miRTarBase - #MIRT460346


—
pre-miRNA Information
pre-miRNA hsa-mir-4534   
Genomic Coordinates chr22: 37988794 - 37988853
Description Homo sapiens miR-4534 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4534
Sequence 36| GGAUGGAGGAGGGGUCU |52
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs890798116 2 dbSNP
rs1382774432 11 dbSNP
rs982883970 15 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ARL14EP   
Synonyms ARF7EP, C11orf46, dJ299F11.1
Description ADP ribosylation factor like GTPase 14 effector protein
Transcript NM_152316   
Expression
Putative miRNA Targets on ARL14EP
3'UTR of ARL14EP
(miRNA target sites are highlighted)		 
>ARL14EP|NM_152316|3'UTR
   1 TCTGCGGTACCAAACTATGGAGCCTTTAAAGGTCTTTATTTCTAAAAATCTGTTACTCTAAGATACATTTTAAGCTTGAT
  81 TATCATATGACAAAGATTTTAAAACCATCTCAGTGTGCCCTAATTTTTCATCTTGGGTGCTTTAAGATTCACTATTTGAT
 161 ATAAATTCAGATAGGCTATTTTTCAGTAGTCAGCGTTAAGCCTGTCTGGATCAATATAAACAAGTAGGGTGTAGGCAGTC
 241 CTCTATTTGCATGTTTCCCATGGGCACAAATTTCAGTGACCTAGATTTAGTTTAAATACCAGTTTCCTTACCAGGAAGGA
 321 AAGAAAACTGGTAAGGAAACTGTTGTTGTTAAAATCTAGGTTAAAATTTTAGTTAGCACATTGTAACTGAGTAATTACAT
 401 GAAGTACAAACCTCTCTGCTAGCTCTTCAGTCTACAAATCGCTATGTAAATAACAGATATGCTTCATGATTGTGACCAGT
 481 CATGTTATTTCTTTCAAATTCTTCCAGTGGTTTGTCCCTGTGCATCTGTTAATTCAGTTCACGTACAGCAGAGCATGTAG
 561 TTATGCTGTCTCTCTGTCATCTACTTGACATTCTATAGAAGTGAACACTCGAAAGAACTGGTCAACAAAGATGAAAGTGC
 641 AGCAAAGCAATGAAAAATGATAACACTGGAAGTGAAATTTTAATCAAACATAAATGAATTTGTAGAAGAAGTCACTGACC
 721 ATGGGAATGTTGTTCTTGCTGCTGTGTATTCATAGGAGCTTAGTGAAGGCAAACTTACCAACACAAATAAGCAAAGTGGT
 801 TGCAATAAAGACAGATACGTCCCAGAGGAAGTGATGGTTAAAAAAAAAAAACTTTACATTAAAAGATATTTAATGTGAAT
 881 ATAGAAATATTTCACAACATTGAAAGCACAAGCAATAAAAGGGTGGAAGCTGACCCAAACTTAGAAGGAGTATGGCAGTT
 961 TGCCGTGAACATAAAAGATGCTTACTCAGTATGGTAAGTTACTTGCCAGAAAAAAAGGCAAGCCCTATTCAAACTACTTT
1041 GTTTTTACAATGAAATAAAACACTTTAATTCTATTTCTAATGTTTTAAATTACAGTGTACTAAATATTTTTAAACATTTT
1121 TGCATTTTTTTCTACATTTATAACTGGTCTTAAGAGTTTTTAATATTTGAGCAGAACCTTAAAGGTCATGGAACAATCAT
1201 CATTTTCCCTATTGATTATTAAGATTGCAGGACCATTTTTATGGTCCCACAGTACCATGTGAAATGAGGATCGCTTGTAG
1281 CTGGGAACAGTGCTTACTTCAGGGAAAACTGATTTTGATAGAACCGACTAGTTGAGTATTAAACTGTTTTGGAAATAATT
1361 TATATATCTAAGTGCTGAAATATATTTCTCTTCTCCCCACTTATTCAAATAAAAAAGTTTTAATACTAAAAAAAAAAAAA
1441 AAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucUGGGG--AGGAGGUAGg 5'
            :|||:  |::|:|||| 
Target 5' gtGCCCTAATTTTTCATCt 3'
 115 - 133 121.00 -12.60
2 
miRNA  3' ucuggggAGGAGGUAGg 5'
                 |||||:||: 
Target 5' taggcagTCCTCTATTt 3'
 232 - 248 118.00 -13.70
3 
miRNA  3' ucugGGGAG-GAGGUAGg 5'
              |: || |||::|| 
Target 5' tatgCTGTCTCTCTGTCa 3'
 562 - 579 113.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31494398 7 COSMIC
COSN30500675 9 COSMIC
COSN30525431 43 COSMIC
COSN30540765 52 COSMIC
COSN16894495 63 COSMIC
COSN30177562 97 COSMIC
COSN10084738 123 COSMIC
COSN20108111 343 COSMIC
COSN21002733 791 COSMIC
COSN1131611 853 COSMIC
COSN26193869 1221 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs753963742 6 dbSNP
rs199587403 7 dbSNP
rs762788716 9 dbSNP
rs372069539 12 dbSNP
rs766244089 13 dbSNP
rs751303562 14 dbSNP
rs1479835481 15 dbSNP
rs755110879 16 dbSNP
rs759249156 18 dbSNP
rs1211138447 23 dbSNP
rs1301473162 24 dbSNP
rs752181320 24 dbSNP
rs1450691601 25 dbSNP
rs948456127 33 dbSNP
rs1370868789 37 dbSNP
rs778291735 39 dbSNP
rs1449980090 43 dbSNP
rs1045714695 44 dbSNP
rs1371298610 48 dbSNP
rs1473789456 53 dbSNP
rs1410346847 68 dbSNP
rs181105070 68 dbSNP
rs1000993227 69 dbSNP
rs752747775 75 dbSNP
rs1378305375 76 dbSNP
rs1158633126 88 dbSNP
rs1476382587 89 dbSNP
rs1253083298 90 dbSNP
rs1183268436 106 dbSNP
rs762495142 114 dbSNP
rs1255973870 129 dbSNP
rs1222206 134 dbSNP
rs1256116328 135 dbSNP
rs1466235375 149 dbSNP
rs1314823805 169 dbSNP
rs778240000 175 dbSNP
rs765838585 179 dbSNP
rs534874710 187 dbSNP
rs1354616608 190 dbSNP
rs1310946063 192 dbSNP
rs747414181 195 dbSNP
rs964388531 196 dbSNP
rs866889092 202 dbSNP
rs1288436711 206 dbSNP
rs1365683518 207 dbSNP
rs1451733811 207 dbSNP
rs1160220720 210 dbSNP
rs1475055240 211 dbSNP
rs553057298 213 dbSNP
rs996866307 217 dbSNP
rs1443565273 232 dbSNP
rs185942757 233 dbSNP
rs1203978819 241 dbSNP
rs1484610792 246 dbSNP
rs1335095600 251 dbSNP
rs535118668 263 dbSNP
rs878990750 265 dbSNP
rs1333856814 280 dbSNP
rs1291256330 281 dbSNP
rs1246900024 285 dbSNP
rs556534065 290 dbSNP
rs982551580 303 dbSNP
rs575187423 307 dbSNP
rs908371891 309 dbSNP
rs959890473 314 dbSNP
rs1461156655 318 dbSNP
rs147967552 325 dbSNP
rs1392731884 331 dbSNP
rs371342239 341 dbSNP
rs771665762 341 dbSNP
rs948352494 357 dbSNP
rs35570843 363 dbSNP
rs1191707319 369 dbSNP
rs1426172481 371 dbSNP
rs1277497965 380 dbSNP
rs1042730436 388 dbSNP
rs1467808993 392 dbSNP
rs1271027470 410 dbSNP
rs545676196 419 dbSNP
rs190359910 423 dbSNP
rs936918858 433 dbSNP
rs1250641209 438 dbSNP
rs1253791656 439 dbSNP
rs1225211959 451 dbSNP
rs1482627000 457 dbSNP
rs1367402242 460 dbSNP
rs1298505982 461 dbSNP
rs1200733340 481 dbSNP
rs117810597 485 dbSNP
rs1368978908 486 dbSNP
rs892619648 492 dbSNP
rs1406281589 498 dbSNP
rs1396258628 499 dbSNP
rs1166643834 501 dbSNP
rs1191903747 504 dbSNP
rs540006406 513 dbSNP
rs1391482462 521 dbSNP
rs569745035 522 dbSNP
rs1453268213 524 dbSNP
rs866270504 536 dbSNP
rs1250706182 538 dbSNP
rs568939399 544 dbSNP
rs530208678 546 dbSNP
rs1465599133 551 dbSNP
rs1303660336 552 dbSNP
rs1194000265 554 dbSNP
rs1377437021 556 dbSNP
rs899916335 556 dbSNP
rs143599966 559 dbSNP
rs372285321 565 dbSNP
rs1397950878 566 dbSNP
rs1276782953 569 dbSNP
rs1437521485 569 dbSNP
rs1297301295 571 dbSNP
rs144017697 573 dbSNP
rs952742852 577 dbSNP
rs1412210823 590 dbSNP
rs1371654424 591 dbSNP
rs1004066252 594 dbSNP
rs1433502856 595 dbSNP
rs1311116200 596 dbSNP
rs779788611 611 dbSNP
rs1478188996 619 dbSNP
rs1232076404 627 dbSNP
rs531268321 628 dbSNP
rs552853221 629 dbSNP
rs1483916448 630 dbSNP
rs1252399895 632 dbSNP
rs1257425016 642 dbSNP
rs1350987393 643 dbSNP
rs1215407382 649 dbSNP
rs992630469 661 dbSNP
rs1280880134 667 dbSNP
rs915609002 668 dbSNP
rs969854221 670 dbSNP
rs1278021803 672 dbSNP
rs536934512 703 dbSNP
rs1188856695 704 dbSNP
rs1312779307 705 dbSNP
rs978806596 710 dbSNP
rs1356925080 719 dbSNP
rs925629597 720 dbSNP
rs183919537 723 dbSNP
rs1414556281 725 dbSNP
rs934338982 726 dbSNP
rs1052685800 729 dbSNP
rs188868271 733 dbSNP
rs1412503796 734 dbSNP
rs914191397 740 dbSNP
rs1432678765 741 dbSNP
rs944147706 745 dbSNP
rs1041235356 752 dbSNP
rs1397145904 769 dbSNP
rs1282359145 771 dbSNP
rs148647180 779 dbSNP
rs1418154452 799 dbSNP
rs567860318 806 dbSNP
rs1361007005 815 dbSNP
rs1381898837 818 dbSNP
rs996926420 819 dbSNP
rs535154873 820 dbSNP
rs1318097219 834 dbSNP
rs1291719848 838 dbSNP
rs1415796787 840 dbSNP
rs1458527686 840 dbSNP
rs34546702 840 dbSNP
rs397745662 840 dbSNP
rs1366771052 841 dbSNP
rs1182395875 845 dbSNP
rs1414765117 847 dbSNP
rs1048979504 855 dbSNP
rs768384770 862 dbSNP
rs1004200755 866 dbSNP
rs1272798505 882 dbSNP
rs117185309 884 dbSNP
rs1323910758 885 dbSNP
rs7116893 890 dbSNP
rs1417858356 898 dbSNP
rs1239063582 902 dbSNP
rs1214551919 903 dbSNP
rs540903500 905 dbSNP
rs747646404 908 dbSNP
rs191952345 913 dbSNP
rs1218306958 914 dbSNP
rs1324813379 926 dbSNP
rs1264238184 927 dbSNP
rs1351450129 931 dbSNP
rs1165351915 935 dbSNP
rs1409370221 943 dbSNP
rs1388385138 948 dbSNP
rs970325837 949 dbSNP
rs539017776 950 dbSNP
rs1192260385 955 dbSNP
rs1255006080 956 dbSNP
rs558035162 957 dbSNP
rs1489658956 962 dbSNP
rs773213318 965 dbSNP
rs150719584 966 dbSNP
rs1340739268 984 dbSNP
rs1277399640 986 dbSNP
rs1323072825 989 dbSNP
rs1381079384 998 dbSNP
rs955683807 1010 dbSNP
rs552894094 1019 dbSNP
rs1384771647 1025 dbSNP
rs118190791 1028 dbSNP
rs1293967220 1033 dbSNP
rs1441215569 1034 dbSNP
rs182990819 1040 dbSNP
rs944284796 1044 dbSNP
rs1349067832 1050 dbSNP
rs1170439129 1056 dbSNP
rs1430442199 1066 dbSNP
rs542329717 1067 dbSNP
rs1174189499 1074 dbSNP
rs35260056 1077 dbSNP
rs921423345 1099 dbSNP
rs544812837 1118 dbSNP
rs1176914953 1123 dbSNP
rs1482284495 1125 dbSNP
rs1327830578 1126 dbSNP
rs1048463881 1127 dbSNP
rs564377022 1132 dbSNP
rs1445322473 1134 dbSNP
rs1483087094 1136 dbSNP
rs1254967926 1151 dbSNP
rs765444505 1157 dbSNP
rs1230607688 1158 dbSNP
rs530952541 1162 dbSNP
rs868679134 1163 dbSNP
rs1301561067 1170 dbSNP
rs1227504891 1174 dbSNP
rs1348436010 1180 dbSNP
rs545835217 1182 dbSNP
rs564837459 1186 dbSNP
rs1410407900 1188 dbSNP
rs895709793 1191 dbSNP
rs1301237385 1192 dbSNP
rs1225859718 1200 dbSNP
rs1378361554 1215 dbSNP
rs1063960 1217 dbSNP
rs139050625 1218 dbSNP
rs1471789562 1223 dbSNP
rs1023328643 1224 dbSNP
rs1183521516 1236 dbSNP
rs1475207546 1238 dbSNP
rs1254694220 1242 dbSNP
rs187529603 1247 dbSNP
rs868392899 1248 dbSNP
rs1275584711 1251 dbSNP
rs1256184420 1257 dbSNP
rs758416461 1259 dbSNP
rs1326788134 1269 dbSNP
rs1198042669 1273 dbSNP
rs1228926145 1275 dbSNP
rs543417174 1278 dbSNP
rs529410929 1282 dbSNP
rs374775303 1285 dbSNP
rs1397807551 1287 dbSNP
rs988446335 1297 dbSNP
rs1018608379 1298 dbSNP
rs1455903388 1301 dbSNP
rs1391287185 1320 dbSNP
rs1160282993 1322 dbSNP
rs191856311 1324 dbSNP
rs568565536 1326 dbSNP
rs539428318 1327 dbSNP
rs551081545 1328 dbSNP
rs1190262979 1341 dbSNP
rs1425010588 1362 dbSNP
rs566806125 1365 dbSNP
rs144522339 1373 dbSNP
rs932799716 1401 dbSNP
rs555636707 1405 dbSNP
rs1355401945 1411 dbSNP
rs1263560478 1418 dbSNP
rs1246948287 1429 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucuggggaGGAGGUAGg 5'
                  :||||||| 
Target 5' -----caaUCUCCAUCu 3'
 		1 - 12
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000282032.3 | 3UTR | CAAUCUCCAUCUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
141 hsa-miR-4534 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT087131 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT179641 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 2
MIRT243304 SLC25A36 solute carrier family 25 member 36 2 2
MIRT325574 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT448776 GNA13 G protein subunit alpha 13 2 2
MIRT451456 HSD11B1L hydroxysteroid 11-beta dehydrogenase 1 like 2 2
MIRT452150 PPP2R1B protein phosphatase 2 scaffold subunit Abeta 2 2
MIRT454199 HLA-A major histocompatibility complex, class I, A 2 2
MIRT455984 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT456058 SLC25A28 solute carrier family 25 member 28 2 2
MIRT457082 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT457278 ALDH9A1 aldehyde dehydrogenase 9 family member A1 2 2
MIRT457361 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT457396 CAMK2A calcium/calmodulin dependent protein kinase II alpha 2 2
MIRT458817 ZNF843 zinc finger protein 843 2 2
MIRT459697 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT460346 ARL14EP ADP ribosylation factor like GTPase 14 effector protein 2 2
MIRT462713 MAPK13 mitogen-activated protein kinase 13 2 2
MIRT464278 VASH1 vasohibin 1 2 2
MIRT465634 TNRC18P2 trinucleotide repeat containing 18 pseudogene 2 2 10
MIRT465772 TMOD3 tropomodulin 3 2 2
MIRT466414 TFDP1 transcription factor Dp-1 2 2
MIRT467122 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 8
MIRT467475 SMYD1 SET and MYND domain containing 1 2 4
MIRT468462 SET SET nuclear proto-oncogene 2 2
MIRT468618 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT468835 RRM2 ribonucleotide reductase regulatory subunit M2 2 4
MIRT470890 PLXND1 plexin D1 2 2
MIRT473226 SMCR7L mitochondrial elongation factor 1 2 4
MIRT473858 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT474975 KCND3 potassium voltage-gated channel subfamily D member 3 2 2
MIRT475858 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT478569 CTNND1 catenin delta 1 2 2
MIRT479347 CEP97 centrosomal protein 97 2 2
MIRT479910 CCDC117 coiled-coil domain containing 117 2 4
MIRT480122 CALR calreticulin 2 2
MIRT480892 BCL9L B-cell CLL/lymphoma 9 like 2 2
MIRT481149 AVL9 AVL9 cell migration associated 2 6
MIRT481527 ARL5B ADP ribosylation factor like GTPase 5B 2 10
MIRT481896 ANKRD40 ankyrin repeat domain 40 2 2
MIRT490138 FN3K fructosamine 3 kinase 2 4
MIRT490329 ANK1 ankyrin 1 2 4
MIRT491472 TMEM214 transmembrane protein 214 2 2
MIRT503552 TIGIT T-cell immunoreceptor with Ig and ITIM domains 2 4
MIRT504413 TUBA1B tubulin alpha 1b 2 4
MIRT508207 SLC35E1 solute carrier family 35 member E1 2 2
MIRT508333 SLC37A4 solute carrier family 37 member 4 2 6
MIRT516381 TRAF3IP2 TRAF3 interacting protein 2 2 4
MIRT518549 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT522545 MED28 mediator complex subunit 28 2 6
MIRT522592 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1 like 2 2
MIRT522923 KAT6A lysine acetyltransferase 6A 2 4
MIRT525937 C11orf74 chromosome 11 open reading frame 74 2 2
MIRT527021 PABPN1L poly(A) binding protein nuclear 1 like, cytoplasmic 2 2
MIRT530396 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT530660 TRIM56 tripartite motif containing 56 2 2
MIRT531625 TM4SF5 transmembrane 4 L six family member 5 2 4
MIRT532703 TCN2 transcobalamin 2 2 4
MIRT540173 MB21D1 Mab-21 domain containing 1 2 2
MIRT540756 UTP6 UTP6, small subunit processome component 2 2
MIRT541966 ZNF485 zinc finger protein 485 2 2
MIRT542738 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 2 2
MIRT543090 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT550687 YARS tyrosyl-tRNA synthetase 2 2
MIRT553466 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT559980 RELA RELA proto-oncogene, NF-kB subunit 2 2
MIRT561084 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT561738 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT569872 KLK10 kallikrein related peptidase 10 2 2
MIRT570264 ARPC3 actin related protein 2/3 complex subunit 3 2 2
MIRT573431 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT573874 PRPS1L1 phosphoribosyl pyrophosphate synthetase 1-like 1 2 2
MIRT576905 Poteg POTE ankyrin domain family, member G 2 2
MIRT607934 ANG angiogenin 2 2
MIRT609472 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT612179 EMC3 ER membrane protein complex subunit 3 2 2
MIRT613428 GALNT6 polypeptide N-acetylgalactosaminyltransferase 6 2 2
MIRT613746 GPR155 G protein-coupled receptor 155 2 2
MIRT615034 DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 2
MIRT615565 JPH2 junctophilin 2 2 2
MIRT615937 MAP1LC3B microtubule associated protein 1 light chain 3 beta 2 2
MIRT616643 LRAT lecithin retinol acyltransferase 2 4
MIRT630890 SLC25A33 solute carrier family 25 member 33 2 2
MIRT636542 FAM126B family with sequence similarity 126 member B 2 2
MIRT641392 NUBPL nucleotide binding protein like 2 2
MIRT641410 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT643184 HYPK huntingtin interacting protein K 2 2
MIRT652600 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT653974 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT655692 NUDT3 nudix hydrolase 3 2 2
MIRT660734 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 4
MIRT661604 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT663284 ZNF675 zinc finger protein 675 2 2
MIRT666337 SKAP2 src kinase associated phosphoprotein 2 2 2
MIRT666636 RBMS2 RNA binding motif single stranded interacting protein 2 2 2
MIRT667125 OCIAD2 OCIA domain containing 2 2 2
MIRT670412 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT671119 ZNF573 zinc finger protein 573 2 2
MIRT671152 ANKRD9 ankyrin repeat domain 9 2 2
MIRT671336 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT671867 ZNF429 zinc finger protein 429 2 2
MIRT671972 IKZF3 IKAROS family zinc finger 3 2 2
MIRT672062 KIAA0930 KIAA0930 2 2
MIRT672652 SLC25A16 solute carrier family 25 member 16 2 4
MIRT672671 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT672768 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT672927 LRRC2 leucine rich repeat containing 2 2 2
MIRT673156 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT673270 RUNDC1 RUN domain containing 1 2 2
MIRT673329 THAP1 THAP domain containing 1 2 2
MIRT673348 SLC35F6 solute carrier family 35 member F6 2 2
MIRT673664 ZNF440 zinc finger protein 440 2 2
MIRT673901 DCTN6 dynactin subunit 6 2 2
MIRT674399 MYCBP MYC binding protein 2 2
MIRT674523 PRR23A proline rich 23A 2 2
MIRT674831 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 2 2
MIRT675064 FGD6 FYVE, RhoGEF and PH domain containing 6 2 2
MIRT675078 CCR6 C-C motif chemokine receptor 6 2 2
MIRT675123 FSD2 fibronectin type III and SPRY domain containing 2 2 2
MIRT679399 IL10RB interleukin 10 receptor subunit beta 2 2
MIRT686608 TMEM70 transmembrane protein 70 2 2
MIRT690371 ZSWIM7 zinc finger SWIM-type containing 7 2 2
MIRT694464 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT695706 OLA1 Obg like ATPase 1 2 2
MIRT696846 WDR13 WD repeat domain 13 2 2
MIRT700894 PER2 period circadian clock 2 2 2
MIRT701924 MLLT1 MLLT1, super elongation complex subunit 2 2
MIRT704918 CCDC36 coiled-coil domain containing 36 2 2
MIRT706211 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706546 GJD2 gap junction protein delta 2 2 2
MIRT706727 RFK riboflavin kinase 2 2
MIRT707366 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT707416 RRP7A ribosomal RNA processing 7 homolog A 2 2
MIRT710646 GLUL glutamate-ammonia ligase 2 2
MIRT712298 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT713709 HIST3H2BB histone cluster 3 H2B family member b 2 2
MIRT713751 SLC9A8 solute carrier family 9 member A8 2 2
MIRT716423 VPS53 VPS53, GARP complex subunit 2 2
MIRT717169 UCHL3 ubiquitin C-terminal hydrolase L3 2 2
MIRT718877 PDIA3 protein disulfide isomerase family A member 3 2 2
MIRT720096 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4534 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4534 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PATU8988)
hsa-miR-4534 Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4534 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4534 Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4534 Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-mir-4534 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-4534 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4534 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-4534 Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-4534 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4534 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-4534 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4534 Platinum 23939 resistant tissue
hsa-miR-4534 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4534 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4534 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)

Error report submission