pre-miRNA Information
pre-miRNA hsa-mir-6132   
Genomic Coordinates chr7: 117020211 - 117020319
Description Homo sapiens miR-6132 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6132
Sequence 21| AGCAGGGCUGGGGAUUGCA |39
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1272646274 4 dbSNP
rs1211969145 8 dbSNP
rs1310278496 11 dbSNP
rs1044115534 13 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DPH2   
Synonyms DPH2L2
Description DPH2 homolog
Transcript NM_001039589   
Other Transcripts NM_001384   
Expression
Putative miRNA Targets on DPH2
3'UTR of DPH2
(miRNA target sites are highlighted)
>DPH2|NM_001039589|3'UTR
   1 TACCATGTGGGGCTGGAGACATAGATGGACTTATGAATGGCTGCTAGGACCTTTAGTGCTCCCTGCACCAACCTCCCATC
  81 CCCCTGCCAAGATCCTTGAAGGACCCTGGAAGGAGGGAGAGCAGGCAGCCCTTCACAGGATAGGATCCGTCTCTGTCCTG
 161 TCCTGGCACTGGCACAAGCTCAGCACATGCCCAGTAATGCGTGTTGTTTGGCTGATGGAATAAAGGGCTTAGGGACTTCC
 241 CTGAGGCCTCTGGACCCATCTGTCTTCCTGAGGGCAGCCCAGGACCTTTGGCCAATCCCAGTTCCCAGGCTGCAGTTGAG
 321 GGTCTGTCCTTGTCAAAAGGCAGGTGCTAGACAGTCTAGACCAGGGTTTCTCAAACTCGTACTTGACATTTGGGGCCAGA
 401 TAATTCTTTGTTGTGGGGCTGTCTGGTGTATGGTAGGGTGCTCAGCAGCATCCCTGGCCTCTGCCCACTAGACATCAGAA
 481 GCACTCCCCCAGTTGTGACAACCAAAAATATCTCCAGACCTTGGCAAATGTTATCTGTGGGGGAAAATTGCCCTCAATTG
 561 AGAACCACTGGTCTAGCTAGACCTGCACTGTCCAGTACAGTAGCCACTAAATACATGTGGCTAAACTTAAATTTAAGTTA
 641 ATTAAGATTAAAAGCTCAGTTTCTCAGTCACATTAGTCATTCAAGTGTTCAGACAGCCACATGAGGGGACAGTGCAGCTA
 721 CAGGATATGCCATCATGGCAGAAAGTTCTATTGGTTGGACAGCGTTGGTCTATACTGACTCTTATTTCTCAGGGAGATCA
 801 CAGCAACCTAAATAAACCAGATACCTTTTCTCAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' acguUAGGGGUCGG-GACGa 5'
              |||||::||| |||| 
Target 5' cagcATCCCTGGCCTCTGCc 3'
446 - 465 135.00 -23.80
2
miRNA  3' acGUUAG-GGGU--CGGGACGa 5'
            ||| | ||||   |||||| 
Target 5' acCAACCTCCCATCCCCCTGCc 3'
67 - 88 127.00 -17.20
3
miRNA  3' acGUUAGG--GGUCGGGACGa 5'
            :::||:  |:|| ||||| 
Target 5' acTGGTCTAGCTAGACCTGCa 3'
567 - 587 123.00 -12.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31560080 4 COSMIC
COSN28834306 21 COSMIC
COSN30156619 25 COSMIC
COSN30505241 59 COSMIC
COSN30463984 78 COSMIC
COSN30105696 80 COSMIC
COSN30152620 84 COSMIC
COSN30177676 107 COSMIC
COSN30476285 139 COSMIC
COSN20230366 150 COSMIC
COSN31497435 154 COSMIC
COSN31560077 154 COSMIC
COSN31559845 179 COSMIC
COSN28700227 186 COSMIC
COSN16828711 591 COSMIC
COSN5372212 651 COSMIC
COSN5203684 821 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs892845618 5 dbSNP
rs760049704 8 dbSNP
rs768202561 10 dbSNP
rs753089088 13 dbSNP
rs756482375 16 dbSNP
rs778023883 19 dbSNP
rs572257374 21 dbSNP
rs748820049 21 dbSNP
rs967501103 23 dbSNP
rs753965717 26 dbSNP
rs551187501 27 dbSNP
rs772923626 33 dbSNP
rs1434258755 35 dbSNP
rs199514796 45 dbSNP
rs745952117 46 dbSNP
rs1262293459 54 dbSNP
rs1224933289 55 dbSNP
rs1408101461 59 dbSNP
rs866185870 62 dbSNP
rs1302178397 67 dbSNP
rs1310042886 68 dbSNP
rs1445816519 71 dbSNP
rs981199447 74 dbSNP
rs1313202332 79 dbSNP
rs542210663 83 dbSNP
rs984923954 87 dbSNP
rs909403762 93 dbSNP
rs562527157 96 dbSNP
rs1374333430 97 dbSNP
rs940839610 106 dbSNP
rs1391700280 116 dbSNP
rs1161608645 120 dbSNP
rs972375497 126 dbSNP
rs531276758 131 dbSNP
rs923520888 132 dbSNP
rs1310364684 137 dbSNP
rs1474023626 140 dbSNP
rs958559482 149 dbSNP
rs545074570 150 dbSNP
rs1487533605 154 dbSNP
rs1050395557 161 dbSNP
rs1283471361 167 dbSNP
rs910526718 170 dbSNP
rs1280394937 176 dbSNP
rs1311474292 179 dbSNP
rs936791449 182 dbSNP
rs783308 186 dbSNP
rs1357343134 192 dbSNP
rs942045588 195 dbSNP
rs1399198409 198 dbSNP
rs892998930 199 dbSNP
rs147787761 201 dbSNP
rs1480785477 202 dbSNP
rs1010478248 225 dbSNP
rs1190971909 226 dbSNP
rs1162834757 249 dbSNP
rs1265753808 267 dbSNP
rs1041696169 270 dbSNP
rs972010226 276 dbSNP
rs754642518 280 dbSNP
rs933424711 286 dbSNP
rs1390135824 297 dbSNP
rs1187468831 298 dbSNP
rs1486024045 299 dbSNP
rs1427824903 302 dbSNP
rs1051843792 306 dbSNP
rs889317175 307 dbSNP
rs943546334 317 dbSNP
rs1002760974 319 dbSNP
rs1217872972 329 dbSNP
rs1355323379 337 dbSNP
rs894026968 339 dbSNP
rs1382555869 342 dbSNP
rs1367223924 345 dbSNP
rs1291966164 363 dbSNP
rs755946779 367 dbSNP
rs1034033843 373 dbSNP
rs958596774 377 dbSNP
rs1005995840 379 dbSNP
rs1365291208 380 dbSNP
rs1375275311 383 dbSNP
rs1442864914 395 dbSNP
rs546831390 410 dbSNP
rs564378533 414 dbSNP
rs1035444053 419 dbSNP
rs1469428569 424 dbSNP
rs752289064 430 dbSNP
rs972206588 431 dbSNP
rs958791265 434 dbSNP
rs923409462 448 dbSNP
rs1316047051 450 dbSNP
rs757967657 468 dbSNP
rs1274581132 474 dbSNP
rs1227931073 475 dbSNP
rs1311347122 478 dbSNP
rs566784652 483 dbSNP
rs1299484229 484 dbSNP
rs954972959 491 dbSNP
rs1371999666 497 dbSNP
rs1330832506 501 dbSNP
rs986325122 503 dbSNP
rs1012670531 509 dbSNP
rs1444628744 518 dbSNP
rs1399309749 521 dbSNP
rs1299203052 526 dbSNP
rs1307683537 529 dbSNP
rs145002887 535 dbSNP
rs1220433866 538 dbSNP
rs936656073 542 dbSNP
rs1455357330 545 dbSNP
rs1053910393 549 dbSNP
rs1177515397 550 dbSNP
rs1435530695 554 dbSNP
rs1252609731 558 dbSNP
rs145425106 559 dbSNP
rs1482809478 566 dbSNP
rs1194658968 572 dbSNP
rs569220070 574 dbSNP
rs971938107 576 dbSNP
rs1236205586 582 dbSNP
rs1348932112 583 dbSNP
rs1308761652 584 dbSNP
rs945445410 586 dbSNP
rs1041584988 587 dbSNP
rs919279536 588 dbSNP
rs1330161029 598 dbSNP
rs907011094 600 dbSNP
rs1185116363 601 dbSNP
rs954725711 603 dbSNP
rs987998848 606 dbSNP
rs777127760 615 dbSNP
rs1435699161 616 dbSNP
rs746990933 619 dbSNP
rs1375718262 627 dbSNP
rs1157629425 639 dbSNP
rs533237072 650 dbSNP
rs1002815133 658 dbSNP
rs1364960299 660 dbSNP
rs1181903202 666 dbSNP
rs1423235020 669 dbSNP
rs1255293028 675 dbSNP
rs943539996 680 dbSNP
rs757192326 683 dbSNP
rs1420370155 684 dbSNP
rs1055705030 685 dbSNP
rs894173511 687 dbSNP
rs1352939087 693 dbSNP
rs1006295668 702 dbSNP
rs1295613488 703 dbSNP
rs781145872 703 dbSNP
rs1415811169 722 dbSNP
rs1397004661 723 dbSNP
rs1462762147 725 dbSNP
rs1297209606 728 dbSNP
rs1398663155 732 dbSNP
rs11539396 739 dbSNP
rs962111031 746 dbSNP
rs4221 751 dbSNP
rs1456941608 759 dbSNP
rs7161 764 dbSNP
rs1475420831 765 dbSNP
rs1002505917 769 dbSNP
rs1057292578 774 dbSNP
rs894196532 792 dbSNP
rs1449011182 794 dbSNP
rs1285189034 795 dbSNP
rs954859340 797 dbSNP
rs1012722377 800 dbSNP
rs1016074759 817 dbSNP
rs986374463 826 dbSNP
rs1428596848 828 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acGUUAG-GGGU--CGGGACGa 5'
            ||| | ||||   |||||| 
Target 5' acCAACCUCCCAUCCCCCUGCc 3'
2 - 23
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000255108.3 | 3UTR | CACCAACCUCCCAUCCCCCUGCCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
82 hsa-miR-6132 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT067294 NECAP1 NECAP endocytosis associated 1 2 10
MIRT100110 ABT1 activator of basal transcription 1 2 8
MIRT358583 CANX calnexin 2 2
MIRT445247 SEMA5A semaphorin 5A 2 2
MIRT445764 CCND3 cyclin D3 2 2
MIRT452388 LY6E lymphocyte antigen 6 family member E 2 4
MIRT452829 FAM131B family with sequence similarity 131 member B 2 2
MIRT453450 GLG1 golgi glycoprotein 1 2 2
MIRT455435 ID3 inhibitor of DNA binding 3, HLH protein 2 2
MIRT460629 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT461607 DPH2 DPH2 homolog 2 2
MIRT461989 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT464258 VCL vinculin 2 2
MIRT465713 TNFAIP1 TNF alpha induced protein 1 2 2
MIRT466475 TECPR2 tectonin beta-propeller repeat containing 2 2 7
MIRT467119 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 4
MIRT468299 SFT2D2 SFT2 domain containing 2 2 2
MIRT469696 RAB5B RAB5B, member RAS oncogene family 2 8
MIRT469904 PTRF caveolae associated protein 1 2 2
MIRT470015 PTPLB 3-hydroxyacyl-CoA dehydratase 2 1 1
MIRT471385 PDPR pyruvate dehydrogenase phosphatase regulatory subunit 2 2
MIRT471409 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT471719 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT473608 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT476328 GLTSCR1L BRD4 interacting chromatin remodeling complex associated protein like 2 2
MIRT479448 CDK6 cyclin dependent kinase 6 2 2
MIRT482032 AMER1 APC membrane recruitment protein 1 2 2
MIRT482360 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT484661 HOXD3 homeobox D3 2 4
MIRT486828 NDOR1 NADPH dependent diflavin oxidoreductase 1 2 2
MIRT487069 CLASP1 cytoplasmic linker associated protein 1 2 4
MIRT487196 NFASC neurofascin 2 4
MIRT487448 TFAP2B transcription factor AP-2 beta 2 4
MIRT487517 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT487640 BRSK2 BR serine/threonine kinase 2 2 4
MIRT487755 SKI SKI proto-oncogene 2 4
MIRT489944 CPLX1 complexin 1 2 2
MIRT491101 MSI1 musashi RNA binding protein 1 2 4
MIRT491181 LAMA5 laminin subunit alpha 5 2 2
MIRT492355 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT493918 FAM127B retrotransposon Gag like 8A 2 4
MIRT493932 FAM127A retrotransposon Gag like 8C 2 4
MIRT494679 ARID3A AT-rich interaction domain 3A 2 2
MIRT494814 AKAP11 A-kinase anchoring protein 11 2 2
MIRT494835 ADCY9 adenylate cyclase 9 2 2
MIRT495455 PNMAL2 paraneoplastic Ma antigen family member 8B 2 2
MIRT496962 MAP1LC3B microtubule associated protein 1 light chain 3 beta 2 2
MIRT526228 MTRNR2L5 MT-RNR2-like 5 2 2
MIRT531028 TDGF1P3 teratocarcinoma-derived growth factor 1 pseudogene 3 2 2
MIRT557110 HOXA3 homeobox A3 2 2
MIRT560514 POGK pogo transposable element derived with KRAB domain 2 2
MIRT567753 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT569608 TRIM29 tripartite motif containing 29 2 2
MIRT570242 CPNE5 copine 5 2 2
MIRT572327 HSPB6 heat shock protein family B (small) member 6 2 2
MIRT572373 ATOX1 antioxidant 1 copper chaperone 2 2
MIRT575024 Tecpr2 tectonin beta-propeller repeat containing 2 2 5
MIRT576146 Hmox1 heme oxygenase 1 2 2
MIRT612443 SMOC2 SPARC related modular calcium binding 2 2 2
MIRT615404 VDAC2 voltage dependent anion channel 2 2 2
MIRT629114 CYCS cytochrome c, somatic 2 2
MIRT631362 FOXI2 forkhead box I2 2 2
MIRT639322 THBD thrombomodulin 2 2
MIRT643797 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT669687 ABLIM1 actin binding LIM protein 1 2 2
MIRT670595 LLGL1 LLGL1, scribble cell polarity complex component 2 4
MIRT691190 NIF3L1 NGG1 interacting factor 3 like 1 2 2
MIRT691688 FLOT2 flotillin 2 2 2
MIRT697127 OTUD5 OTU deubiquitinase 5 2 2
MIRT700814 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT701248 NUP35 nucleoporin 35 2 2
MIRT702362 KLHL15 kelch like family member 15 2 2
MIRT703325 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 2 2
MIRT706060 PKD1 polycystin 1, transient receptor potential channel interacting 2 2
MIRT710475 CDH5 cadherin 5 2 2
MIRT713018 SLC4A2 solute carrier family 4 member 2 2 2
MIRT716427 RAB15 RAB15, member RAS oncogene family 2 2
MIRT718093 ABHD12 abhydrolase domain containing 12 2 2
MIRT718542 PIGQ phosphatidylinositol glycan anchor biosynthesis class Q 2 2
MIRT719122 CACFD1 calcium channel flower domain containing 1 2 2
MIRT721393 LDLRAD4 low density lipoprotein receptor class A domain containing 4 2 2
MIRT736283 CDC42 cell division cycle 42 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6132 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-6132 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-6132 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-6132 Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-6132 Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-6132 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-6132 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-6132 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-6132 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission