>MUC17|NM_001040105|3'UTR
   1 GGCATGGAGCTGAGAAGTCTGGGAGTGAGGAGATCCCAGTCCGGCTAAGCTTGGTGGAGCATTTTCCCATTGAGAGCCTT
  81 CCATGGGAACTCAATGTTCCCATTGTAAGTACAGGAAACAAGCCCTGTACTTACCAAGGAGAAAGAGGAGAGACAGCAGT
 161 GCTGGGAGATTCTCAAATAGAAACCCGTGGACGCTCCAATGGGCTTGTCATGATATCAGGCTAGGCTTTCCTGCTCATTT
 241 TTCAAAGACGCTCCAGATTTGAGGGTACTCTGACTGCAACATCTTTCACCCCATTGATCGCCAGGATTGATTTGGTTGAT
 321 CTGGCTGAGCAGGCGGGTGTCCCCGTCCTCCCTCACTGCCCCATATGTGTCCCTCCTAAAGCTGCATGCTCAGTTGAAGA
 401 GGACGAGAGGACGACCTTCTCTGATAGAGGAGGACCACGCTTCAGTCAAAGGCATACAAGTATCTATCTGGACTTCCCTG
 481 CTAGCACTTCCAAACAAGCTCAGAGATGTTCCTCCCCTCATCTGCCCGGGTTCAGTACCATGGACAGCGCCCTCGACCCG
 561 CTGTTTACAACCATGACCCCTTGGACACTGGACTGCATGCACTTTACATATCACAAAATGCTCTCATAAGAATTATTGCA
 641 TACCATCTTCATGAAAAACACCTGTATTTAAATATAGAGCATTTACCTTTTGGTATATAAGATTGTGGGTATTTTTTAAG
 721 TTCTTATTGTTATGAGTTCTGATTTTTTCCTTAGTAAATATTATAATATATATTTGTAGTAACTAAAAATAATAAAGCAA
 801 TTTTATTACAATTTTAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cggGCUGGAGUGGGUGGGGc 5' | || || ::|||||| Target 5' ctgCAACATCTTTCACCCCa 3'	274 - 293	141.00	-14.70
2	miRNA 3' cgGGCUGGAGUG---GGUGGGGc 5' ||| |||| | |::|||| Target 5' ccCCGTCCTCCCTCACTGCCCCa 3'	341 - 363	130.00	-24.70
3	miRNA 3' cgggcuGGAGUGGGUGGGgc 5' |||||:|::||| Target 5' tcctccCCTCATCTGCCCgg 3'	510 - 529	114.00	-24.40

Mutant ID	Mutant Position	Mutant Source
COSN26985381	8	COSMIC
COSN31495290	28	COSMIC
COSN30467898	38	COSMIC
COSN26985382	43	COSMIC
COSN30447540	57	COSMIC
COSN30472703	67	COSMIC
COSN23500720	77	COSMIC
COSN30459467	100	COSMIC
COSN30135021	111	COSMIC
COSN30144845	111	COSMIC
COSN18732208	127	COSMIC
COSN31577683	157	COSMIC
COSN31592477	185	COSMIC
COSN30104962	193	COSMIC
COSN20212085	300	COSMIC
COSN23279941	300	COSMIC
COSN30136084	301	COSMIC
COSN2188635	628	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs151258613	2	dbSNP
rs187135134	3	dbSNP
rs1454516779	8	dbSNP
rs73404820	9	dbSNP
rs1382925837	13	dbSNP
rs1407550055	21	dbSNP
rs1327225068	26	dbSNP
rs768859443	31	dbSNP
rs776325334	41	dbSNP
rs1225536714	42	dbSNP
rs373198651	43	dbSNP
rs374588011	44	dbSNP
rs1239344573	45	dbSNP
rs1293903388	46	dbSNP
rs1429835869	50	dbSNP
rs1259586733	51	dbSNP
rs1347973600	53	dbSNP
rs377319360	62	dbSNP
rs1457287187	72	dbSNP
rs1236933894	73	dbSNP
rs537994337	86	dbSNP
rs901467856	87	dbSNP
rs528041558	91	dbSNP
rs1009531903	95	dbSNP
rs4729654	97	dbSNP
rs1475331554	98	dbSNP
rs1335710836	102	dbSNP
rs1218619249	105	dbSNP
rs1465367406	107	dbSNP
rs1215725108	110	dbSNP
rs1201935382	112	dbSNP
rs1021644284	114	dbSNP
rs1338602698	124	dbSNP
rs4729655	127	dbSNP
rs1213737991	128	dbSNP
rs1196911308	129	dbSNP
rs1253263182	133	dbSNP
rs1420399613	149	dbSNP
rs1334136916	150	dbSNP
rs952437295	153	dbSNP
rs1470704243	155	dbSNP
rs1359379351	156	dbSNP
rs1005278327	157	dbSNP
rs1169359872	169	dbSNP
rs1409729251	177	dbSNP
rs1179045740	178	dbSNP
rs1191017965	188	dbSNP
rs979598830	193	dbSNP
rs1015175908	195	dbSNP
rs1181818506	200	dbSNP
rs926773317	203	dbSNP
rs1256784236	206	dbSNP
rs1204116278	207	dbSNP
rs1475331160	210	dbSNP
rs961036902	211	dbSNP
rs150528234	214	dbSNP
rs1228977842	221	dbSNP
rs1381928936	222	dbSNP
rs1312921019	223	dbSNP
rs1454089772	225	dbSNP
rs1379329287	226	dbSNP
rs553851030	231	dbSNP
rs573107763	234	dbSNP
rs917135877	237	dbSNP
rs1353055828	238	dbSNP
rs1398540006	245	dbSNP
rs917631424	247	dbSNP
rs1430867426	249	dbSNP
rs1389806079	250	dbSNP
rs939681823	252	dbSNP
rs540493073	265	dbSNP
rs1425579316	267	dbSNP
rs1036675071	268	dbSNP
rs1328287525	273	dbSNP
rs970028924	281	dbSNP
rs919868158	284	dbSNP
rs980312968	285	dbSNP
rs4729656	286	dbSNP
rs117451414	295	dbSNP
rs1053878980	300	dbSNP
rs1205606203	301	dbSNP
rs914020578	302	dbSNP
rs1040485360	306	dbSNP
rs945354525	307	dbSNP
rs1321757712	315	dbSNP
rs901904626	316	dbSNP
rs1041077682	319	dbSNP
rs138451649	325	dbSNP
rs932934220	326	dbSNP
rs746031829	328	dbSNP
rs968728378	334	dbSNP
rs1301791129	335	dbSNP
rs1459901396	336	dbSNP
rs113215808	343	dbSNP
rs1033841619	344	dbSNP
rs770007377	345	dbSNP
rs775846381	346	dbSNP
rs76767333	352	dbSNP
rs370692314	357	dbSNP
rs896932331	367	dbSNP
rs1014323709	377	dbSNP
rs992244786	379	dbSNP
rs1023986646	382	dbSNP
rs961143743	388	dbSNP
rs970355377	392	dbSNP
rs980044842	395	dbSNP
rs532819869	397	dbSNP
rs957182233	401	dbSNP
rs1189680414	403	dbSNP
rs1415182960	405	dbSNP
rs988680349	414	dbSNP
rs1318247587	416	dbSNP
rs1288531336	417	dbSNP
rs1222555968	423	dbSNP
rs913972511	434	dbSNP
rs919601060	437	dbSNP
rs1388944861	440	dbSNP
rs1392076790	446	dbSNP
rs551380551	453	dbSNP
rs1288838328	454	dbSNP
rs931259191	457	dbSNP
rs1390957150	458	dbSNP
rs530904614	461	dbSNP
rs1480237027	462	dbSNP
rs1374513688	465	dbSNP
rs977130559	466	dbSNP
rs1433629899	469	dbSNP
rs1260926480	480	dbSNP
rs772989105	491	dbSNP
rs1465826748	494	dbSNP
rs1297486642	501	dbSNP
rs1268211438	503	dbSNP
rs1202576744	505	dbSNP
rs566312621	513	dbSNP
rs1320952777	521	dbSNP
rs76925166	522	dbSNP
rs932858539	529	dbSNP
rs1050018901	531	dbSNP
rs1040871553	535	dbSNP
rs567619609	540	dbSNP
rs766223558	549	dbSNP
rs901952563	550	dbSNP
rs1355040360	560	dbSNP
rs776576328	561	dbSNP
rs888732288	563	dbSNP
rs1383188976	564	dbSNP
rs1298211249	570	dbSNP
rs941529929	571	dbSNP
rs549261043	572	dbSNP
rs1174579137	574	dbSNP
rs768735036	574	dbSNP
rs556602576	576	dbSNP
rs1372316298	579	dbSNP
rs1190850475	580	dbSNP
rs1281633907	581	dbSNP
rs759474729	582	dbSNP
rs896881318	585	dbSNP
rs1014021228	599	dbSNP
rs1024350848	606	dbSNP
rs1248629662	607	dbSNP
rs567557391	608	dbSNP
rs1459620908	611	dbSNP
rs1280268964	612	dbSNP
rs538031344	615	dbSNP
rs903844592	619	dbSNP
rs1346103966	622	dbSNP
rs1251112979	625	dbSNP
rs556409624	635	dbSNP
rs1000786179	640	dbSNP
rs369527683	661	dbSNP
rs1212388967	663	dbSNP
rs1344921298	668	dbSNP
rs1299084915	672	dbSNP
rs1451973482	674	dbSNP
rs1380698739	676	dbSNP
rs1255044654	677	dbSNP
rs1336353494	678	dbSNP
rs1482726991	681	dbSNP
rs1186688233	684	dbSNP
rs1033894077	685	dbSNP
rs764972517	688	dbSNP
rs1431467993	697	dbSNP
rs1013718269	704	dbSNP
rs1390676118	705	dbSNP
rs1162906881	710	dbSNP
rs1442187908	712	dbSNP
rs1238735119	718	dbSNP
rs1187731802	721	dbSNP
rs1436879256	727	dbSNP
rs867165337	728	dbSNP
rs55903219	734	dbSNP
rs1245922803	736	dbSNP
rs1354251129	756	dbSNP
rs1245686109	759	dbSNP
rs1395586323	759	dbSNP
rs1032923863	762	dbSNP
rs1306446816	762	dbSNP
rs957295313	771	dbSNP
rs972502435	779	dbSNP
rs57645356	795	dbSNP
rs1020145041	812	dbSNP
rs1374871757	814	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.