>LSM1|NM_014462|3'UTR
   1 TCTTTTGCCCAGAGGCTGTTGGCTCTTGAAGAGTAGGGGCTGTCACTGAGTGAAAGTGACATCCTGGCCACCTCACGCAT
  81 TTGATCACAGACTGTAGAGTTTTGAAAAGTCACTTTTATTTTTAATTATTTTACATATGCAACATGAAGAAATCGTGTAG
 161 GTGGGTTTTTTTTTTAATAACAAAATCACTGTTTAAAGAAACAGTGGCATAGACTCCTTCACACATCACTGTGGCACCAG
 241 CAACTACTTCTTTATATTGTTCTTCATATCCCAAATTAGAGTTTACAGGGACAGTCTTCATTTACTTGTAAATAAAATAT
 321 GAATCTCAAAAGTGTCATGTTATTTCCAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cuacGAGAGACAUGAGUGUGUu 5' ||| || ||||||| Target 5' tagaCTC-CT----TCACACAt 3'	210 - 226	143.00	-11.10
2	miRNA 3' cuAC-GAGAGAC--AU-GAGUGUGUu 5' || | : ||| | |||||:|| Target 5' agTGACATCCTGGCCACCTCACGCAt 3'	55 - 80	130.00	-15.30
3	miRNA 3' cuACGAGA---GACAUG-AGUGUGuu 5' | ||:| :||| | |||:|: Target 5' acTTCTTTATATTGTTCTTCATATcc 3'	246 - 271	104.00	-7.10

Mutant ID	Mutant Position	Mutant Source
COSN18733190	13	COSMIC
COSN31856699	40	COSMIC
COSN30710823	47	COSMIC
COSN30118364	51	COSMIC
COSN30509153	61	COSMIC
COSN31614537	66	COSMIC
COSN30170610	118	COSMIC
COSN28880606	166	COSMIC
COSN31661879	166	COSMIC
COSN20105379	175	COSMIC
rs5891007	177	GWAS

Mutant ID	Mutant Position	Mutant Source
rs1165623004	7	dbSNP
rs1368500430	12	dbSNP
rs1341500913	15	dbSNP
rs764644449	16	dbSNP
rs370074152	17	dbSNP
rs1346839396	18	dbSNP
rs752184193	19	dbSNP
rs907657329	21	dbSNP
rs757496594	22	dbSNP
rs1375730745	24	dbSNP
rs1175109675	31	dbSNP
rs780980149	35	dbSNP
rs767217307	39	dbSNP
rs951937148	40	dbSNP
rs1476686541	41	dbSNP
rs770757790	42	dbSNP
rs759101177	45	dbSNP
rs1214386373	46	dbSNP
rs1265305541	48	dbSNP
rs938489063	56	dbSNP
rs1029312235	69	dbSNP
rs557413484	76	dbSNP
rs919081606	77	dbSNP
rs1425790425	100	dbSNP
rs1165525308	116	dbSNP
rs1036231779	118	dbSNP
rs942092764	125	dbSNP
rs1300554681	141	dbSNP
rs1452160604	148	dbSNP
rs1404116011	154	dbSNP
rs117235344	155	dbSNP
rs192741212	165	dbSNP
rs1458555360	166	dbSNP
rs1845	175	dbSNP
rs1237372357	176	dbSNP
rs397892600	176	dbSNP
rs1008191968	178	dbSNP
rs5891007	178	dbSNP
rs201541221	179	dbSNP
rs749386169	181	dbSNP
rs568627073	187	dbSNP
rs976740442	187	dbSNP
rs1052571015	194	dbSNP
rs546835041	195	dbSNP
rs1001425566	196	dbSNP
rs1250131296	203	dbSNP
rs1417400025	208	dbSNP
rs1160594524	209	dbSNP
rs1381413021	210	dbSNP
rs1434648624	219	dbSNP
rs1172120731	222	dbSNP
rs1181890525	223	dbSNP
rs187041451	224	dbSNP
rs1031575784	225	dbSNP
rs1240814185	226	dbSNP
rs1210987494	231	dbSNP
rs370402587	235	dbSNP
rs571131763	236	dbSNP
rs948262621	240	dbSNP
rs551412169	246	dbSNP
rs1354284095	247	dbSNP
rs1233509406	249	dbSNP
rs1276481764	263	dbSNP
rs1313712325	280	dbSNP
rs1210638741	285	dbSNP
rs1250958214	291	dbSNP
rs1456622211	297	dbSNP
rs182372064	308	dbSNP
rs1454182102	309	dbSNP
rs141144159	320	dbSNP
rs138805927	321	dbSNP
rs940375298	328	dbSNP
rs1012551434	329	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.