371437325	450	dbSNP
rs1249636963	451	dbSNP
rs894087603	452	dbSNP
rs1134009	456	dbSNP
rs920401695	458	dbSNP
rs544040354	460	dbSNP
rs1381662775	461	dbSNP
rs961980926	464	dbSNP
rs924281888	465	dbSNP
rs537222882	466	dbSNP
rs1015296379	478	dbSNP
rs189966963	479	dbSNP
rs557955981	483	dbSNP
rs1445222729	485	dbSNP
rs1399951041	488	dbSNP
rs1293407661	489	dbSNP
rs933774432	490	dbSNP
rs754622280	491	dbSNP
rs1348254891	492	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.