>EMC7|NM_020154|3'UTR
   1 TCAGGCCGTCCAGAGCTGGCATTTGCACAAACACGGCAACACTGGGTGGCATCCAAGTCTTGGAAAACCGTGTGAAGCAA
  81 CTACTATAAACTTGAGTCATCCCGACGTTGATCTCTTACAACTGTGTATGTTAACTTTTTAGCACATGTTTTGTACTTGG
 161 TACACGAGAAAACCCAGCTTTCATCTTTTGTCTGTATGAGGTCAATATTGATGTCACTGAATTAATTACAGTGTCCTATA
 241 GAAAATGCCATTAATAAATTATATGAACTACTATACATTATGTATATTAATTAAAACATCTTAATCCAGAAAAAAAAAAA
 321 AAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' guCGGGAGGACCACCGACCGg 5' ||| ||| | |||||| Target 5' agGCCGTCCAGA--GCTGGCa 3'	3 - 21	130.00	-19.50
2	miRNA 3' gucgggaggaccACCGACCGg 5' ||| |||| Target 5' acacggcaacacTGGGTGGCa 3'	31 - 51	113.00	-16.90
3	miRNA 3' guCGGGAG--GACCACCGACcgg 5' ||::|| || || ||| Target 5' caGCTTTCATCTTTTGTCTGtat 3'	175 - 197	89.00	-10.12

Mutant ID	Mutant Position	Mutant Source
COSN30190655	8	COSMIC
COSN21907173	35	COSMIC
COSN30516944	35	COSMIC
COSN30109572	36	COSMIC
COSN31593865	37	COSMIC
COSN30487985	62	COSMIC
COSN31518030	69	COSMIC
COSN28193943	70	COSMIC
COSN30448844	103	COSMIC
COSN30132515	106	COSMIC
COSN30162965	115	COSMIC
COSN31487811	182	COSMIC
COSN31591538	200	COSMIC
COSN31486094	219	COSMIC
COSN5859969	300	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1264212783	2	dbSNP
rs764800614	7	dbSNP
rs201960302	8	dbSNP
rs763640178	11	dbSNP
rs1224522380	14	dbSNP
rs189947179	15	dbSNP
rs1301610390	17	dbSNP
rs746866414	18	dbSNP
rs778532651	24	dbSNP
rs766720002	25	dbSNP
rs775268525	27	dbSNP
rs763244343	28	dbSNP
rs773419602	29	dbSNP
rs372289953	34	dbSNP
rs200013278	35	dbSNP
rs1207493525	36	dbSNP
rs768519905	38	dbSNP
rs761905243	39	dbSNP
rs776831428	40	dbSNP
rs1179604609	42	dbSNP
rs768897338	46	dbSNP
rs914527059	47	dbSNP
rs746939025	48	dbSNP
rs780152685	49	dbSNP
rs771832394	50	dbSNP
rs1226272656	54	dbSNP
rs1289084663	56	dbSNP
rs964461483	65	dbSNP
rs988679696	69	dbSNP
rs749087670	70	dbSNP
rs1382743970	83	dbSNP
rs1247314950	102	dbSNP
rs1351938527	103	dbSNP
rs1035489323	106	dbSNP
rs572998974	107	dbSNP
rs952966508	122	dbSNP
rs1025816227	129	dbSNP
rs554598808	138	dbSNP
rs143031568	143	dbSNP
rs1006675922	146	dbSNP
rs757144639	148	dbSNP
rs1185332909	153	dbSNP
rs1378329311	163	dbSNP
rs755834337	165	dbSNP
rs896023147	166	dbSNP
rs1166245678	177	dbSNP
rs1346625532	177	dbSNP
rs1036247723	180	dbSNP
rs1464199860	194	dbSNP
rs1301799560	195	dbSNP
rs575560716	196	dbSNP
rs745373032	200	dbSNP
rs879161155	203	dbSNP
rs1040954537	207	dbSNP
rs1007713048	208	dbSNP
rs548791107	208	dbSNP
rs1471580615	209	dbSNP
rs557390608	209	dbSNP
rs1239006553	210	dbSNP
rs1187921970	212	dbSNP
rs386782867	212	dbSNP
rs568905541	212	dbSNP
rs889557336	214	dbSNP
rs1208242449	215	dbSNP
rs185186630	224	dbSNP
rs753743349	231	dbSNP
rs1049487458	252	dbSNP
rs1437165629	268	dbSNP
rs1248315426	270	dbSNP
rs1203173807	271	dbSNP
rs1461824030	272	dbSNP
rs1205570301	277	dbSNP
rs1236303767	278	dbSNP
rs947073361	282	dbSNP
rs1177605219	284	dbSNP
rs1042765448	295	dbSNP
rs1275399951	295	dbSNP
rs11638774	309	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.