miRTarBase - #MIRT458496


—
pre-miRNA Information
pre-miRNA hsa-mir-3689d-1   
Genomic Coordinates chr9: 134849609 - 134849682
Description Homo sapiens miR-3689d-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3689d-2   
Genomic Coordinates chr9: 134850277 - 134850356
Description Homo sapiens miR-3689d-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3689d
Sequence 2| GGGAGGUGUGAUCUCACACUCG |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs551722268 8 dbSNP
rs143142996 8 dbSNP
rs1236297052 12 dbSNP
rs573148947 14 dbSNP
rs1210004979 14 dbSNP
rs1217460444 14 dbSNP
rs762590109 18 dbSNP
rs574332265 18 dbSNP
rs1164353021 21 dbSNP
rs963741171 21 dbSNP
rs1177416877 22 dbSNP
rs765777344 22 dbSNP
Putative Targets

Gene Information
Gene Symbol MARVELD2   
Synonyms DFNB49, MARVD2, MRVLDC2, Tric
Description MARVEL domain containing 2
Transcript NM_001038603   
Expression
Putative miRNA Targets on MARVELD2
3'UTR of MARVELD2
(miRNA target sites are highlighted)		 
>MARVELD2|NM_001038603|3'UTR
   1 CGCTTATTTGAAACCACTTTATTTTTTTATTTTATTTTATTTTTTTGAGATGAAGTCTCGCTCTGTTACCCAGGCTGGAA
  81 TGCAGTGGCACAATCTCGGCTCACTGCAACCTCCACCTCCCGGGTTCAAGCAATTCTCCTGTTCAAGCAATTAGCCTCCC
 161 CAGTAGCTGGGATTACAGGCGTGCGCTGCCACACCCCGCTAATTTTTGTATTTTTAGTAGAGACGAGGTTTCACCATGTT
 241 GGTCAGGCTGGGAAACTACTTTTTTTAAAAAATAGCAAGTTTACTATTTATTTACTGCCTTTTTAATGCTAGCCTCTGTG
 321 GTAGAGAAGCAAGCGCTTCCCAAATCAGCTTCCAATTGGTTTAACCAGTATGCAACATTAAAGATTTTACTCAGACATTT
 401 TTAAACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 481 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gcUCACACUCUAGUGUGGAGGg 5'
            | ||  |  || ||||||| 
Target 5' tcACTGCAACCTC-CACCTCCc 3'
 101 - 121 147.00 -15.60
2 
miRNA  3' gcuCA-CA-CUC-UAGU--GUGGAGGg 5'
             || || ||| | ||  |:|:||| 
Target 5' tctGTGGTAGAGAAGCAAGCGCTTCCc 3'
 315 - 341 121.00 -18.30
3 
miRNA  3' gcUCACACUCUA--GUGUGGAGgg 5'
            :| ||| | |  |||||| |  
Target 5' caGGCGTGCGCTGCCACACCCCgc 3'
 176 - 199 110.00 -15.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
228850 2 ClinVar
517529 3 ClinVar
907029 9 ClinVar
907030 98 ClinVar
354096 122 ClinVar
904780 158 ClinVar
354097 172 ClinVar
354098 185 ClinVar
354099 211 ClinVar
904781 267 ClinVar
904782 347 ClinVar
904783 377 ClinVar
COSN30139776 3 COSMIC
COSN31483762 11 COSMIC
COSN26983808 22 COSMIC
COSN31487977 28 COSMIC
COSN30478538 29 COSMIC
COSN30110839 42 COSMIC
COSN30470978 46 COSMIC
COSN30157894 54 COSMIC
COSN14176839 118 COSMIC
COSN27717583 142 COSMIC
COSN20209240 167 COSMIC
COSN30532748 264 COSMIC
COSN7951763 709 COSMIC
COSN37867 711 COSMIC
COSN26736325 1441 COSMIC
COSN15140056 1595 COSMIC
COSN16438322 1763 COSMIC
COSN20582546 1993 COSMIC
COSN4851627 2073 COSMIC
COSN20583807 2076 COSMIC
COSN14983434 2095 COSMIC
COSN26698937 2232 COSMIC
COSN20580019 2332 COSMIC
COSN18723780 2355 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs570049997 2 dbSNP
rs530892254 3 dbSNP
rs780204358 7 dbSNP
rs753965867 8 dbSNP
rs1193784046 10 dbSNP
rs755268242 11 dbSNP
rs1431701835 13 dbSNP
rs1479645963 17 dbSNP
rs1161687789 21 dbSNP
rs551484380 22 dbSNP
rs777404253 25 dbSNP
rs1305379209 26 dbSNP
rs746855195 30 dbSNP
rs771123160 30 dbSNP
rs549827782 31 dbSNP
rs955881293 40 dbSNP
rs770984761 43 dbSNP
rs1426695366 47 dbSNP
rs751906364 50 dbSNP
rs936196290 60 dbSNP
rs755408835 61 dbSNP
rs1268335673 75 dbSNP
rs1321134379 81 dbSNP
rs1285031839 90 dbSNP
rs1225554060 94 dbSNP
rs1361118881 97 dbSNP
rs568296893 98 dbSNP
rs948490448 99 dbSNP
rs1054708770 101 dbSNP
rs867209296 120 dbSNP
rs886060735 122 dbSNP
rs926788306 123 dbSNP
rs535297949 125 dbSNP
rs1245968327 136 dbSNP
rs945679573 142 dbSNP
rs1490728835 146 dbSNP
rs1417940601 156 dbSNP
rs374775664 158 dbSNP
rs898104727 163 dbSNP
rs756878174 172 dbSNP
rs1202635798 179 dbSNP
rs1051809388 182 dbSNP
rs886060736 185 dbSNP
rs867702570 186 dbSNP
rs1306741045 195 dbSNP
rs764933658 198 dbSNP
rs1017361769 199 dbSNP
rs1423227116 200 dbSNP
rs1034154570 203 dbSNP
rs1165182792 203 dbSNP
rs904382455 209 dbSNP
rs886060737 211 dbSNP
rs1461769302 223 dbSNP
rs565481782 225 dbSNP
rs1173147084 226 dbSNP
rs956017423 231 dbSNP
rs1308122308 240 dbSNP
rs748414843 242 dbSNP
rs1371406631 260 dbSNP
rs992901528 265 dbSNP
rs1442265551 266 dbSNP
rs142001621 267 dbSNP
rs983448114 272 dbSNP
rs1480176733 276 dbSNP
rs557400178 277 dbSNP
rs1249465792 297 dbSNP
rs1206360467 299 dbSNP
rs1342709871 315 dbSNP
rs575656482 319 dbSNP
rs192412701 335 dbSNP
rs969763971 336 dbSNP
rs1385132742 349 dbSNP
rs1313679235 351 dbSNP
rs966119868 355 dbSNP
rs1371624844 375 dbSNP
rs756402195 377 dbSNP
rs555796868 383 dbSNP
rs942179202 385 dbSNP
rs1162187541 393 dbSNP
rs973629723 396 dbSNP
rs1422243882 403 dbSNP
rs922078503 407 dbSNP
rs574267700 408 dbSNP
rs1247967992 410 dbSNP
rs377534287 421 dbSNP
rs1483244347 424 dbSNP
rs1268136212 442 dbSNP
rs1220099557 443 dbSNP
rs570445089 448 dbSNP
rs1266040731 451 dbSNP
rs1235287458 457 dbSNP
rs777697368 465 dbSNP
rs1315413319 476 dbSNP
rs1309392330 480 dbSNP
rs1410870167 483 dbSNP
rs1345226431 484 dbSNP
rs1301857773 489 dbSNP
rs749447074 491 dbSNP
rs1392262097 493 dbSNP
rs770703470 506 dbSNP
rs1482663866 508 dbSNP
rs80270395 526 dbSNP
rs1160794117 537 dbSNP
rs745610060 561 dbSNP
rs1244909095 564 dbSNP
rs1428271689 571 dbSNP
rs559964994 572 dbSNP
rs1490839340 573 dbSNP
rs115103672 586 dbSNP
rs1167805666 590 dbSNP
rs1039075598 593 dbSNP
rs1262745663 596 dbSNP
rs545533825 597 dbSNP
rs937069617 606 dbSNP
rs1332231311 609 dbSNP
rs1000429938 625 dbSNP
rs1381195030 627 dbSNP
rs1382082906 629 dbSNP
rs1031543768 630 dbSNP
rs1174001402 639 dbSNP
rs891668585 640 dbSNP
rs995287960 653 dbSNP
rs563743932 654 dbSNP
rs1283088671 657 dbSNP
rs1192327913 661 dbSNP
rs1426835273 664 dbSNP
rs1448876989 665 dbSNP
rs1263869152 669 dbSNP
rs1209600004 673 dbSNP
rs775302074 674 dbSNP
rs1261477865 678 dbSNP
rs1206018119 680 dbSNP
rs1363643947 681 dbSNP
rs969731423 685 dbSNP
rs1270155796 686 dbSNP
rs979789499 697 dbSNP
rs534654560 698 dbSNP
rs530812190 702 dbSNP
rs1008568376 706 dbSNP
rs1299262898 711 dbSNP
rs1435172526 746 dbSNP
rs1404963661 751 dbSNP
rs1018907247 760 dbSNP
rs1415989868 762 dbSNP
rs1402580833 763 dbSNP
rs1167273733 783 dbSNP
rs1460340042 788 dbSNP
rs1362189061 794 dbSNP
rs1215923498 810 dbSNP
rs1016684743 814 dbSNP
rs962529926 818 dbSNP
rs973938342 825 dbSNP
rs1241569944 830 dbSNP
rs1029067197 833 dbSNP
rs1189823655 840 dbSNP
rs919438970 852 dbSNP
rs1443369335 858 dbSNP
rs1272660679 881 dbSNP
rs1194433684 890 dbSNP
rs760221748 903 dbSNP
rs1203761160 938 dbSNP
rs1264922042 945 dbSNP
rs185005068 949 dbSNP
rs987700288 965 dbSNP
rs1312489424 971 dbSNP
rs1449690290 978 dbSNP
rs1340845875 985 dbSNP
rs1242527938 1008 dbSNP
rs1476287289 1016 dbSNP
rs913418336 1022 dbSNP
rs1169103174 1035 dbSNP
rs1383402291 1041 dbSNP
rs1165229012 1046 dbSNP
rs1473288287 1047 dbSNP
rs1189642698 1049 dbSNP
rs1232506237 1053 dbSNP
rs375061908 1054 dbSNP
rs561872146 1062 dbSNP
rs1484223037 1063 dbSNP
rs1415042610 1065 dbSNP
rs1253208136 1067 dbSNP
rs943361136 1080 dbSNP
rs188891340 1081 dbSNP
rs1387069163 1083 dbSNP
rs904603099 1095 dbSNP
rs1229530952 1099 dbSNP
rs936103593 1103 dbSNP
rs1053331925 1111 dbSNP
rs1439799060 1118 dbSNP
rs370790794 1136 dbSNP
rs1321845515 1139 dbSNP
rs1404190352 1151 dbSNP
rs1363637683 1153 dbSNP
rs891642129 1155 dbSNP
rs936997191 1162 dbSNP
rs1406005755 1165 dbSNP
rs11361474 1173 dbSNP
rs35551446 1173 dbSNP
rs568061187 1173 dbSNP
rs868151122 1173 dbSNP
rs878934755 1173 dbSNP
rs1014157839 1180 dbSNP
rs1045660227 1190 dbSNP
rs1223189381 1191 dbSNP
rs1023594491 1192 dbSNP
rs1366549055 1193 dbSNP
rs1223580175 1194 dbSNP
rs1284706150 1195 dbSNP
rs1326954608 1198 dbSNP
rs1226131857 1203 dbSNP
rs1207986583 1204 dbSNP
rs1330960320 1207 dbSNP
rs919659504 1225 dbSNP
rs1343616926 1237 dbSNP
rs1448457256 1238 dbSNP
rs529249558 1239 dbSNP
rs1344635037 1244 dbSNP
rs1246337402 1245 dbSNP
rs1458954941 1254 dbSNP
rs1389646701 1255 dbSNP
rs1176229977 1256 dbSNP
rs1479646129 1257 dbSNP
rs905810740 1261 dbSNP
rs1001197306 1262 dbSNP
rs1016609828 1271 dbSNP
rs547662692 1276 dbSNP
rs962739582 1277 dbSNP
rs1466022503 1292 dbSNP
rs1472320140 1295 dbSNP
rs1159598772 1296 dbSNP
rs1202842798 1298 dbSNP
rs1387788352 1300 dbSNP
rs565875914 1301 dbSNP
rs1046846673 1306 dbSNP
rs886944362 1312 dbSNP
rs547216378 1313 dbSNP
rs1268557243 1320 dbSNP
rs1008101097 1321 dbSNP
rs1323380779 1324 dbSNP
rs1348921029 1325 dbSNP
rs1041350731 1330 dbSNP
rs1304614006 1332 dbSNP
rs1468593329 1333 dbSNP
rs1361208059 1338 dbSNP
rs1177436817 1342 dbSNP
rs565556080 1343 dbSNP
rs1186181343 1366 dbSNP
rs181631277 1370 dbSNP
rs539222731 1377 dbSNP
rs551067866 1378 dbSNP
rs557855862 1391 dbSNP
rs1288937553 1393 dbSNP
rs1210553017 1395 dbSNP
rs1026874807 1397 dbSNP
rs1224949894 1398 dbSNP
rs906401651 1407 dbSNP
rs1342907856 1408 dbSNP
rs1249911957 1412 dbSNP
rs1003385923 1419 dbSNP
rs950893278 1423 dbSNP
rs1020427491 1431 dbSNP
rs1381615389 1437 dbSNP
rs536689015 1442 dbSNP
rs1441907830 1453 dbSNP
rs761391933 1456 dbSNP
rs1366045803 1465 dbSNP
rs981669383 1466 dbSNP
rs912138833 1467 dbSNP
rs186495444 1468 dbSNP
rs1163008058 1474 dbSNP
rs1182281362 1480 dbSNP
rs974675827 1482 dbSNP
rs1386207012 1483 dbSNP
rs925983929 1490 dbSNP
rs991086642 1523 dbSNP
rs1483428124 1526 dbSNP
rs144504056 1530 dbSNP
rs1053229818 1534 dbSNP
rs913332567 1536 dbSNP
rs1242686111 1544 dbSNP
rs1368319266 1544 dbSNP
rs535312783 1546 dbSNP
rs1310401363 1547 dbSNP
rs35672884 1547 dbSNP
rs368101257 1547 dbSNP
rs1408681005 1551 dbSNP
rs1410905654 1557 dbSNP
rs368020197 1563 dbSNP
rs1337438013 1565 dbSNP
rs746971684 1570 dbSNP
rs1445781079 1571 dbSNP
rs1400883432 1575 dbSNP
rs956500061 1576 dbSNP
rs1247910731 1582 dbSNP
rs1272752430 1588 dbSNP
rs1164984091 1591 dbSNP
rs1341791913 1592 dbSNP
rs982492500 1593 dbSNP
rs1196432443 1594 dbSNP
rs1184078289 1595 dbSNP
rs989212703 1596 dbSNP
rs1252803029 1604 dbSNP
rs1268070333 1619 dbSNP
rs1208178752 1634 dbSNP
rs553668329 1639 dbSNP
rs1215258823 1648 dbSNP
rs866936734 1649 dbSNP
rs1290672094 1670 dbSNP
rs1229380403 1672 dbSNP
rs943854873 1673 dbSNP
rs1187393679 1686 dbSNP
rs1299775764 1690 dbSNP
rs1384598455 1692 dbSNP
rs1244304730 1695 dbSNP
rs1293760443 1712 dbSNP
rs1392193939 1712 dbSNP
rs1456441932 1714 dbSNP
rs1183278 1722 dbSNP
rs1167175800 1726 dbSNP
rs1161167788 1731 dbSNP
rs545572446 1747 dbSNP
rs932600292 1748 dbSNP
rs1196602690 1749 dbSNP
rs1434996359 1757 dbSNP
rs1050386766 1758 dbSNP
rs1461212033 1777 dbSNP
rs1463757681 1783 dbSNP
rs781144081 1789 dbSNP
rs1011625513 1790 dbSNP
rs1038412337 1793 dbSNP
rs866549811 1795 dbSNP
rs189780721 1798 dbSNP
rs575681041 1799 dbSNP
rs1433690007 1810 dbSNP
rs1362638354 1824 dbSNP
rs1322092220 1833 dbSNP
rs1457595011 1838 dbSNP
rs1401163770 1842 dbSNP
rs1170745888 1844 dbSNP
rs542699770 1851 dbSNP
rs955335106 1856 dbSNP
rs1009019298 1863 dbSNP
rs561312366 1866 dbSNP
rs529205540 1872 dbSNP
rs1295194473 1880 dbSNP
rs1461153572 1895 dbSNP
rs748245684 1898 dbSNP
rs1019073495 1904 dbSNP
rs1202533005 1905 dbSNP
rs964897886 1910 dbSNP
rs1253319151 1924 dbSNP
rs974981200 1930 dbSNP
rs1339387638 1941 dbSNP
rs982440030 1941 dbSNP
rs908267675 1945 dbSNP
rs925925664 1950 dbSNP
rs1311619532 1960 dbSNP
rs180807308 1961 dbSNP
rs1167837574 1968 dbSNP
rs943819700 1976 dbSNP
rs1392036805 1977 dbSNP
rs1199946938 2009 dbSNP
rs989249179 2011 dbSNP
rs1264298794 2018 dbSNP
rs1463091429 2022 dbSNP
rs1169469098 2023 dbSNP
rs1472627444 2030 dbSNP
rs1366914590 2039 dbSNP
rs976960878 2041 dbSNP
rs921116025 2047 dbSNP
rs1187039326 2052 dbSNP
rs1203560388 2053 dbSNP
rs913311783 2060 dbSNP
rs1481790094 2082 dbSNP
rs932519051 2085 dbSNP
rs1247838527 2096 dbSNP
rs1053703098 2100 dbSNP
rs950114164 2105 dbSNP
rs1045553695 2117 dbSNP
rs1340790980 2130 dbSNP
rs1307353075 2134 dbSNP
rs1193385000 2167 dbSNP
rs1407843918 2174 dbSNP
rs1374442930 2176 dbSNP
rs1041763236 2193 dbSNP
rs559177068 2194 dbSNP
rs927122331 2221 dbSNP
rs1411941661 2227 dbSNP
rs9885314 2230 dbSNP
rs1473338478 2235 dbSNP
rs1411605058 2237 dbSNP
rs1180468618 2239 dbSNP
rs1476755253 2251 dbSNP
rs937217671 2267 dbSNP
rs1175165405 2272 dbSNP
rs1038271628 2274 dbSNP
rs1406703193 2275 dbSNP
rs1253136141 2280 dbSNP
rs1470939449 2288 dbSNP
rs898434714 2299 dbSNP
rs1287324980 2301 dbSNP
rs9885315 2301 dbSNP
rs929650342 2304 dbSNP
rs1356789079 2315 dbSNP
rs1287560029 2317 dbSNP
rs1382582914 2320 dbSNP
rs1352306277 2336 dbSNP
rs1435882771 2337 dbSNP
rs1348141992 2342 dbSNP
rs1047207926 2344 dbSNP
rs1406243621 2344 dbSNP
rs1297911709 2345 dbSNP
rs890838755 2346 dbSNP
rs1157464696 2347 dbSNP
rs1329635509 2348 dbSNP
rs1057473554 2351 dbSNP
rs867883118 2352 dbSNP
rs868257220 2353 dbSNP
rs200146717 2355 dbSNP
rs1242557934 2356 dbSNP
rs1466091295 2356 dbSNP
rs375559227 2356 dbSNP
rs746994253 2356 dbSNP
rs1007939779 2357 dbSNP
rs1326232698 2359 dbSNP
rs1400985065 2361 dbSNP
rs1310417947 2366 dbSNP
rs1280610808 2368 dbSNP
rs1278024750 2370 dbSNP
rs201073536 2371 dbSNP
rs1235702050 2372 dbSNP
rs1268073091 2377 dbSNP
rs1486361199 2378 dbSNP
rs1207335596 2379 dbSNP
rs1277565751 2381 dbSNP
rs894641173 2382 dbSNP
rs1295690929 2383 dbSNP
rs1013072175 2385 dbSNP
rs1256623451 2402 dbSNP
rs1263398685 2402 dbSNP
rs1446238561 2403 dbSNP
rs1361441180 2414 dbSNP
rs1335392500 2415 dbSNP
rs1431143373 2424 dbSNP
rs1019042428 2431 dbSNP
rs532973277 2435 dbSNP
rs1166168842 2448 dbSNP
rs1429332065 2458 dbSNP
rs1181106865 2466 dbSNP
rs1419765578 2466 dbSNP
rs551153969 2467 dbSNP
rs569698015 2468 dbSNP
rs1033254153 2471 dbSNP
rs535767436 2474 dbSNP
rs1211435165 2482 dbSNP
rs769977161 2484 dbSNP
rs952986581 2491 dbSNP
rs1272651148 2493 dbSNP
rs1003809585 2494 dbSNP
rs1015271295 2496 dbSNP
rs556951636 2502 dbSNP
rs988787284 2508 dbSNP
rs1020710995 2509 dbSNP
rs1226990905 2519 dbSNP
rs1381728810 2519 dbSNP
rs971440495 2520 dbSNP
rs1409823603 2521 dbSNP
rs1290473277 2522 dbSNP
rs981540054 2525 dbSNP
rs927384435 2527 dbSNP
rs1431074141 2529 dbSNP
rs143560429 2535 dbSNP
rs1163571513 2539 dbSNP
rs767965457 2556 dbSNP
rs976533280 2557 dbSNP
rs1188381192 2560 dbSNP
rs548738906 2560 dbSNP
rs771607555 2560 dbSNP
rs773723949 2560 dbSNP
rs921055010 2561 dbSNP
rs1480974327 2574 dbSNP
rs753163682 2585 dbSNP
rs1219565380 2597 dbSNP
rs989342733 2602 dbSNP
rs915143729 2609 dbSNP
rs756280174 2619 dbSNP
rs1046694053 2625 dbSNP
rs1290710584 2627 dbSNP
rs1226656829 2629 dbSNP
rs1392646095 2637 dbSNP
rs536740790 2638 dbSNP
rs943768387 2658 dbSNP
rs1042082309 2660 dbSNP
rs924637626 2665 dbSNP
rs1456479159 2667 dbSNP
rs938719603 2674 dbSNP
rs186086141 2675 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gcUCACACUCUAGUGUGGAGGg 5'
            | ||  |  || ||||||| 
Target 5' ucACUGCAACCUC-CACCUCCc 3'
 		13 - 33
2 
miRNA  3' gcucacacucuagugUGGAGgg 5'
                         |:|||  
Target 5' -----------cacaAUCUCgg 3'
 		1 - 11
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM4903829
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / CTLTD_shCTL_a
Location of target site NM_001038603 | 3UTR | CUCGGCUCACUGCAACCUCCACCUCCCGGGUUCAAGCAAUUCUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903830
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / CTLTD_shCTL_b
Location of target site NM_001038603 | 3UTR | CUCGGCUCACUGCAACCUCCACCUCCCGGGUUCAAGCAAUUCUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903831
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / 124TD_shELAVL3_a
Location of target site NM_001038603 | 3UTR | CCUCCACCUCCCGGGUUCAAGCAAUUCUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903832
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / 124TD_shELAVL3_b
Location of target site NM_001038603 | 3UTR | CUCCACCUCCCGGGUUCAAGCAAUUCUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001038603 | 3UTR | AUCUCGGCUCACUGCAACCUCCACCUCCCGGGUUCAAGCAAUUCUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_001038603 | 3UTR | UCGGCUCACUGCAACCUCCACCUCCCGGGUUCAAGCAAUUCUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001038603 | 3UTR | CGGCUCACUGCAACCUCCACCUCCCGGGUUCAAGCAAUUCUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001038603 | 3UTR | UCUCGGCUCACUGCAACCUCCACCUCCCGGGUUCAAGCAAUUCUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001038603 | 3UTR | AAUCUCGGCUCACUGCAACCUCCACCUCCCGGGUUCAAGCAAUUCUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_001038603 | 3UTR | CAAUCUCGGCUCACUGCAACCUCCACCUCCCGGGUUCAAGCAAUUCUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000325631.5 | 3UTR | CACAAUCUCGGCUCACUGCAACCUCCACCUCCCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
231 hsa-miR-3689d Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059166 TXNIP thioredoxin interacting protein 2 4
MIRT080699 KIAA1468 KIAA1468 2 2
MIRT218770 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT278059 KHNYN KH and NYN domain containing 2 2
MIRT345933 EIF4A1 eukaryotic translation initiation factor 4A1 2 2
MIRT366238 VMA21 VMA21, vacuolar ATPase assembly factor 2 2
MIRT449689 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT451149 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451266 NDUFA11 NADH:ubiquinone oxidoreductase subunit A11 2 2
MIRT451375 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT451570 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451585 HIRIP3 HIRA interacting protein 3 2 2
MIRT451614 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451763 ZNF611 zinc finger protein 611 2 6
MIRT452383 LY6E lymphocyte antigen 6 family member E 2 4
MIRT452573 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT452735 PTGES3L prostaglandin E synthase 3 like 2 6
MIRT452867 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT452975 CABP4 calcium binding protein 4 2 2
MIRT453215 CERS1 ceramide synthase 1 2 2
MIRT453259 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT453449 GLG1 golgi glycoprotein 1 2 2
MIRT453479 PITPNM3 PITPNM family member 3 2 2
MIRT453663 CD207 CD207 molecule 2 6
MIRT453724 RAP1GDS1 Rap1 GTPase-GDP dissociation stimulator 1 2 2
MIRT453760 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT454181 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 6
MIRT454330 PPARA peroxisome proliferator activated receptor alpha 2 2
MIRT454338 CDKL1 cyclin dependent kinase like 1 2 2
MIRT454427 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT454665 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT454825 POLR2J3 RNA polymerase II subunit J3 2 2
MIRT455130 TBC1D25 TBC1 domain family member 25 2 2
MIRT455166 SUV39H1 suppressor of variegation 3-9 homolog 1 2 2
MIRT455416 RXRB retinoid X receptor beta 2 2
MIRT455668 GLO1 glyoxalase I 2 2
MIRT455999 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456446 TMEM81 transmembrane protein 81 2 2
MIRT456642 NOS1AP nitric oxide synthase 1 adaptor protein 2 2
MIRT456728 TMEM239 transmembrane protein 239 2 2
MIRT457131 ASPH aspartate beta-hydroxylase 2 2
MIRT457157 MXRA7 matrix remodeling associated 7 2 2
MIRT457358 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT457458 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT457619 UPK3BL uroplakin 3B like 1 2 2
MIRT457692 ZNF587 zinc finger protein 587 2 2
MIRT457727 SMOX spermine oxidase 2 2
MIRT457788 VWA1 von Willebrand factor A domain containing 1 2 2
MIRT457875 THEM6 thioesterase superfamily member 6 2 4
MIRT457909 ZNF212 zinc finger protein 212 2 2
MIRT458395 ABCF1 ATP binding cassette subfamily F member 1 2 2
MIRT458496 MARVELD2 MARVEL domain containing 2 2 2
MIRT458544 CYP2B6 cytochrome P450 family 2 subfamily B member 6 2 2
MIRT458577 TCOF1 treacle ribosome biogenesis factor 1 2 2
MIRT458732 CES2 carboxylesterase 2 2 2
MIRT458814 ZNF843 zinc finger protein 843 2 2
MIRT458931 SAMD4B sterile alpha motif domain containing 4B 2 2
MIRT459341 ZNF17 zinc finger protein 17 2 2
MIRT459365 MPLKIP M-phase specific PLK1 interacting protein 2 6
MIRT459572 NLGN2 neuroligin 2 2 2
MIRT460015 DTX3L deltex E3 ubiquitin ligase 3L 2 4
MIRT460144 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT460653 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT460798 VPS33A VPS33A, CORVET/HOPS core subunit 2 2
MIRT461058 KCNK6 potassium two pore domain channel subfamily K member 6 2 4
MIRT461458 SLC19A3 solute carrier family 19 member 3 2 2
MIRT461572 SCO1 SCO1, cytochrome c oxidase assembly protein 2 4
MIRT461927 TNFSF14 TNF superfamily member 14 2 2
MIRT461953 C3 complement C3 2 2
MIRT462278 KRR1 KRR1, small subunit processome component homolog 2 2
MIRT462744 EFNB1 ephrin B1 2 2
MIRT463136 ZNF451 zinc finger protein 451 2 4
MIRT463566 ZBTB39 zinc finger and BTB domain containing 39 2 6
MIRT463866 WNT7B Wnt family member 7B 2 2
MIRT464326 UST uronyl 2-sulfotransferase 2 2
MIRT464796 UBE2F ubiquitin conjugating enzyme E2 F (putative) 2 2
MIRT465034 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT466207 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT467007 SSBP2 single stranded DNA binding protein 2 2 2
MIRT467029 SRSF1 serine and arginine rich splicing factor 1 2 4
MIRT468001 SKI SKI proto-oncogene 2 2
MIRT468031 SIKE1 suppressor of IKBKE 1 2 6
MIRT468575 SERBP1 SERPINE1 mRNA binding protein 1 2 6
MIRT468834 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT468970 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT469450 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT470888 PLXND1 plexin D1 2 2
MIRT470953 PKM pyruvate kinase, muscle 2 2
MIRT471828 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT472590 NACC1 nucleus accumbens associated 1 2 2
MIRT472805 MTMR12 myotubularin related protein 12 2 2
MIRT472818 MTMR10 myotubularin related protein 10 2 6
MIRT472914 MSN moesin 2 2
MIRT474558 KLHDC3 kelch domain containing 3 2 2
MIRT474716 KIF13A kinesin family member 13A 2 6
MIRT475279 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT475300 IFNLR1 interferon lambda receptor 1 2 2
MIRT475759 HDLBP high density lipoprotein binding protein 2 2
MIRT475786 HDGF heparin binding growth factor 2 2
MIRT475933 GXYLT2 glucoside xylosyltransferase 2 2 8
MIRT476212 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT476238 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 4
MIRT476799 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT477988 DNAL1 dynein axonemal light chain 1 2 2
MIRT478317 DDN dendrin 2 2
MIRT479257 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT479344 CEP97 centrosomal protein 97 2 2
MIRT479522 CDCA4 cell division cycle associated 4 2 2
MIRT479906 CCDC117 coiled-coil domain containing 117 2 6
MIRT481147 AVL9 AVL9 cell migration associated 2 6
MIRT481735 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT482089 ALG8 ALG8, alpha-1,3-glucosyltransferase 2 2
MIRT482389 AEN apoptosis enhancing nuclease 2 2
MIRT483093 TFPI tissue factor pathway inhibitor 2 2
MIRT484246 ANK1 ankyrin 1 2 2
MIRT484342 EPN1 epsin 1 2 4
MIRT489141 C5orf38 chromosome 5 open reading frame 38 2 2
MIRT489163 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489547 SOX11 SRY-box 11 2 4
MIRT489780 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT489799 KRT80 keratin 80 2 6
MIRT490535 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT492198 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492283 SHISA6 shisa family member 6 2 4
MIRT501059 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT501094 SLC5A6 solute carrier family 5 member 6 2 4
MIRT503870 CBS cystathionine-beta-synthase 2 2
MIRT507981 BCL2L13 BCL2 like 13 2 4
MIRT508125 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT508205 SLC35E1 solute carrier family 35 member E1 2 2
MIRT508385 SPTBN2 spectrin beta, non-erythrocytic 2 2 4
MIRT510308 PDRG1 p53 and DNA damage regulated 1 2 2
MIRT510462 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT512227 ATXN3 ataxin 3 2 8
MIRT512665 STEAP3 STEAP3 metalloreductase 2 2
MIRT514184 PGPEP1 pyroglutamyl-peptidase I 2 2
MIRT515053 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515138 ZNF799 zinc finger protein 799 2 4
MIRT515452 ZNF747 zinc finger protein 747 2 2
MIRT515791 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT515905 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT516129 MRPS16 mitochondrial ribosomal protein S16 2 6
MIRT516679 ZNF860 zinc finger protein 860 2 4
MIRT516750 ZNF100 zinc finger protein 100 2 2
MIRT516971 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT517491 NPAP1 nuclear pore associated protein 1 2 2
MIRT517774 PROM2 prominin 2 2 2
MIRT517938 ZNF431 zinc finger protein 431 2 4
MIRT518386 ZNF250 zinc finger protein 250 2 2
MIRT520621 TMEM41B transmembrane protein 41B 2 2
MIRT521028 SLC30A5 solute carrier family 30 member 5 2 2
MIRT521454 RAD51 RAD51 recombinase 2 2
MIRT521564 PTPLB 3-hydroxyacyl-CoA dehydratase 2 1 1
MIRT521581 PTBP2 polypyrimidine tract binding protein 2 2 2
MIRT522263 NKRF NFKB repressing factor 2 2
MIRT522410 MXI1 MAX interactor 1, dimerization protein 2 2
MIRT522543 MED28 mediator complex subunit 28 2 6
MIRT522915 KCNE3 potassium voltage-gated channel subfamily E regulatory subunit 3 2 2
MIRT523029 IGF1 insulin like growth factor 1 2 2
MIRT523854 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT524184 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT524520 CDK19 cyclin dependent kinase 19 2 2
MIRT524674 C12orf5 TP53 induced glycolysis regulatory phosphatase 2 2
MIRT530257 ZNF620 zinc finger protein 620 2 2
MIRT540691 BMP3 bone morphogenetic protein 3 2 2
MIRT540976 C17orf85 nuclear cap binding subunit 3 2 2
MIRT545505 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT545631 GGCX gamma-glutamyl carboxylase 2 2
MIRT547358 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT550701 MPL MPL proto-oncogene, thrombopoietin receptor 2 4
MIRT550717 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT551203 NCR3LG1 natural killer cell cytotoxicity receptor 3 ligand 1 2 2
MIRT553999 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 4
MIRT561081 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT563523 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT564463 SLC35E2 solute carrier family 35 member E2 2 2
MIRT565233 TRAF6 TNF receptor associated factor 6 2 2
MIRT566618 NKAP NFKB activating protein 2 2
MIRT569527 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 2
MIRT569639 QPCT glutaminyl-peptide cyclotransferase 2 2
MIRT570253 SSPN sarcospan 2 2
MIRT570570 OTUD7B OTU deubiquitinase 7B 2 2
MIRT570621 MTF2 metal response element binding transcription factor 2 2 2
MIRT571098 ISLR2 immunoglobulin superfamily containing leucine rich repeat 2 2 2
MIRT575196 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575554 Cd99 CD99 antigen 2 2
MIRT575634 Gnl3l guanine nucleotide binding protein-like 3 (nucleolar)-like 2 2
MIRT608267 NOP14 NOP14 nucleolar protein 2 2
MIRT609314 FXYD6 FXYD domain containing ion transport regulator 6 2 2
MIRT627670 RPL28 ribosomal protein L28 2 2
MIRT631185 TSPAN14 tetraspanin 14 2 2
MIRT631964 YIPF5 Yip1 domain family member 5 2 2
MIRT632885 GINM1 glycoprotein integral membrane 1 2 2
MIRT642618 CDKN3 cyclin dependent kinase inhibitor 3 2 2
MIRT645609 TSPAN6 tetraspanin 6 2 2
MIRT662227 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662329 MYLK3 myosin light chain kinase 3 2 2
MIRT662725 LRRC3C leucine rich repeat containing 3C 2 2
MIRT665520 USP14 ubiquitin specific peptidase 14 2 2
MIRT666634 RBMS2 RNA binding motif single stranded interacting protein 2 2 2
MIRT668969 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT670925 DESI1 desumoylating isopeptidase 1 2 2
MIRT673939 ZNF500 zinc finger protein 500 2 2
MIRT674675 PLCE1 phospholipase C epsilon 1 2 2
MIRT675230 MAK male germ cell associated kinase 2 2
MIRT680864 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT681047 ZDBF2 zinc finger DBF-type containing 2 2 2
MIRT681105 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT683553 HAVCR1 hepatitis A virus cellular receptor 1 2 2
MIRT684508 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT684812 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT685981 CCDC77 coiled-coil domain containing 77 2 2
MIRT686709 TBC1D19 TBC1 domain family member 19 2 2
MIRT686867 SLC25A32 solute carrier family 25 member 32 2 2
MIRT688908 C11orf84 chromosome 11 open reading frame 84 2 2
MIRT691208 KLHL30 kelch like family member 30 2 2
MIRT692298 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT694380 MTA1 metastasis associated 1 2 2
MIRT696497 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT700686 POLR3D RNA polymerase III subunit D 2 2
MIRT701088 PAPOLG poly(A) polymerase gamma 2 2
MIRT703373 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT706189 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT706648 SMIM19 small integral membrane protein 19 2 2
MIRT709466 KRTAP19-1 keratin associated protein 19-1 2 2
MIRT709699 DMWD DM1 locus, WD repeat containing 2 2
MIRT710693 LYRM4 LYR motif containing 4 2 2
MIRT713457 DNAJC11 DnaJ heat shock protein family (Hsp40) member C11 2 2
MIRT722409 RARS2 arginyl-tRNA synthetase 2, mitochondrial 2 2
MIRT725391 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT725548 DNMT3A DNA methyltransferase 3 alpha 2 2

Error report submission