>RMI1|NM_024945|3'UTR
   1 TTAAACTAAAATAGTATTAGGAACAATTAAAAACAACAAGGAAATATTTAGAATTTGTTCACAATTTTACTTATGATACT
  81 TTGTGTAAAAAGGAAAAATGAAATTTCATAGCTTATTTCAGTTTAATTTTAAAGTGTTTAATCATGTTTGTTATATGTGG
 161 AGCTTTTGAAAATAAGTTAATCTTTTTTTTTTTTTTTTTAATGTCAGGGTATTGCTCTGTTGCCCAGGCTAGAGTGCAGT
 241 GGCATGATCATAGGTTATTGCATCAACCTCTTGAGCTCAAGCGATCCTCCTGCCTTAGCCTCTTGAGTTGCTGGGACTAT
 321 AGGCATGTACCACCATGCCCAGCTAATTTATAATTACTATTATTGTTTTGTAGGGACAGAGTTTTGCTATGTTGCCCAGA
 401 TTGGTCTCAAACTCCTGGCCTCTCACTCCTGCCGTCATGGCCTCCAAAGTTTACTTTTTTTAAAAGTAACTGTTAGATGG
 481 AGGAATATGGTGACCCACTATTGTTGAGAAATTTGTTTTCCACTTGTCACGTCACATAAGATGATTGCTAAAATATTGTA
 561 CTGGTGTTCGGTGGTGAGTCATATTTTTGAAAGTTAATAATTATAAATAGGTAATTTCCTTCTAATATGTTGGTACTGTC
 641 TATGGCCATACCACCCTGAACATGCCTGAGCTTGTCATAATATGTTGAGTACCCAAAAGATTTGTTTATATTGTTAATCT
 721 TAGGGAAAAAAAATTAAAATCCAGTAGATCAGAACATCAGGCTTTCAGATACAAATTGATTTACTGGTTTTTATTTTGCT
 801 GATTATAATATTTGGTATATTTAAGGTAATCTAGTTAACTAGATGCTATTTCATAGATTATATTGAATGATTTAAAACTT
 881 TATTTTCAAGGATAGTTTATTTTAAATGGCATATTGAAAACATCATTATTAAGATCCAGTAGGTAGGACATTTATTGGAT
 961 TAAAATGAAGCATTTATCTATGTCTTTAGGTGTCATTGTTCCCTTTCTGAATTAGCTGTACATATAAGCCTTCCTTTGGT
1041 TTTAAGTACTGATTTTTTTTTAAAAAAAAGAGGGACTGTTTACCATTCTTCCACTGTGCTGTTATAAAGTTGTATTTGAA
1121 AGGTAATGTTGTTTTTATTAATCTTTTGTCTTAAAATAATTTAAAGTGCTTTGAATTTTAAAACATTAAACAAATCCTTA
1201 AATAACAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aucGU-CGUACUUGGACAGag 5' || || |||:|:|||| Target 5' gaaCATGCCTGAGCTTGTCat 3'	658 - 678	129.00	-14.80
2	miRNA 3' aucgucguacuugGACAGAg 5' |||||| Target 5' taatatgttggtaCTGTCTa 3'	623 - 642	120.00	-9.20
3	miRNA 3' aucgUCG-UACUUGGACAGAg 5' ||| || |||| || Target 5' ctcaAGCGATCCTCCTGCCTt 3'	276 - 296	116.00	-9.80

Mutant ID	Mutant Position	Mutant Source
COSN30144338	29	COSMIC
COSN19662110	43	COSMIC
COSN30492911	72	COSMIC
COSN14400984	79	COSMIC
COSN6604713	85	COSMIC
COSN31598138	158	COSMIC
COSN28627148	183	COSMIC
COSN1381979	200	COSMIC
COSN30132667	211	COSMIC
COSN30531329	239	COSMIC
COSN30119781	299	COSMIC
COSN30108169	334	COSMIC
COSN31568487	385	COSMIC
COSN26650076	435	COSMIC
COSN26677961	450	COSMIC
COSN30122409	454	COSMIC
COSN30158023	481	COSMIC
COSN20315016	671	COSMIC
COSN30124706	727	COSMIC
COSN31536938	735	COSMIC
COSN31528036	782	COSMIC
COSN5706824	794	COSMIC
COSN30534289	839	COSMIC
COSN23552245	870	COSMIC
COSN30541880	959	COSMIC
COSN31548740	985	COSMIC
COSN30536854	1048	COSMIC
COSN17422408	1062	COSMIC
COSN31518807	1062	COSMIC
COSN16620666	1063	COSMIC
COSN15626137	1084	COSMIC
COSN30529981	1086	COSMIC
COSN30134396	1106	COSMIC
COSN30114119	1136	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs144577451	2	dbSNP
rs372773674	2	dbSNP
rs368577759	7	dbSNP
rs749497290	8	dbSNP
rs766246675	8	dbSNP
rs1479228401	12	dbSNP
rs751366878	20	dbSNP
rs1423961440	21	dbSNP
rs781000659	28	dbSNP
rs1167788853	29	dbSNP
rs768825015	32	dbSNP
rs1463503998	35	dbSNP
rs1458363977	47	dbSNP
rs781261017	48	dbSNP
rs1490346654	52	dbSNP
rs189797558	53	dbSNP
rs1343845631	63	dbSNP
rs1253938139	64	dbSNP
rs1157123660	70	dbSNP
rs912657669	72	dbSNP
rs749962211	73	dbSNP
rs73471400	75	dbSNP
rs536851261	83	dbSNP
rs1336696377	84	dbSNP
rs1379938923	86	dbSNP
rs1382918886	88	dbSNP
rs1039679730	89	dbSNP
rs1171089741	92	dbSNP
rs1307104748	99	dbSNP
rs1395401781	106	dbSNP
rs1315894906	109	dbSNP
rs978410539	110	dbSNP
rs925604826	116	dbSNP
rs745515133	122	dbSNP
rs1324058436	144	dbSNP
rs1193257104	147	dbSNP
rs988546055	150	dbSNP
rs1202919771	151	dbSNP
rs1253607548	157	dbSNP
rs1201779163	162	dbSNP
rs1348182418	171	dbSNP
rs917445689	172	dbSNP
rs1228137022	173	dbSNP
rs931294678	173	dbSNP
rs879143314	174	dbSNP
rs950173010	177	dbSNP
rs554746291	180	dbSNP
rs1272490884	182	dbSNP
rs10602387	183	dbSNP
rs10602388	183	dbSNP
rs1228222595	183	dbSNP
rs200645024	183	dbSNP
rs560632293	183	dbSNP
rs572963124	187	dbSNP
rs927529386	198	dbSNP
rs1427646909	199	dbSNP
rs1418681787	200	dbSNP
rs1475733368	201	dbSNP
rs1431864757	202	dbSNP
rs1470546375	204	dbSNP
rs1168462132	208	dbSNP
rs1472445795	210	dbSNP
rs1176320831	212	dbSNP
rs1366154178	215	dbSNP
rs1189035216	218	dbSNP
rs1485756761	239	dbSNP
rs1404471180	240	dbSNP
rs182113444	243	dbSNP
rs1463985717	245	dbSNP
rs1298215075	246	dbSNP
rs930890130	251	dbSNP
rs1372014030	267	dbSNP
rs1445248951	273	dbSNP
rs1204876731	274	dbSNP
rs1049095638	275	dbSNP
rs1275687303	278	dbSNP
rs1284844963	283	dbSNP
rs886430725	284	dbSNP
rs1356274839	287	dbSNP
rs1282430367	301	dbSNP
rs1235287687	304	dbSNP
rs534048466	311	dbSNP
rs1222727583	314	dbSNP
rs566790816	316	dbSNP
rs1040414833	320	dbSNP
rs1319822213	324	dbSNP
rs1407730119	328	dbSNP
rs755729945	360	dbSNP
rs1329322334	364	dbSNP
rs1248167288	366	dbSNP
rs558653312	366	dbSNP
rs1388496030	368	dbSNP
rs1166465580	369	dbSNP
rs1475284500	372	dbSNP
rs894231704	375	dbSNP
rs577152566	378	dbSNP
rs1205173998	386	dbSNP
rs997993145	390	dbSNP
rs779581527	400	dbSNP
rs1205661956	402	dbSNP
rs954025887	403	dbSNP
rs1451530561	406	dbSNP
rs968441406	412	dbSNP
rs1215611593	417	dbSNP
rs1335593700	421	dbSNP
rs1271395223	422	dbSNP
rs1267618966	432	dbSNP
rs998907032	434	dbSNP
rs186454851	435	dbSNP
rs1279851014	439	dbSNP
rs192185094	443	dbSNP
rs574645472	445	dbSNP
rs1329264772	449	dbSNP
rs541965884	450	dbSNP
rs1032706290	451	dbSNP
rs2118168	455	dbSNP
rs987271222	456	dbSNP
rs1171796262	462	dbSNP
rs1353378344	463	dbSNP
rs1178124567	464	dbSNP
rs1460082110	465	dbSNP
rs1477933623	471	dbSNP
rs1251643021	479	dbSNP
rs910345278	481	dbSNP
rs1469324140	486	dbSNP
rs1267524014	490	dbSNP
rs988577312	493	dbSNP
rs1206909664	494	dbSNP
rs1024032790	495	dbSNP
rs1285293492	498	dbSNP
rs769225184	501	dbSNP
rs544758422	509	dbSNP
rs142234974	513	dbSNP
rs927447113	515	dbSNP
rs930939667	521	dbSNP
rs1364374349	523	dbSNP
rs748161348	526	dbSNP
rs147422312	531	dbSNP
rs531330699	532	dbSNP
rs1047479267	537	dbSNP
rs1203040035	538	dbSNP
rs1294050515	542	dbSNP
rs940669630	545	dbSNP
rs1393604831	549	dbSNP
rs1175934911	553	dbSNP
rs1455036204	556	dbSNP
rs139895184	561	dbSNP
rs901894064	562	dbSNP
rs932055313	570	dbSNP
rs1057391550	571	dbSNP
rs1209635215	582	dbSNP
rs1487080038	583	dbSNP
rs1484828682	600	dbSNP
rs1049613996	602	dbSNP
rs889603416	614	dbSNP
rs79089519	615	dbSNP
rs1419495277	617	dbSNP
rs1427269562	619	dbSNP
rs1032905694	623	dbSNP
rs948851825	627	dbSNP
rs1215782470	628	dbSNP
rs1361986139	637	dbSNP
rs1301776895	638	dbSNP
rs891480781	641	dbSNP
rs1009867359	642	dbSNP
rs771959809	646	dbSNP
rs971205790	647	dbSNP
rs145325676	652	dbSNP
rs1169009768	656	dbSNP
rs1430844380	662	dbSNP
rs998544546	671	dbSNP
rs1031718091	675	dbSNP
rs1259942053	677	dbSNP
rs1211299778	678	dbSNP
rs1482629093	680	dbSNP
rs1346741963	690	dbSNP
rs980247373	692	dbSNP
rs1308016414	701	dbSNP
rs1311304725	725	dbSNP
rs1230995129	726	dbSNP
rs183503539	727	dbSNP
rs952289204	730	dbSNP
rs1248118501	735	dbSNP
rs772928103	741	dbSNP
rs1415750234	745	dbSNP
rs1017466315	747	dbSNP
rs760143143	750	dbSNP
rs566700986	759	dbSNP
rs1360316800	760	dbSNP
rs1463931400	763	dbSNP
rs1355694116	768	dbSNP
rs1164151130	774	dbSNP
rs1474293746	784	dbSNP
rs985023757	790	dbSNP
rs908102757	794	dbSNP
rs940696016	800	dbSNP
rs976091232	801	dbSNP
rs1188871600	802	dbSNP
rs1472398746	803	dbSNP
rs534157337	805	dbSNP
rs1458055539	806	dbSNP
rs1178733522	809	dbSNP
rs932112252	810	dbSNP
rs1264855874	814	dbSNP
rs973622217	818	dbSNP
rs373983370	819	dbSNP
rs1273305441	822	dbSNP
rs889644845	825	dbSNP
rs952875380	827	dbSNP
rs935803906	830	dbSNP
rs1054381238	834	dbSNP
rs1333637811	840	dbSNP
rs891757151	844	dbSNP
rs982805910	847	dbSNP
rs1393553866	861	dbSNP
rs1010149928	863	dbSNP
rs1374659968	864	dbSNP
rs1024006982	865	dbSNP
rs1185991138	876	dbSNP
rs906845187	880	dbSNP
rs908583405	881	dbSNP
rs1001311579	882	dbSNP
rs1396722765	889	dbSNP
rs577313162	891	dbSNP
rs1034487366	892	dbSNP
rs1165766674	896	dbSNP
rs1456849125	899	dbSNP
rs938657188	907	dbSNP
rs1161003624	915	dbSNP
rs140080721	921	dbSNP
rs916146208	924	dbSNP
rs1191631038	925	dbSNP
rs1469786475	926	dbSNP
rs1253023557	933	dbSNP
rs1400688431	945	dbSNP
rs948931700	956	dbSNP
rs952257094	963	dbSNP
rs1348080142	966	dbSNP
rs1006304006	979	dbSNP
rs1241582230	981	dbSNP
rs1317852613	983	dbSNP
rs1303156161	984	dbSNP
rs1015041729	985	dbSNP
rs1373833669	990	dbSNP
rs962302503	993	dbSNP
rs1409629446	994	dbSNP
rs1383046047	996	dbSNP
rs1160556533	997	dbSNP
rs538190186	1017	dbSNP
rs1454533673	1020	dbSNP
rs904279736	1021	dbSNP
rs1171544561	1023	dbSNP
rs976289360	1025	dbSNP
rs556290688	1026	dbSNP
rs1444817948	1029	dbSNP
rs953478129	1031	dbSNP
rs574638973	1047	dbSNP
rs529777720	1053	dbSNP
rs890151784	1053	dbSNP
rs542165013	1061	dbSNP
rs11540578	1062	dbSNP
rs994690405	1062	dbSNP
rs572256163	1063	dbSNP
rs950577111	1066	dbSNP
rs1324722672	1067	dbSNP
rs11540577	1068	dbSNP
rs796086043	1068	dbSNP
rs1382936740	1073	dbSNP
rs1375080060	1075	dbSNP
rs1054324333	1077	dbSNP
rs1015674703	1080	dbSNP
rs913058828	1085	dbSNP
rs945970475	1086	dbSNP
rs1454488004	1093	dbSNP
rs1310845052	1106	dbSNP
rs960051419	1107	dbSNP
rs1375954122	1115	dbSNP
rs145021435	1122	dbSNP
rs1474397137	1124	dbSNP
rs60272798	1128	dbSNP
rs1282517965	1129	dbSNP
rs564209160	1129	dbSNP
rs763446665	1131	dbSNP
rs1353037542	1134	dbSNP
rs1193280111	1137	dbSNP
rs992802704	1144	dbSNP
rs1255031934	1152	dbSNP
rs1224576834	1153	dbSNP
rs1195684837	1157	dbSNP
rs1281535758	1157	dbSNP
rs1486882023	1157	dbSNP
rs1283947346	1162	dbSNP
rs1327589801	1167	dbSNP
rs916178828	1181	dbSNP
rs1271941063	1188	dbSNP
rs1045655231	1194	dbSNP
rs1355032070	1195	dbSNP
rs1291704122	1199	dbSNP
rs1416885572	1204	dbSNP
rs1375780147	1211	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.