| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4524b |
| Genomic Coordinates | chr17: 69099542 - 69099656 |
| Description | Homo sapiens miR-4524b stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4524b-3p | ||||||||||||
| Sequence | 66| GAGACAGGUUCAUGCUGCUA |85 | ||||||||||||
| Evidence | Experimental | ||||||||||||
| Experiments | SOLiD | ||||||||||||
| SNPs in miRNA |
|
||||||||||||
| Putative Targets | |||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | PAGR1 | ||||||||||||||||||||
| Synonyms | C16orf53, GAS, PA1 | ||||||||||||||||||||
| Description | PAXIP1 associated glutamate rich protein 1 | ||||||||||||||||||||
| Transcript | NM_024516 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on PAGR1 | |||||||||||||||||||||
| 3'UTR of PAGR1 (miRNA target sites are highlighted) |
>PAGR1|NM_024516|3'UTR 1 TTCCCACTGCTCCTGCCTCTAGGGTGCAGTGTCCGTACCTGCTGGAGCCTGGGCCCTCCTTCCCCAGCCCAGACATTGAG 81 AAACTTGGGAAGAAGAGAGAAACCTCAAGCTCCCAAACAGCACGTTGCGGGAAAGAGGAAGAGAGAGTGTGAGTGTGTGT 161 GTGTGTTTTTTCTATTGAACACCTGTAGAGTGTGTGTGTGTGTTTTCTATTGAACACCTATAGAGAGAGTGTGTGTGTTT 241 TCTATTGAACATCTATATAGAGAGAGTGTGTGAGTGTGTGTTTTCTATTGAACACCTATTCAGAGACCTGGACTGAATTT 321 TCTGAGTCTGAAATAAAAGATGCAGAGCTATCATCTCTTAAAAGGAGGGGCTGTAGCTGTAGCTCAACAGTTAGGCCCCA 401 CTTGAAGGGAGAGGCAGAATTGTACTCACCCAGATTGGAAAATGAAAGCCAGATGGGTAGAGGTGCCCTCAGTTAGCACC 481 TGTCCCATCTCGGGCCCTCCAACTCCTCCCAGTCCCACTCCAGTGCAGCCAGCTGGCTCCAAGGTAGAAACCCATGAGCA 561 CTCAGGGAGCAGTGTGCCTTCAGCTGCAGCAGAAGCAGCCCGGAGGATAAAATGAGAACCAGCTGCACACGGGCCCTTTA 641 ACTCCCAAGCCCCACCCCTGGGCTTGGCCTGCCTTGCCCTGCCGGGAAGTGATCCCCAAGGCAGGGTGAGAGTTCCCCAT 721 CTGAGGCGTTTGTTGCAGCTACCTGCACTTCTAGATGTGAGTACATTGTACTAGCCCCCCAAACCCCAAATCAGGGGCAG 801 ATCTTTGTATCCCTTGAGGCTCTCTTTAGTCCTGTCTTGCTTTGAAGGGCCTTGCTTCTGCTGGGGCAGGGAAAACATGT 881 CTGAATCAGAGTGGGGAAGGAGGATGGGTGGTGGCTTTGCTTTTGGAGGTTTCACTTTCCAATAGTTGGGAGTCTTCTGG 961 GTTTTGAAGTAAAGGCAGATTAACACCAACACCGGTCCCCCACCCCCCTGCAACTCTCAGGCCTCTCTCTGACTTCAGGG 1041 TCCCACCTGGGAAATCAGGTGGGGAACCTTACAGGGTCATTCAGACCCCATCTTAGCCCTAGATCGGTGCTTGCTCTACT 1121 CACCTGCACTGTCCTGGGGACCTGGGCTCTGGCCTGTCACCTTGAGCTCCAAGAATGTGACCTGTACCCATTCAGGCCCC 1201 TTAACTCTGACAGATGAGGGTTTCTTACTCCTCCATGCAGGGCTGGGCCAGCTGTTGGTCTCAGTCGATCATTCAGGAAG 1281 TCATTAGCAGAGTGATTTCCAGAAGGCGTAGAATTTAGTGACCAAGGTTCTTTCCTTTTTGGGAGGAGAAAGTGAAAACT 1361 AGGATGCTCAGCTGGACCCACCAGCCTGAGATTCTGGGGATTTTAGAGCTGTCCCTTGGGGAGCCAAGCACTTGGGGGTG 1441 GAGGTGATAGCGAGGCTGATGGCCCCTGTGTTCTCAGCTCTCTGCCTGGGTAGCCCCTGGGTGATGGGGGAGAGGCCAGC 1521 TGTCACGTGGGGTATCAGGTGGCTCTGCCAGAAACTCCCTTGGCACACAGAGCACTGGGTCGGCCCTCGGGTGTGGCTGT 1601 TTGGGCAGGACAGCCCTCTGTATGTAGCCTTGAGCAGGTAGGGGGGCCACCTTGAGTGGGTGGCCCAGAGACAGCCTCAG 1681 GGCTCCAAGGTAACGGGGTGCTCAGGTTATCTTGGGTGCTGCCCTCCCAGGTTCTGGGGGAGCAGAGGCTGGGCGCTGGC 1761 CCAACTTACAGGAAACACTCACCTTTGAACTGCCATTAGCACCATCTGGGCAGTACACAGCCCCACCCAGGTCCTCTAGT 1841 TCTTGTTCTCGGCTTAGAATCTTTGTGTTTCTGCCTGAGAAGCCACTGCCTCCTAGTTTGTGGTCTCTACAGTTATAGCC 1921 AGGTTGGACTTCCGGCTCCGTCCTTTGATAACTGTGTGCTCTTGGGCAAATTTCTTAACTTGCAGGTTCTTGTGAGGATA 2001 ACATGAGTTAATTGAGGGCACTTAACACTACCTGGCACAGATTAAGCTCATCTGAAGTGGGAGCTGTTACTTAGGGGCGT 2081 TTGCCTAGAACACAGGGTCCAGAGGCTCTCTCCCGGAAACTTAGACCCAGTGAGTCAGAAGTGAGGCCTGCAAAAAGCAG 2161 CAGGAGTGGGGTTAAGAATTCCAGCCTAGGGCTGGATGCGGTGGCTCAGGCCTGTAATCCCAGTACTTTGGGAGGCCCGA 2241 ATGGGAGGATGGCTTGAGGCCAGGAGTTCCAGACCAGCCTGAGCAACATAGCGAGACCCTGTCTCTGTTTGTGTGTGTGT 2321 GGTTGGGGTTTTGTTTTTTTTTTTTTTTTAAAGAATTATAGCTCAGTCCTATGATTAGGCAAGTTGAGAAAATATTGATG 2401 AAGATCAGGGGTGCTGAAGCCTGGTTCCTGGGGTCGCTTCTGATCTAGGCGGTTCTTGCCTCTGGTGACTGGTGTTAATT 2481 GGCAGGAGTGGGAGGAGGGAGGACAAGTGGAAGTCTAGGCTGGCTGAGCTGTTCTGTCTCGAAAAGTTCCTAAAACTGTG 2561 CTGCTTTAAAAAAAAAAAAAGTAATTTATGAGACACATTCTCAATTTCCATTAATCATCTCCTAAAGGGGGTAAACCAGG 2641 AAGCCGCTGGGTGAAAACAGGCTGTTGGCAATTCCTGAGTCATGTGACCCATTCTCTAAAGACTAGAATATTTAACTTAA 2721 ATCAGTGAGAAACTCTGTGAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 79447.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase
"PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 79447.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 79447.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| CLIP-seq Support 1 for dataset GSM714642 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000320330.6 | 3UTR | CAGCCUGAGCAACAUAGCGAGACCCUGUCUCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000320330.6 | 3UTR | CAGCCUGAGCAACAUAGCGAGACCCUGUCUCUGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM545213 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000320330.6 | 3UTR | CUGAGCAACAUAGCGAGACCCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000320330.6 | 3UTR | CCUGAGCAACAUAGCGAGACCCUGUCUCUGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM545215 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO4 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000320330.6 | 3UTR | CAGCCUGAGCAACAUAGCGAGACCCUGUCUCUGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000320330.6 | 3UTR | ACCAGCCUGAGCAACAUAGCGAGACCCUGUCUCUGUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000320330.6 | 3UTR | CAGCCUGAGCAACAUAGCGAGACCCUGUCUCUGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM714646 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / mildMNase, repA |
| Location of target site | ENST00000320330.6 | 3UTR | CCAGCCUGAGCAACAUAGCGAGACCCUGUCUCUGUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM714647 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / mildMNase, repB |
| Location of target site | ENST00000320330.6 | 3UTR | CAGCCUGAGCAACAUAGCGAGACCCUGUCUCUGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 10 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000320330.6 | 3UTR | ACCAGCCUGAGCAACAUAGCGAGACCCUGUCUCUGUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 11 for dataset GSM1065667 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
| Location of target site | ENST00000320330.6 | 3UTR | CCAGCCUGAGCAACAUAGCGAGACCCUGUCUCUGUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 12 for dataset GSM1065669 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000320330.6 | 3UTR | CAACAUAGCGAGACCCUGUCUCUGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 13 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000320330.6 | 3UTR | AGCCUGAGCAACAUAGCGAGACCCUGUCUCUGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 14 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000320330.6 | 3UTR | AACAUAGCGAGACCCUGUCUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
175 hsa-miR-4524b-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT064889 | ZBTB18 | zinc finger and BTB domain containing 18 |  |
|
2 | 2 | ||||||
| MIRT075345 | SF3B3 | splicing factor 3b subunit 3 | |
|
2 | 2 | ||||||
| MIRT094174 | PCGF3 | polycomb group ring finger 3 | |
|
2 | 6 | ||||||
| MIRT100109 | ABT1 | activator of basal transcription 1 | |
|
2 | 8 | ||||||
| MIRT102242 | HBP1 | HMG-box transcription factor 1 | |
|
2 | 2 | ||||||
| MIRT124918 | HCCS | holocytochrome c synthase | |
|
2 | 2 | ||||||
| MIRT140195 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | |
|
2 | 2 | ||||||
| MIRT193891 | HACD3 | 3-hydroxyacyl-CoA dehydratase 3 | |
|
2 | 2 | ||||||
| MIRT265634 | LDHA | lactate dehydrogenase A | |
|
2 | 2 | ||||||
| MIRT303878 | VAMP8 | vesicle associated membrane protein 8 | |
|
2 | 2 | ||||||
| MIRT409756 | CRTAP | cartilage associated protein | |
|
2 | 4 | ||||||
| MIRT441503 | SPG20 | spartin | |
|
2 | 6 | ||||||
| MIRT446882 | ZNF554 | zinc finger protein 554 | |
|
2 | 2 | ||||||
| MIRT447093 | COPRS | coordinator of PRMT5 and differentiation stimulator | |
|
2 | 2 | ||||||
| MIRT449987 | AEN | apoptosis enhancing nuclease | |
|
2 | 2 | ||||||
| MIRT452116 | IFITM1 | interferon induced transmembrane protein 1 | |
|
2 | 2 | ||||||
| MIRT452654 | ZNF33A | zinc finger protein 33A | |
|
2 | 2 | ||||||
| MIRT453886 | IFRD1 | interferon related developmental regulator 1 | |
|
2 | 12 | ||||||
| MIRT454143 | FOXRED2 | FAD dependent oxidoreductase domain containing 2 | |
|
2 | 2 | ||||||
| MIRT454501 | SLC29A1 | solute carrier family 29 member 1 (Augustine blood group) | |
|
2 | 2 | ||||||
| MIRT456633 | ARMCX6 | armadillo repeat containing, X-linked 6 | |
|
2 | 2 | ||||||
| MIRT457021 | ACADSB | acyl-CoA dehydrogenase, short/branched chain | |
|
2 | 2 | ||||||
| MIRT457055 | NEGR1 | neuronal growth regulator 1 | |
|
2 | 2 | ||||||
| MIRT457335 | REG4 | regenerating family member 4 | |
|
2 | 2 | ||||||
| MIRT457421 | CASC5 | kinetochore scaffold 1 | |
|
2 | 2 | ||||||
| MIRT457940 | LCE1A | late cornified envelope 1A | |
|
2 | 2 | ||||||
| MIRT458486 | RMI1 | RecQ mediated genome instability 1 | |
|
2 | 10 | ||||||
| MIRT458662 | PAGR1 | PAXIP1 associated glutamate rich protein 1 | |
|
2 | 12 | ||||||
| MIRT459784 | IDH3A | isocitrate dehydrogenase 3 (NAD(+)) alpha | |
|
2 | 2 | ||||||
| MIRT459864 | SVOP | SV2 related protein | |
|
2 | 2 | ||||||
| MIRT460575 | FEM1A | fem-1 homolog A | |
|
2 | 2 | ||||||
| MIRT460987 | STK17B | serine/threonine kinase 17b | |
|
2 | 2 | ||||||
| MIRT462315 | TMEM109 | transmembrane protein 109 | |
|
2 | 2 | ||||||
| MIRT464407 | URM1 | ubiquitin related modifier 1 | |
|
2 | 2 | ||||||
| MIRT465148 | TSC22D2 | TSC22 domain family member 2 | |
|
2 | 2 | ||||||
| MIRT466312 | TIMM22 | translocase of inner mitochondrial membrane 22 | |
|
2 | 2 | ||||||
| MIRT466718 | SYNJ2BP | synaptojanin 2 binding protein | |
|
2 | 2 | ||||||
| MIRT468258 | SFXN4 | sideroflexin 4 | |
|
2 | 2 | ||||||
| MIRT469140 | RNF126 | ring finger protein 126 | |
|
2 | 2 | ||||||
| MIRT471783 | NUP153 | nucleoporin 153 | |
|
2 | 2 | ||||||
| MIRT472506 | NACC2 | NACC family member 2 | |
|
2 | 2 | ||||||
| MIRT474588 | KLF6 | Kruppel like factor 6 | |
|
2 | 2 | ||||||
| MIRT475049 | JOSD1 | Josephin domain containing 1 | |
|
2 | 2 | ||||||
| MIRT476900 | FBXO21 | F-box protein 21 | |
|
2 | 2 | ||||||
| MIRT476972 | FAM83G | family with sequence similarity 83 member G | |
|
2 | 4 | ||||||
| MIRT477433 | EMP1 | epithelial membrane protein 1 | |
|
2 | 2 | ||||||
| MIRT480334 | C5orf51 | chromosome 5 open reading frame 51 | |
|
2 | 10 | ||||||
| MIRT481179 | AVL9 | AVL9 cell migration associated | |
|
2 | 6 | ||||||
| MIRT481693 | AR | androgen receptor | |
|
2 | 2 | ||||||
| MIRT483280 | HIVEP3 | human immunodeficiency virus type I enhancer binding protein 3 | |
|
2 | 4 | ||||||
| MIRT485775 | B4GALT5 | beta-1,4-galactosyltransferase 5 | |
|
2 | 2 | ||||||
| MIRT487424 | CACNB1 | calcium voltage-gated channel auxiliary subunit beta 1 | |
|
2 | 2 | ||||||
| MIRT488002 | RXRB | retinoid X receptor beta | |
|
2 | 2 | ||||||
| MIRT488259 | DNLZ | DNL-type zinc finger | |
|
2 | 4 | ||||||
| MIRT490360 | DPYSL5 | dihydropyrimidinase like 5 | |
|
2 | 2 | ||||||
| MIRT491593 | USB1 | U6 snRNA biogenesis phosphodiesterase 1 | |
|
2 | 2 | ||||||
| MIRT495269 | IGF2BP1 | insulin like growth factor 2 mRNA binding protein 1 | |
|
2 | 4 | ||||||
| MIRT495619 | ZNF736 | zinc finger protein 736 | |
|
2 | 2 | ||||||
| MIRT496167 | ELP3 | elongator acetyltransferase complex subunit 3 | |
|
2 | 2 | ||||||
| MIRT496250 | GJB2 | gap junction protein beta 2 | |
|
2 | 2 | ||||||
| MIRT496915 | RTKN | rhotekin | |
|
2 | 2 | ||||||
| MIRT498713 | PGAM5 | PGAM family member 5, mitochondrial serine/threonine protein phosphatase | |
|
2 | 10 | ||||||
| MIRT501106 | SLC5A6 | solute carrier family 5 member 6 | |
|
2 | 4 | ||||||
| MIRT501831 | NCOA3 | nuclear receptor coactivator 3 | |
|
2 | 2 | ||||||
| MIRT507142 | GIGYF1 | GRB10 interacting GYF protein 1 | |
|
2 | 2 | ||||||
| MIRT510991 | PER1 | period circadian clock 1 | |
|
2 | 4 | ||||||
| MIRT512283 | ARHGDIA | Rho GDP dissociation inhibitor alpha | |
|
2 | 6 | ||||||
| MIRT513152 | CSDC2 | cold shock domain containing C2 | |
|
2 | 2 | ||||||
| MIRT513327 | KCNMB1 | potassium calcium-activated channel subfamily M regulatory beta subunit 1 | |
|
2 | 6 | ||||||
| MIRT515090 | FAM120AOS | family with sequence similarity 120A opposite strand | |
|
2 | 2 | ||||||
| MIRT516113 | OARD1 | O-acyl-ADP-ribose deacylase 1 | |
|
2 | 8 | ||||||
| MIRT516657 | PIGP | phosphatidylinositol glycan anchor biosynthesis class P | |
|
2 | 2 | ||||||
| MIRT516892 | PLEKHS1 | pleckstrin homology domain containing S1 | |
|
2 | 2 | ||||||
| MIRT517966 | ZMIZ2 | zinc finger MIZ-type containing 2 | |
|
2 | 4 | ||||||
| MIRT519492 | PNPLA3 | patatin like phospholipase domain containing 3 | |
|
2 | 2 | ||||||
| MIRT519799 | ZNF226 | zinc finger protein 226 | |
|
2 | 2 | ||||||
| MIRT524309 | CTC1 | CST telomere replication complex component 1 | |
|
2 | 8 | ||||||
| MIRT524425 | CNKSR3 | CNKSR family member 3 | |
|
2 | 2 | ||||||
| MIRT525927 | KIAA0391 | KIAA0391 | |
|
2 | 2 | ||||||
| MIRT528022 | ACOT9 | acyl-CoA thioesterase 9 | |
|
2 | 2 | ||||||
| MIRT528227 | METTL8 | methyltransferase like 8 | |
|
2 | 2 | ||||||
| MIRT528686 | CEP57L1 | centrosomal protein 57 like 1 | |
|
2 | 2 | ||||||
| MIRT528774 | CD1D | CD1d molecule | |
|
2 | 2 | ||||||
| MIRT529935 | P2RX7 | purinergic receptor P2X 7 | |
|
2 | 2 | ||||||
| MIRT530642 | PPIC | peptidylprolyl isomerase C | |
|
2 | 4 | ||||||
| MIRT530683 | CHRNB1 | cholinergic receptor nicotinic beta 1 subunit | |
|
2 | 4 | ||||||
| MIRT531922 | SLC4A1 | solute carrier family 4 member 1 (Diego blood group) | |
|
2 | 2 | ||||||
| MIRT532181 | SEC14L5 | SEC14 like lipid binding 5 | |
|
2 | 4 | ||||||
| MIRT534996 | PRR11 | proline rich 11 | |
|
2 | 6 | ||||||
| MIRT535452 | PDCL | phosducin like | |
|
2 | 4 | ||||||
| MIRT544682 | AP1S1 | adaptor related protein complex 1 sigma 1 subunit | |
|
2 | 2 | ||||||
| MIRT553757 | TARBP2 | TARBP2, RISC loading complex RNA binding subunit | |
|
2 | 4 | ||||||
| MIRT560724 | ZNF749 | zinc finger protein 749 | |
|
2 | 2 | ||||||
| MIRT561518 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | |
|
2 | 2 | ||||||
| MIRT561578 | SLC30A1 | solute carrier family 30 member 1 | |
|
2 | 2 | ||||||
| MIRT562483 | CHORDC1 | cysteine and histidine rich domain containing 1 | |
|
2 | 2 | ||||||
| MIRT565039 | VAV2 | vav guanine nucleotide exchange factor 2 | |
|
2 | 2 | ||||||
| MIRT565348 | TMED4 | transmembrane p24 trafficking protein 4 | |
|
2 | 2 | ||||||
| MIRT567104 | KANSL1 | KAT8 regulatory NSL complex subunit 1 | |
|
2 | 2 | ||||||
| MIRT568879 | LY6H | lymphocyte antigen 6 family member H | |
|
2 | 2 | ||||||
| MIRT569141 | NAP1L4 | nucleosome assembly protein 1 like 4 | |
|
2 | 2 | ||||||
| MIRT569199 | LRRC3C | leucine rich repeat containing 3C | |
|
2 | 2 | ||||||
| MIRT573559 | TMEM120B | transmembrane protein 120B | |
|
2 | 2 | ||||||
| MIRT575931 | Mrrf | mitochondrial ribosome recycling factor | |
|
2 | 6 | ||||||
| MIRT607035 | MRRF | mitochondrial ribosome recycling factor | |
|
2 | 9 | ||||||
| MIRT607194 | SPRY4 | sprouty RTK signaling antagonist 4 | |
|
2 | 2 | ||||||
| MIRT609682 | TMEM213 | transmembrane protein 213 | |
|
2 | 2 | ||||||
| MIRT611227 | ZNF274 | zinc finger protein 274 | |
|
2 | 2 | ||||||
| MIRT611370 | PLXDC1 | plexin domain containing 1 | |
|
2 | 4 | ||||||
| MIRT611640 | SCRG1 | stimulator of chondrogenesis 1 | |
|
2 | 2 | ||||||
| MIRT613011 | GABRB1 | gamma-aminobutyric acid type A receptor beta1 subunit | |
|
2 | 2 | ||||||
| MIRT613532 | GTSE1 | G2 and S-phase expressed 1 | |
|
2 | 2 | ||||||
| MIRT614459 | REL | REL proto-oncogene, NF-kB subunit | |
|
2 | 2 | ||||||
| MIRT616492 | CD300E | CD300e molecule | |
|
2 | 2 | ||||||
| MIRT617288 | GTF2H3 | general transcription factor IIH subunit 3 | |
|
2 | 2 | ||||||
| MIRT618356 | CDKL1 | cyclin dependent kinase like 1 | |
|
2 | 2 | ||||||
| MIRT619529 | ZNF74 | zinc finger protein 74 | |
|
2 | 2 | ||||||
| MIRT619990 | ZSCAN22 | zinc finger and SCAN domain containing 22 | |
|
2 | 2 | ||||||
| MIRT621286 | ATP5E | ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit | |
|
2 | 2 | ||||||
| MIRT621482 | GPKOW | G-patch domain and KOW motifs | |
|
2 | 2 | ||||||
| MIRT625456 | RANGAP1 | Ran GTPase activating protein 1 | |
|
2 | 2 | ||||||
| MIRT626757 | NDUFA9 | NADH:ubiquinone oxidoreductase subunit A9 | |
|
2 | 2 | ||||||
| MIRT629138 | CTCFL | CCCTC-binding factor like | |
|
2 | 2 | ||||||
| MIRT630092 | DCAF10 | DDB1 and CUL4 associated factor 10 | |
|
2 | 2 | ||||||
| MIRT633501 | RNF14 | ring finger protein 14 | |
|
2 | 2 | ||||||
| MIRT633604 | APCDD1 | APC down-regulated 1 | |
|
2 | 2 | ||||||
| MIRT633772 | F2 | coagulation factor II, thrombin | |
|
2 | 2 | ||||||
| MIRT635605 | ADAT1 | adenosine deaminase, tRNA specific 1 | |
|
2 | 2 | ||||||
| MIRT637422 | EPB41L3 | erythrocyte membrane protein band 4.1 like 3 | |
|
2 | 2 | ||||||
| MIRT637822 | PLA2G7 | phospholipase A2 group VII | |
|
2 | 2 | ||||||
| MIRT637978 | RRP36 | ribosomal RNA processing 36 | |
|
2 | 2 | ||||||
| MIRT638385 | RABL3 | RAB, member of RAS oncogene family like 3 | |
|
2 | 2 | ||||||
| MIRT638547 | KIAA1549 | KIAA1549 | |
|
2 | 2 | ||||||
| MIRT642019 | NCKIPSD | NCK interacting protein with SH3 domain | |
|
2 | 2 | ||||||
| MIRT643342 | MICA | MHC class I polypeptide-related sequence A | |
|
2 | 2 | ||||||
| MIRT644281 | LRRC57 | leucine rich repeat containing 57 | |
|
2 | 2 | ||||||
| MIRT646818 | COX19 | COX19, cytochrome c oxidase assembly factor | |
|
2 | 2 | ||||||
| MIRT646839 | TLDC1 | TBC/LysM-associated domain containing 1 | |
|
2 | 2 | ||||||
| MIRT646976 | CYP2W1 | cytochrome P450 family 2 subfamily W member 1 | |
|
2 | 2 | ||||||
| MIRT647735 | CXCR2 | C-X-C motif chemokine receptor 2 | |
|
2 | 2 | ||||||
| MIRT648598 | ZYG11B | zyg-11 family member B, cell cycle regulator | |
|
2 | 2 | ||||||
| MIRT649843 | LIPG | lipase G, endothelial type | |
|
2 | 2 | ||||||
| MIRT650031 | VHL | von Hippel-Lindau tumor suppressor | |
|
2 | 2 | ||||||
| MIRT652082 | TSPAN14 | tetraspanin 14 | |
|
2 | 2 | ||||||
| MIRT652103 | TRUB2 | TruB pseudouridine synthase family member 2 | |
|
2 | 2 | ||||||
| MIRT652902 | SYNPO2L | synaptopodin 2 like | |
|
2 | 2 | ||||||
| MIRT653549 | SLC38A7 | solute carrier family 38 member 7 | |
|
2 | 2 | ||||||
| MIRT653981 | SEMA6B | semaphorin 6B | |
|
2 | 2 | ||||||
| MIRT654287 | RCAN1 | regulator of calcineurin 1 | |
|
2 | 2 | ||||||
| MIRT658372 | FAM63B | MINDY lysine 48 deubiquitinase 2 | |
|
2 | 2 | ||||||
| MIRT660321 | BDP1 | B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB | |
|
2 | 2 | ||||||
| MIRT663063 | LRIF1 | ligand dependent nuclear receptor interacting factor 1 | |
|
2 | 2 | ||||||
| MIRT663269 | ATP1A2 | ATPase Na+/K+ transporting subunit alpha 2 | |
|
2 | 2 | ||||||
| MIRT664076 | ZNF417 | zinc finger protein 417 | |
|
2 | 2 | ||||||
| MIRT664193 | MYOZ2 | myozenin 2 | |
|
2 | 2 | ||||||
| MIRT664512 | POLR3K | RNA polymerase III subunit K | |
|
2 | 2 | ||||||
| MIRT667025 | peptide deformylase, mitochondrial | |
|
2 | 2 | |||||||
| MIRT669621 | ACSL6 | acyl-CoA synthetase long chain family member 6 | |
|
2 | 2 | ||||||
| MIRT670530 | MLLT6 | MLLT6, PHD finger containing | |
|
2 | 2 | ||||||
| MIRT673050 | SGPL1 | sphingosine-1-phosphate lyase 1 | |
|
2 | 2 | ||||||
| MIRT683339 | ZNF581 | zinc finger protein 581 | |
|
2 | 2 | ||||||
| MIRT689264 | WDR83OS | WD repeat domain 83 opposite strand | |
|
2 | 2 | ||||||
| MIRT690902 | TOP2A | DNA topoisomerase II alpha | |
|
2 | 2 | ||||||
| MIRT699196 | SLX4IP | SLX4 interacting protein | |
|
2 | 2 | ||||||
| MIRT702223 | LONRF3 | LON peptidase N-terminal domain and ring finger 3 | |
|
2 | 2 | ||||||
| MIRT707053 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | |
|
2 | 2 | ||||||
| MIRT707080 | MED29 | mediator complex subunit 29 | |
|
2 | 2 | ||||||
| MIRT712347 | NLN | neurolysin | |
|
2 | 2 | ||||||
| MIRT714715 | KIT | KIT proto-oncogene receptor tyrosine kinase | |
|
2 | 2 | ||||||
| MIRT715963 | CES4A | carboxylesterase 4A | |
|
2 | 2 | ||||||
| MIRT718224 | DEFB105B | defensin beta 105B | |
|
2 | 2 | ||||||
| MIRT718244 | DEFB105A | defensin beta 105A | |
|
2 | 2 | ||||||
| MIRT721960 | GCK | glucokinase | |
|
2 | 2 | ||||||
| MIRT723098 | SERINC3 | serine incorporator 3 | |
|
2 | 2 | ||||||
| MIRT725207 | PTPRT | protein tyrosine phosphatase, receptor type T | |
|
2 | 2 | ||||||