pre-miRNA Information
pre-miRNA hsa-mir-605   
Genomic Coordinates chr10: 51299573 - 51299655
Synonyms MIRN605, hsa-mir-605, MIR605
Description Homo sapiens miR-605 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-605-3p
Sequence 51| AGAAGGCACUAUGAGAUUUAGA |72
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 10 + 51299626 27587585, 28550310, 26028588, 26449202, 26487287, 29165639 MiREDiBase
A-to-I 14 10 + 51299636 29233923 MiREDiBase
A-to-I 20 10 + 51299642 18684997, 26449202, 27587585, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs759219082 5 dbSNP
rs1491224174 9 dbSNP
rs746611214 10 dbSNP
rs367648737 11 dbSNP
rs1359467239 14 dbSNP
rs1442565019 16 dbSNP
Putative Targets

Gene Information
Gene Symbol IL17RB   
Synonyms CRL4, EVI27, IL17BR, IL17RH1
Description interleukin 17 receptor B
Transcript NM_018725   
Expression
Putative miRNA Targets on IL17RB
3'UTR of IL17RB
(miRNA target sites are highlighted)
>IL17RB|NM_018725|3'UTR
   1 CCCACCCATGAGAAGCAAGAGACCTTAAAGGCTTCCTATCCCACCAATTACAGGGAAAAAACGTGTGATGATCCTGAAGC
  81 TTACTATGCAGCCTACAAACAGCCTTAGTAATTAAAACATTTTATACCAATAAAATTTTCAAATATTGCTAACTAATGTA
 161 GCATTAACTAACGATTGGAAACTACATTTACAACTTCAAAGCTGTTTTATACATAGAAATCAATTACAGTTTTAATTGAA
 241 AACTATAACCATTTTGATAATGCAACAATAAAGCATCTTCAGCCAAACATCTAGTCTTCCATAGACCATGCATTGCAGTG
 321 TACCCAGAACTGTTTAGCTAATATTCTATGTTTAATTAATGAATACTAACTCTAAGAACCCCTCACTGATTCACTCAATA
 401 GCATCTTAAGTGAAAAACCTTCTATTACATGCAAAAAATCATTGTTTTTAAGATAACAAAAGTAGGGAATAAACAAGCTG
 481 AACCCACTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agAU-UUAGAGUAUC-ACGGAAga 5'
            || || :||| || ||::||  
Target 5' ttTACAACTTCAAAGCTGTTTTat 3'
187 - 210 112.00 -5.30
2
miRNA  3' agauUUAGA--GUAUC----ACGGAAga 5'
              |:|||  |||||    ||| ||  
Target 5' atctAGTCTTCCATAGACCATGCATTgc 3'
289 - 316 110.00 -8.83
3
miRNA  3' agAUU-UAGAGUAUCAC-----GGAAGa 5'
            ||: ||||:| ||||     ||||| 
Target 5' aaTAGCATCTTA-AGTGAAAAACCTTCt 3'
397 - 423 107.00 -13.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31532788 50 COSMIC
COSN28838259 62 COSMIC
COSN27530365 70 COSMIC
COSN20090822 113 COSMIC
COSN31532776 113 COSMIC
COSN19711474 231 COSMIC
COSN1952793 295 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1250720065 1 dbSNP
rs976443123 6 dbSNP
rs1481471917 10 dbSNP
rs1327995114 15 dbSNP
rs1186418426 23 dbSNP
rs1389386735 24 dbSNP
rs375781273 26 dbSNP
rs759681740 26 dbSNP
rs376880235 30 dbSNP
rs951206936 32 dbSNP
rs1338108451 33 dbSNP
rs745605858 38 dbSNP
rs369678154 39 dbSNP
rs1043265 41 dbSNP
rs1343867309 42 dbSNP
rs767870420 46 dbSNP
rs1453454934 49 dbSNP
rs1287971709 50 dbSNP
rs1390948694 52 dbSNP
rs954586240 56 dbSNP
rs1009117826 63 dbSNP
rs563882862 63 dbSNP
rs754664754 64 dbSNP
rs1259631700 83 dbSNP
rs1339822704 86 dbSNP
rs1245222586 94 dbSNP
rs941247791 98 dbSNP
rs1457373025 107 dbSNP
rs1055745366 110 dbSNP
rs964965198 111 dbSNP
rs1453260560 132 dbSNP
rs916562663 133 dbSNP
rs1341468818 144 dbSNP
rs1251643285 155 dbSNP
rs1223813639 158 dbSNP
rs978821857 159 dbSNP
rs1316758364 160 dbSNP
rs1452652759 165 dbSNP
rs948046241 165 dbSNP
rs1334645448 169 dbSNP
rs66720724 173 dbSNP
rs1393611440 176 dbSNP
rs376944865 184 dbSNP
rs955989276 186 dbSNP
rs988898325 203 dbSNP
rs906611093 213 dbSNP
rs1387242681 215 dbSNP
rs1164468462 218 dbSNP
rs1439383317 221 dbSNP
rs546346493 230 dbSNP
rs709324 231 dbSNP
rs1184128215 232 dbSNP
rs1439473023 237 dbSNP
rs3017 246 dbSNP
rs774726189 248 dbSNP
rs1293741859 250 dbSNP
rs927591736 250 dbSNP
rs867617078 262 dbSNP
rs3774626 267 dbSNP
rs1277240156 269 dbSNP
rs1167714605 271 dbSNP
rs28385752 283 dbSNP
rs1018498576 292 dbSNP
rs1403428449 292 dbSNP
rs146382687 303 dbSNP
rs139753652 308 dbSNP
rs571426330 314 dbSNP
rs1029370244 320 dbSNP
rs1402631296 324 dbSNP
rs1383139531 331 dbSNP
rs534304389 338 dbSNP
rs1470573901 342 dbSNP
rs1326669804 348 dbSNP
rs568509549 352 dbSNP
rs1364246116 353 dbSNP
rs186349320 356 dbSNP
rs1479452743 358 dbSNP
rs982583630 361 dbSNP
rs574005428 364 dbSNP
rs1226332491 365 dbSNP
rs1270733613 380 dbSNP
rs1268229949 383 dbSNP
rs1223007421 399 dbSNP
rs542638643 400 dbSNP
rs535861087 404 dbSNP
rs1246595037 405 dbSNP
rs764912563 409 dbSNP
rs1206313886 420 dbSNP
rs1017852293 423 dbSNP
rs1290998578 426 dbSNP
rs909690957 429 dbSNP
rs1490206249 431 dbSNP
rs1220429904 433 dbSNP
rs1264057170 443 dbSNP
rs1447806480 449 dbSNP
rs1347979359 453 dbSNP
rs6798958 464 dbSNP
rs991377227 468 dbSNP
rs915836940 472 dbSNP
rs947995270 474 dbSNP
rs1046826382 475 dbSNP
rs1371728418 479 dbSNP
rs1032889270 481 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293/HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells) ...

- Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology.

Article - Kishore S; Gruber AR; Jedlinski DJ; Syed et al.
- Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
CLIP-seq Support 1 for dataset GSM1067869
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (asynchronous cells)
Location of target site ENST00000288167.3 | 3UTR | CCUUCCGGGUUCACGCCAUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000288167.3 | 3UTR | CCUUCCGGGUUCACGCCAUUCUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
100 hsa-miR-605-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT061339 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT061584 BTG2 BTG anti-proliferation factor 2 2 6
MIRT076140 WDR81 WD repeat domain 81 2 2
MIRT079361 CCDC137 coiled-coil domain containing 137 2 2
MIRT079547 VAMP3 vesicle associated membrane protein 3 2 2
MIRT096242 CANX calnexin 2 2
MIRT243877 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT249186 AKIRIN1 akirin 1 2 8
MIRT273604 SP1 Sp1 transcription factor 2 2
MIRT316766 FOXC1 forkhead box C1 2 4
MIRT322410 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT370117 TRIB3 tribbles pseudokinase 3 2 2
MIRT392725 UBN2 ubinuclein 2 2 2
MIRT406910 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT407440 CTDSP1 CTD small phosphatase 1 2 2
MIRT441887 RD3 retinal degeneration 3 2 4
MIRT444979 C15orf52 chromosome 15 open reading frame 52 2 2
MIRT445241 FOXD4 forkhead box D4 2 2
MIRT445500 FOXD4L5 forkhead box D4 like 5 2 2
MIRT445503 FOXD4L4 forkhead box D4 like 4 2 2
MIRT447025 FOXD4L1 forkhead box D4 like 1 2 2
MIRT447743 TMCC3 transmembrane and coiled-coil domain family 3 2 2
MIRT448761 HDX highly divergent homeobox 2 2
MIRT450003 HAX1 HCLS1 associated protein X-1 2 2
MIRT452830 FAM131B family with sequence similarity 131 member B 2 2
MIRT452872 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT453506 ARRB1 arrestin beta 1 2 2
MIRT454169 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT458742 CES2 carboxylesterase 2 2 2
MIRT459166 HSPA6 heat shock protein family A (Hsp70) member 6 2 21
MIRT460246 IL17RB interleukin 17 receptor B 2 4
MIRT460514 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT460698 RNF157 ring finger protein 157 2 2
MIRT461481 METTL1 methyltransferase like 1 2 2
MIRT462617 C20orf27 chromosome 20 open reading frame 27 2 4
MIRT463233 ZNF131 zinc finger protein 131 2 2
MIRT465699 TNPO2 transportin 2 2 8
MIRT466304 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT468957 RPS14 ribosomal protein S14 2 6
MIRT469571 RARA retinoic acid receptor alpha 2 2
MIRT469685 RAB5B RAB5B, member RAS oncogene family 2 2
MIRT470800 PMP22 peripheral myelin protein 22 2 2
MIRT471649 PANK2 pantothenate kinase 2 2 4
MIRT471722 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT472281 NFIB nuclear factor I B 2 4
MIRT473680 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT475859 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT477326 EPHA2 EPH receptor A2 2 2
MIRT477831 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478572 CTNND1 catenin delta 1 2 4
MIRT479634 CD81 CD81 molecule 2 2
MIRT481950 ANKRD11 ankyrin repeat domain 11 2 2
MIRT483696 ZNF74 zinc finger protein 74 2 6
MIRT488798 MALT1 MALT1 paracaspase 2 2
MIRT489066 STARD3 StAR related lipid transfer domain containing 3 2 2
MIRT492533 PSMD11 proteasome 26S subunit, non-ATPase 11 2 2
MIRT492857 NRARP NOTCH regulated ankyrin repeat protein 2 2
MIRT496793 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT500122 ZNF106 zinc finger protein 106 2 4
MIRT505359 TMEM167A transmembrane protein 167A 2 2
MIRT506786 KLHL15 kelch like family member 15 2 6
MIRT510692 SRM spermidine synthase 2 6
MIRT515841 CEP104 centrosomal protein 104 2 4
MIRT516448 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 2 4
MIRT528855 PKP1 plakophilin 1 2 2
MIRT533848 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT539025 ATXN7L1 ataxin 7 like 1 2 4
MIRT542872 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT546543 SATB2 SATB homeobox 2 2 2
MIRT554114 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT560569 ZNF460 zinc finger protein 460 2 2
MIRT560796 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT562836 GCFC2 GC-rich sequence DNA-binding factor 2 2 2
MIRT563109 IFRD2 interferon related developmental regulator 2 2 2
MIRT564177 MRPL49 mitochondrial ribosomal protein L49 2 2
MIRT564283 ASB1 ankyrin repeat and SOCS box containing 1 2 2
MIRT564350 USP22 ubiquitin specific peptidase 22 2 2
MIRT565279 TNFRSF21 TNF receptor superfamily member 21 2 2
MIRT565338 TMEM104 transmembrane protein 104 2 2
MIRT565905 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT567108 ITGB1 integrin subunit beta 1 2 2
MIRT567601 FANCF Fanconi anemia complementation group F 2 2
MIRT567779 DGAT2 diacylglycerol O-acyltransferase 2 2 2
MIRT568075 CENPQ centromere protein Q 2 2
MIRT624304 COL12A1 collagen type XII alpha 1 chain 2 2
MIRT644395 CDKL1 cyclin dependent kinase like 1 2 2
MIRT661547 ZNF674 zinc finger protein 674 2 4
MIRT670949 IRAK3 interleukin 1 receptor associated kinase 3 2 2
MIRT672951 AKAP5 A-kinase anchoring protein 5 2 2
MIRT697426 ZFP36 ZFP36 ring finger protein 2 2
MIRT700793 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT702657 ITGA3 integrin subunit alpha 3 2 2
MIRT708945 FZR1 fizzy and cell division cycle 20 related 1 2 2
MIRT713657 PLCE1 phospholipase C epsilon 1 2 2
MIRT719239 CYSLTR2 cysteinyl leukotriene receptor 2 2 2
MIRT719951 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT722048 HLA-E major histocompatibility complex, class I, E 2 2
MIRT722201 URM1 ubiquitin related modifier 1 2 2
MIRT724790 C1D C1D nuclear receptor corepressor 2 2
MIRT734347 CYP2B6 cytochrome P450 family 2 subfamily B member 6 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-605 Anthranilamide-pyrazolo[1,5-a]pyrimidine NULL NULL Quantitative real-time PCR neuroblastoma cells 23992861 2013 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-605 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-605 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-605-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)

Error report submission