pre-miRNA Information
pre-miRNA hsa-mir-383   
Genomic Coordinates chr8: 14853438 - 14853510
Synonyms MIRN383, hsa-mir-383, MIR383
Description Homo sapiens miR-383 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-383-5p
Sequence 7| AGAUCAGAAGGUGAUUGUGGCU |28
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN26994512 7 COSMIC
COSN30109318 22 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs112302475 1 dbSNP
rs756858316 1 dbSNP
rs757040124 3 dbSNP
rs1419085595 4 dbSNP
rs912771170 5 dbSNP
rs1190491141 6 dbSNP
rs986831934 7 dbSNP
rs1471946963 9 dbSNP
rs1237080909 10 dbSNP
rs757526216 11 dbSNP
rs1431645579 13 dbSNP
rs763747200 13 dbSNP
rs184836993 15 dbSNP
rs913343525 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KIAA1009
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.551 0.04 0.736 0 11 Click to see details
LUSC -0.726 0.08 -0.700 0.09 5 Click to see details
PRAD 0.166 0.14 0.163 0.15 44 Click to see details
PAAD 0.61 0.29 0.500 0.33 3 Click to see details
LIHC 0.107 0.29 0.003 0.49 28 Click to see details
CHOL -0.234 0.33 -0.143 0.39 6 Click to see details
BRCA -0.059 0.38 -0.031 0.44 30 Click to see details
BLCA 0.102 0.38 0.045 0.45 11 Click to see details
UCEC 0.063 0.47 0.400 0.3 4 Click to see details
STAD -0.001 0.5 -0.020 0.47 18 Click to see details
STAD -0.001 0.5 -0.020 0.47 18 Click to see details
STAD -0.001 0.5 -0.020 0.47 18 Click to see details
STAD -0.001 0.5 -0.020 0.47 18 Click to see details
STAD -0.001 0.5 -0.020 0.47 18 Click to see details
STAD -0.001 0.5 -0.020 0.47 18 Click to see details
STAD -0.001 0.5 -0.020 0.47 18 Click to see details
STAD -0.001 0.5 -0.020 0.47 18 Click to see details
96 hsa-miR-383-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004443 VEGFA vascular endothelial growth factor A 5 2
MIRT006137 DIO1 iodothyronine deiodinase 1 3 1
MIRT006535 IRF1 interferon regulatory factor 1 3 1
MIRT007246 IGF1R insulin like growth factor 1 receptor 1 1
MIRT007305 PRDX3 peroxiredoxin 3 1 1
MIRT054359 CCND1 cyclin D1 4 2
MIRT057087 DDIT4 DNA damage inducible transcript 4 2 2
MIRT086536 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT086544 MOB4 MOB family member 4, phocein 2 2
MIRT438194 PPP1R10 protein phosphatase 1 regulatory subunit 10 3 1
MIRT448282 ZMYM2 zinc finger MYM-type containing 2 2 2
MIRT451601 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT453387 RHD Rh blood group D antigen 2 2
MIRT458521 C5orf22 chromosome 5 open reading frame 22 2 2
MIRT459720 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT461491 KIAA1009 centrosomal protein 162 1 1
MIRT463261 ZIC5 Zic family member 5 2 2
MIRT464237 VCP valosin containing protein 2 2
MIRT465320 TRAF5 TNF receptor associated factor 5 2 2
MIRT465774 TMOD3 tropomodulin 3 2 2
MIRT467879 SLC22A23 solute carrier family 22 member 23 2 2
MIRT469636 RAD21 RAD21 cohesin complex component 2 6
MIRT472041 NPAT nuclear protein, coactivator of histone transcription 2 2
MIRT476568 GABARAPL1 GABA type A receptor associated protein like 1 2 2
MIRT478586 CTDSPL2 CTD small phosphatase like 2 2 2
MIRT478870 CREBRF CREB3 regulatory factor 2 2
MIRT482202 AHR aryl hydrocarbon receptor 2 2
MIRT484237 IER2 immediate early response 2 2 2
MIRT487480 NRF1 nuclear respiratory factor 1 2 6
MIRT493746 GRAP2 GRB2-related adaptor protein 2 2 2
MIRT496836 ZNF460 zinc finger protein 460 2 2
MIRT497234 APOL2 apolipoprotein L2 2 2
MIRT499424 PLCG2 phospholipase C gamma 2 2 9
MIRT500598 UBN2 ubinuclein 2 2 10
MIRT502859 CHEK2 checkpoint kinase 2 2 6
MIRT507727 CLIC4 chloride intracellular channel 4 2 4
MIRT510509 YOD1 YOD1 deubiquitinase 2 6
MIRT511901 FNBP1L formin binding protein 1 like 2 6
MIRT514393 CLUAP1 clusterin associated protein 1 2 2
MIRT520180 WBP2 WW domain binding protein 2 2 4
MIRT531214 PLA2G4D phospholipase A2 group IVD 2 2
MIRT532846 ZNF699 zinc finger protein 699 2 2
MIRT533461 TRIM71 tripartite motif containing 71 2 2
MIRT539263 ANKRD44 ankyrin repeat domain 44 2 2
MIRT539380 ADSS adenylosuccinate synthase 2 6
MIRT548129 GAS1 growth arrest specific 1 2 2
MIRT550662 ZFP37 ZFP37 zinc finger protein 2 2
MIRT551499 CENPN centromere protein N 2 2
MIRT553778 TAF13 TATA-box binding protein associated factor 13 2 2
MIRT554376 SFPQ splicing factor proline and glutamine rich 2 2
MIRT555821 PCDH11Y protocadherin 11 Y-linked 2 4
MIRT557558 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT557694 GATA6 GATA binding protein 6 2 2
MIRT561383 TWF1 twinfilin actin binding protein 1 2 2
MIRT561414 TSN translin 2 2
MIRT561867 MSH6 mutS homolog 6 2 2
MIRT567383 GTPBP3 GTP binding protein 3, mitochondrial 2 2
MIRT569272 PCDH11X protocadherin 11 X-linked 2 2
MIRT569556 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT569760 RIMBP3C RIMS binding protein 3C 2 5
MIRT573387 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT573456 RPL41 ribosomal protein L41 2 2
MIRT573968 DDX21 DExD-box helicase 21 2 2
MIRT574163 ATG10 autophagy related 10 2 2
MIRT574659 KLHL15 kelch like family member 15 2 2
MIRT574907 Plcg2 phospholipase C, gamma 2 2 6
MIRT607496 HEBP2 heme binding protein 2 2 2
MIRT612840 KCNJ12 potassium voltage-gated channel subfamily J member 12 2 4
MIRT613962 TMEM59 transmembrane protein 59 2 2
MIRT621125 PCNXL2 pecanex homolog 2 2 2
MIRT625216 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT643337 MICA MHC class I polypeptide-related sequence A 2 2
MIRT646342 CLIC6 chloride intracellular channel 6 2 2
MIRT647361 WDR5B WD repeat domain 5B 2 2
MIRT650308 SLC35E2 solute carrier family 35 member E2 2 2
MIRT651372 ZBTB21 zinc finger and BTB domain containing 21 2 2
MIRT655301 PEAR1 platelet endothelial aggregation receptor 1 2 2
MIRT681918 SLC11A2 solute carrier family 11 member 2 2 2
MIRT684165 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT688053 GLUL glutamate-ammonia ligase 2 2
MIRT690210 C5orf45 MRN complex interacting protein 2 2
MIRT691024 CRTC3 CREB regulated transcription coactivator 3 2 2
MIRT697699 WAC WW domain containing adaptor with coiled-coil 2 2
MIRT698201 TMEM30A transmembrane protein 30A 2 2
MIRT698857 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT702292 LDHA lactate dehydrogenase A 4 2
MIRT703341 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 2 2
MIRT704082 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT713729 SUCO SUN domain containing ossification factor 2 2
MIRT719487 RBM27 RNA binding motif protein 27 2 2
MIRT722080 SMC2 structural maintenance of chromosomes 2 2 2
MIRT724102 TMEM199 transmembrane protein 199 2 2
MIRT725124 SYNRG synergin gamma 2 2
MIRT725601 CAPN6 calpain 6 2 2
MIRT737186 RBM3 RNA binding motif (RNP1, RRM) protein 3 4 0
MIRT755379 NOS3 nitric oxide synthase 3 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-383 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-383 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-383 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-383 Doxorubicin approved 31703 Microarray heart 22859947 2012 up-regulated
miR-383 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-383 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-383-5p Vincristine 5978 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-383-5p Daunorubicin 30323 NSC82151 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-383-5p Prednisolone 5755 NSC9120 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-383-5p L-Asparaginase resistant High Lymphoblastic Leukemia tissue
hsa-miR-383-5p Cisplatin 5460033 NSC119875 approved resistant High Germ Cell Tumor cell line (NTERA-2)
hsa-miR-383-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-383-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-383-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-383-5p Docetaxel 148124 NSC628503 approved sensitive High Prostate Cancer cell line (PC-3)
hsa-miR-383-5p Cetuximab sensitive High Colon Cancer cell line
hsa-miR-383-5p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (OVCAR3, A2780)
hsa-miR-383-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (BT-474, SKBR3)
hsa-miR-383-5p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) resistant High Metastatic Colorectal Cancer tissue
hsa-miR-383-5p Gemcitabine 60750 NSC613327 approved sensitive Low Pancreatic Ductal Adenocarcinoma tissue
hsa-miR-383-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (AGS)
hsa-miR-383-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Hepatocellular Carcinoma cell line (Hep3B, Huh-7)
hsa-miR-383-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-383-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-383-5p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-383-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-383-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-383-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-383-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-383-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-383-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-383-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-383-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-383-5p Cetuximab resistant tissue (colorectal carcinoma)

Error report submission