pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-497 |
Genomic Coordinates | chr17: 7017911 - 7018022 |
Synonyms | MIRN497, hsa-mir-497, MIR497 |
Description | Homo sapiens miR-497 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-497-3p | ||||||||||||||||||||||||||||
Sequence | 64| CAAACCACACUGUGGUGUUAGA |85 | ||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||
Experiments | Cloned | ||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | KRT10 | ||||||||||||||||||||
Synonyms | BCIE, BIE, CK10, EHK, K10, KPP | ||||||||||||||||||||
Description | keratin 10 | ||||||||||||||||||||
Transcript | NM_000421 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on KRT10 | |||||||||||||||||||||
3'UTR of KRT10 (miRNA target sites are highlighted) |
>KRT10|NM_000421|3'UTR 1 CAAAACCAGAGTAATCAAGACAATTATTGAAGAGGTGGCGCCCGACGGTAGAGTTCTTTCATCTATGGTTGAATCAGAAA 81 CCAAGAAACACTACTATTAAACTGCATCAAGAGGAAAGAGTCTCCCTTCACACAGACCATTATTTACAGATGCATGGAAA 161 ACAAAGTCTCCAAGAAAACACTTCTGTCTTGATGGTCTATGGAAATAGACCTTGAAAATAAGGTGTCTACAAGGTGTTTT 241 GTGGTTTCTGTATTTCTTCTTTTCACTTTACCAGAAAGTGTTCTTTAATGGAAAGAAAAACAACTTTCTGTTCTCATTTA 321 CTAATGAATTTCAATAAACTTTCTTACTGATGCAAACTAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 3858.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 3858.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | TZM-bl |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 5 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Prostate Tissue | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000269576.5 | 3UTR | UGGUUUCUGUAUUUCUUCUUUUCACUUUACCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000269576.5 | 3UTR | UGGUUUCUGUAUUUCUUCUUUUCACUUUACCAGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000269576.5 | 3UTR | UUUCUGUAUUUCUUCUUUUCACUUUACCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000269576.5 | 3UTR | UGGUUUCUGUAUUUCUUCUUUUCACUUUACCAGAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000269576.5 | 3UTR | UUCUGUAUUUCUUCUUUUCACUUUACCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000269576.5 | 3UTR | GUUUCUGUAUUUCUUCUUUUCACUUUACCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
95 hsa-miR-497-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT092955 | CYP2U1 | cytochrome P450 family 2 subfamily U member 1 | 2 | 4 | ||||||||
MIRT124568 | PRRC2B | proline rich coiled-coil 2B | 2 | 2 | ||||||||
MIRT125196 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | 2 | 4 | ||||||||
MIRT147296 | KPNA2 | karyopherin subunit alpha 2 | 2 | 8 | ||||||||
MIRT163999 | KIAA1109 | KIAA1109 | 2 | 4 | ||||||||
MIRT252495 | NWD1 | NACHT and WD repeat domain containing 1 | 2 | 2 | ||||||||
MIRT357969 | GRPEL2 | GrpE like 2, mitochondrial | 2 | 2 | ||||||||
MIRT443007 | TRIOBP | TRIO and F-actin binding protein | 2 | 2 | ||||||||
MIRT443524 | NETO1 | neuropilin and tolloid like 1 | 2 | 2 | ||||||||
MIRT443573 | EVX2 | even-skipped homeobox 2 | 2 | 2 | ||||||||
MIRT443656 | BACH1 | BTB domain and CNC homolog 1 | 2 | 2 | ||||||||
MIRT460670 | KRT10 | keratin 10 | 2 | 8 | ||||||||
MIRT464761 | UBE2N | ubiquitin conjugating enzyme E2 N | 2 | 2 | ||||||||
MIRT465032 | LINC00598 | long intergenic non-protein coding RNA 598 | 2 | 2 | ||||||||
MIRT465040 | TTC39C | tetratricopeptide repeat domain 39C | 2 | 2 | ||||||||
MIRT468667 | SEC62 | SEC62 homolog, preprotein translocation factor | 2 | 2 | ||||||||
MIRT473694 | MAPK8 | mitogen-activated protein kinase 8 | 2 | 4 | ||||||||
MIRT477618 | EFNA3 | ephrin A3 | 2 | 2 | ||||||||
MIRT480506 | C11orf57 | chromosome 11 open reading frame 57 | 2 | 2 | ||||||||
MIRT480592 | BUB3 | BUB3, mitotic checkpoint protein | 2 | 2 | ||||||||
MIRT486915 | ZNF398 | zinc finger protein 398 | 2 | 6 | ||||||||
MIRT487770 | ANKEF1 | ankyrin repeat and EF-hand domain containing 1 | 2 | 16 | ||||||||
MIRT493265 | MDFIC | MyoD family inhibitor domain containing | 2 | 2 | ||||||||
MIRT495271 | SLC1A2 | solute carrier family 1 member 2 | 2 | 4 | ||||||||
MIRT495309 | CHST12 | carbohydrate sulfotransferase 12 | 2 | 2 | ||||||||
MIRT496681 | DPP6 | dipeptidyl peptidase like 6 | 2 | 4 | ||||||||
MIRT496891 | FOXP1 | forkhead box P1 | 2 | 2 | ||||||||
MIRT497330 | IRF4 | interferon regulatory factor 4 | 2 | 2 | ||||||||
MIRT498272 | KIAA1644 | KIAA1644 | 2 | 2 | ||||||||
MIRT498634 | CHD4 | chromodomain helicase DNA binding protein 4 | 2 | 10 | ||||||||
MIRT500581 | USP53 | ubiquitin specific peptidase 53 | 2 | 2 | ||||||||
MIRT500751 | TMPPE | transmembrane protein with metallophosphoesterase domain | 2 | 6 | ||||||||
MIRT509668 | ZNF354B | zinc finger protein 354B | 2 | 10 | ||||||||
MIRT510919 | PSMA2 | proteasome subunit alpha 2 | 2 | 4 | ||||||||
MIRT519118 | CEP76 | centrosomal protein 76 | 2 | 2 | ||||||||
MIRT526193 | ABCG2 | ATP binding cassette subfamily G member 2 (Junior blood group) | 2 | 2 | ||||||||
MIRT526746 | HLA-DOB | major histocompatibility complex, class II, DO beta | 2 | 2 | ||||||||
MIRT527270 | FBLN2 | fibulin 2 | 2 | 2 | ||||||||
MIRT528198 | PLEKHM2 | pleckstrin homology and RUN domain containing M2 | 2 | 2 | ||||||||
MIRT528330 | TBC1D22B | TBC1 domain family member 22B | 2 | 2 | ||||||||
MIRT530346 | GABRB3 | gamma-aminobutyric acid type A receptor beta3 subunit | 2 | 2 | ||||||||
MIRT533627 | TMX3 | thioredoxin related transmembrane protein 3 | 2 | 2 | ||||||||
MIRT533738 | TMEM200C | transmembrane protein 200C | 2 | 2 | ||||||||
MIRT533779 | TMEM133 | transmembrane protein 133 | 2 | 2 | ||||||||
MIRT534317 | SKIDA1 | SKI/DACH domain containing 1 | 2 | 2 | ||||||||
MIRT538438 | COG5 | component of oligomeric golgi complex 5 | 2 | 2 | ||||||||
MIRT539156 | AREL1 | apoptosis resistant E3 ubiquitin protein ligase 1 | 2 | 2 | ||||||||
MIRT539474 | ADARB2 | adenosine deaminase, RNA specific B2 (inactive) | 2 | 2 | ||||||||
MIRT539620 | SHISA9 | shisa family member 9 | 2 | 2 | ||||||||
MIRT539650 | BUB1 | BUB1 mitotic checkpoint serine/threonine kinase | 2 | 2 | ||||||||
MIRT540346 | OPHN1 | oligophrenin 1 | 2 | 2 | ||||||||
MIRT540412 | PITPNC1 | phosphatidylinositol transfer protein, cytoplasmic 1 | 2 | 2 | ||||||||
MIRT541200 | HSP90AA1 | heat shock protein 90 alpha family class A member 1 | 2 | 2 | ||||||||
MIRT541395 | CDC27 | cell division cycle 27 | 2 | 2 | ||||||||
MIRT546443 | SNX5 | sorting nexin 5 | 2 | 2 | ||||||||
MIRT547369 | MSI2 | musashi RNA binding protein 2 | 2 | 2 | ||||||||
MIRT553288 | TSPAN3 | tetraspanin 3 | 2 | 2 | ||||||||
MIRT554402 | SERP1 | stress associated endoplasmic reticulum protein 1 | 2 | 2 | ||||||||
MIRT557822 | FOXN2 | forkhead box N2 | 2 | 2 | ||||||||
MIRT568530 | ANP32E | acidic nuclear phosphoprotein 32 family member E | 2 | 2 | ||||||||
MIRT569508 | THYN1 | thymocyte nuclear protein 1 | 2 | 2 | ||||||||
MIRT570707 | FAM69A | family with sequence similarity 69 member A | 2 | 2 | ||||||||
MIRT608376 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | 2 | 2 | ||||||||
MIRT608483 | NKTR | natural killer cell triggering receptor | 2 | 6 | ||||||||
MIRT613533 | TRA2B | transformer 2 beta homolog | 2 | 2 | ||||||||
MIRT616601 | ELP2 | elongator acetyltransferase complex subunit 2 | 2 | 2 | ||||||||
MIRT618166 | DUSP18 | dual specificity phosphatase 18 | 2 | 2 | ||||||||
MIRT632059 | CEP135 | centrosomal protein 135 | 2 | 2 | ||||||||
MIRT647379 | ZDHHC23 | zinc finger DHHC-type containing 23 | 2 | 2 | ||||||||
MIRT648366 | POTED | POTE ankyrin domain family member D | 2 | 2 | ||||||||
MIRT651075 | ZNF518B | zinc finger protein 518B | 2 | 4 | ||||||||
MIRT653618 | SLC30A4 | solute carrier family 30 member 4 | 2 | 2 | ||||||||
MIRT653636 | SLC30A1 | solute carrier family 30 member 1 | 2 | 2 | ||||||||
MIRT654895 | POU2F1 | POU class 2 homeobox 1 | 2 | 2 | ||||||||
MIRT656232 | MFSD6 | major facilitator superfamily domain containing 6 | 2 | 2 | ||||||||
MIRT659880 | CAPRIN1 | cell cycle associated protein 1 | 2 | 2 | ||||||||
MIRT660526 | ARL4C | ADP ribosylation factor like GTPase 4C | 2 | 2 | ||||||||
MIRT666286 | SLC30A3 | solute carrier family 30 member 3 | 2 | 2 | ||||||||
MIRT686808 | SNX2 | sorting nexin 2 | 2 | 4 | ||||||||
MIRT695302 | TK1 | thymidine kinase 1 | 2 | 2 | ||||||||
MIRT699737 | SERINC3 | serine incorporator 3 | 2 | 2 | ||||||||
MIRT700794 | PIAS2 | protein inhibitor of activated STAT 2 | 2 | 2 | ||||||||
MIRT712270 | PPP1CB | protein phosphatase 1 catalytic subunit beta | 2 | 2 | ||||||||
MIRT712617 | KNSTRN | kinetochore localized astrin/SPAG5 binding protein | 2 | 2 | ||||||||
MIRT714264 | RPL10A | ribosomal protein L10a | 2 | 2 | ||||||||
MIRT715072 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | 2 | 2 | ||||||||
MIRT715386 | TADA3 | transcriptional adaptor 3 | 2 | 2 | ||||||||
MIRT716397 | NPAS1 | neuronal PAS domain protein 1 | 2 | 2 | ||||||||
MIRT725328 | NFASC | neurofascin | 2 | 2 | ||||||||
MIRT725503 | GANAB | glucosidase II alpha subunit | 2 | 2 | ||||||||
MIRT732913 | IRAK2 | interleukin 1 receptor associated kinase 2 | 3 | 0 | ||||||||
MIRT734890 | SMAD3 | SMAD family member 3 | 3 | 0 | ||||||||
MIRT737328 | LINC02476 | long intergenic non-protein coding RNA 2476 | 3 | 0 | ||||||||
MIRT737544 | MALAT1 | metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) | 4 | 0 | ||||||||
MIRT755545 | PAK1 | p21 (RAC1) activated kinase 1 | 3 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|