miRTarBase - #MIRT461817


—
pre-miRNA Information
pre-miRNA hsa-mir-7113   
Genomic Coordinates chr11: 68032864 - 68032922
Description Homo sapiens miR-7113 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7113-5p
Sequence 2| UCCAGGGAGACAGUGUGUGAG |22
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs536888936 4 dbSNP
rs896404692 5 dbSNP
rs1431421326 7 dbSNP
rs746958707 11 dbSNP
rs756213920 13 dbSNP
rs1467018028 14 dbSNP
rs1168207815 21 dbSNP
Putative Targets

Gene Information
Gene Symbol SNAP23   
Synonyms HsT17016, SNAP-23, SNAP23A, SNAP23B
Description synaptosome associated protein 23
Transcript NM_003825   
Other Transcripts NM_130798   
Expression
Putative miRNA Targets on SNAP23
3'UTR of SNAP23
(miRNA target sites are highlighted)		 
>SNAP23|NM_003825|3'UTR
   1 AGCTACTGCTGTTCTTCTTTATCATTTATTCACTTCCGTAGCTCCTCCTTGAAAGTTATTACCTTTTCAGAGTTTAAGTT
  81 TTCGGTTCCACGCTCTTCTAATTGGGAGATAATATGGAAGAAGGGCCAGAGCAGTTACAGCCCTCCTTCTTTTTTGTTTT
 161 CTGTTGAGGGCCGACTGCTGCTCTGCCTTCCTTCTAGTATTTTCTTTCTCAATTCATACGCTTAGATTGGTTTTCATATG
 241 TCATGTTTAGTGTTTTCATCCTCCTCATATACTTCAGCAGGTTCTTTTGCTTTCAAGATTTGGAAGCATTGCCAAAGACA
 321 GCCATGAAGAAGGAAGCTGTAGAGGTGTTTTTTGTTGTTGTTTATTTTTGCTTTTGTGGTTGAGGGAAGGACAAGAGATA
 401 AGAGGTTGTTACCTCAGTAAAAACCTTCAGGCCACAAAGCAAAAAGTTGCATAGCCACAACGAAGATCTAGTTGGATATA
 481 GTTTTTGATTTAAGTTGCAGTTATAGCCAATTTAGGCTAATGCTTGGTTTTGGAGCTTTTATACACAACGTTTTTGTTAG
 561 GCATCACAGTTTTGCAACCTCTGCTCCAAAGAGAAAAATAGAATGAGTTTTCTTTCTTTTTTTTTTTTTTGGAGTCAGAG
 641 TCTCGCTCTCTTGTCCAGGCTGGAGTGCAATAGCGCGATCTGGGCTCACTGCAACCTCCGCCTCCCTGGTTCAAGCAATT
 721 CTCCTGCCTTGCCTCCTGAGTAGCTGGGATTACAGGCGTGTGTCACCACGCTCGGCTAATTTTTGTATTTTTAGTAGAGA
 801 CAGGGTTTCACCATGTCAAGCTGGTCTTGGACTCCTGACGTCGTGATCCACCCGCCTTGGCCTCCCAAAGTACTGGGATT
 881 ACAGGCGTGAGCCACTGTGCCTGGCTGAGTTTTCTTAAAGTGAGCTTAATTTCTGAACTCTTAGTGATTCATATATGTAC
 961 ATAAATCTGTGATCCCATTTCTTATTGCACCATTCAGGAACACTTTATATAAATGAGTGGCTTTTTATTTCATATTATTA
1041 GTAGTATCATGGTTCCATTACAGGCCTATTAACATCATACATTGTCATTAGTCTTTGAAGAAAAAATATGTAAATATATA
1121 TGTGTAACATGAGAATTTCTCTCTAAAGCAGGGCTTAAAATTTTTTGGAAAAGTTTGACAAAGCATACCACATGAATTCA
1201 GATTTACCTCAATGCTAAGAATTATGTTTAGTTAGGAAAAAGGAAAGTCATTTTGACCTCAGGTAGAAAAATAGATTGCT
1281 TTGAGTTTTATGTAGCTTTAGACTTTAAAAAGTTAGAATTTATTCTGTAACTAAAAATTATTTGAAAAAATTATGCCTCT
1361 GGTTTAATTATTGGTGATTACACACTCTTTCTCTTACCCTTGTGTATTGAACTATGTCCATAATCAAGTTGATGTGGATC
1441 CTGAAAAGTGTTATGAACATCTGATTGGTATTTGTCACATTTATTTTAAAATTAGCATCTGAACACTTCAAAGCTGTCAG
1521 TGTGTATTGGTTTCACCAATAACCACTGCTTGATCCTTACAATTAAATTTTTTAACTAACTAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaGUGUGUGACAGAGGGACCu 5'
            ||  | | | |||||||| 
Target 5' tgCAACCTCCGCCTCCCTGGt 3'
 690 - 710 155.00 -19.30
2 
miRNA  3' gaGUGUGUGACAGAGGGAccu 5'
            :||||||| |:||:||   
Target 5' atTACACACTCTTTCTCTtac 3'
 1377 - 1397 123.00 -17.42
3 
miRNA  3' gaguguGUGACAGAGGGACCu 5'
                |||||  | ||||| 
Target 5' gtgagcCACTG--TGCCTGGc 3'
 887 - 905 123.00 -15.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31580319 27 COSMIC
COSN30134710 39 COSMIC
COSN30501406 48 COSMIC
COSN510807 69 COSMIC
COSN31524941 78 COSMIC
COSN30472810 109 COSMIC
COSN28599603 113 COSMIC
COSN30450752 128 COSMIC
COSN31603607 133 COSMIC
COSN31530223 285 COSMIC
COSN31515763 330 COSMIC
COSN29462265 346 COSMIC
COSN22489787 350 COSMIC
COSN30540603 371 COSMIC
COSN30161886 1101 COSMIC
COSN31541016 1248 COSMIC
COSN31607640 1317 COSMIC
COSN8744238 1330 COSMIC
COSN31535943 1376 COSMIC
COSN31512879 1443 COSMIC
COSN31594985 1514 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs758368863 6 dbSNP
rs1338928041 8 dbSNP
rs1394781229 11 dbSNP
rs1299971538 12 dbSNP
rs1437033129 13 dbSNP
rs772606719 15 dbSNP
rs775807926 19 dbSNP
rs760837005 20 dbSNP
rs764017582 21 dbSNP
rs1455182626 24 dbSNP
rs1212050877 30 dbSNP
rs542540620 33 dbSNP
rs34405800 36 dbSNP
rs374999742 38 dbSNP
rs766344395 39 dbSNP
rs781305757 45 dbSNP
rs751370753 49 dbSNP
rs1187546994 56 dbSNP
rs755014436 59 dbSNP
rs1163349168 60 dbSNP
rs1415809228 63 dbSNP
rs1177314035 65 dbSNP
rs767513736 70 dbSNP
rs752509743 73 dbSNP
rs561636566 81 dbSNP
rs777132028 84 dbSNP
rs771146201 85 dbSNP
rs1434376000 86 dbSNP
rs1295488093 88 dbSNP
rs774632715 90 dbSNP
rs552724273 92 dbSNP
rs759674294 93 dbSNP
rs1324038894 98 dbSNP
rs772281385 101 dbSNP
rs1201712071 102 dbSNP
rs1290594886 107 dbSNP
rs939083838 110 dbSNP
rs1057334163 114 dbSNP
rs895983138 116 dbSNP
rs146015128 119 dbSNP
rs373411749 119 dbSNP
rs1199898870 121 dbSNP
rs527265901 125 dbSNP
rs547108563 130 dbSNP
rs1044674025 132 dbSNP
rs564207384 135 dbSNP
rs1432739182 141 dbSNP
rs532927058 142 dbSNP
rs575278112 146 dbSNP
rs56125021 150 dbSNP
rs1000221779 153 dbSNP
rs989875362 156 dbSNP
rs1175746576 157 dbSNP
rs1397277653 162 dbSNP
rs1411770157 164 dbSNP
rs762587193 169 dbSNP
rs1032074593 173 dbSNP
rs748610970 174 dbSNP
rs914293374 182 dbSNP
rs772769603 194 dbSNP
rs377127825 198 dbSNP
rs948417963 201 dbSNP
rs1044021346 204 dbSNP
rs188966860 217 dbSNP
rs1220898826 218 dbSNP
rs1437546107 220 dbSNP
rs569518773 221 dbSNP
rs1341739474 224 dbSNP
rs974515658 232 dbSNP
rs1296514953 234 dbSNP
rs1212621062 245 dbSNP
rs11549246 247 dbSNP
rs1275417321 259 dbSNP
rs920529472 259 dbSNP
rs535338135 267 dbSNP
rs548880570 270 dbSNP
rs117476614 273 dbSNP
rs1429915657 276 dbSNP
rs1369589027 282 dbSNP
rs907524483 295 dbSNP
rs1339469477 306 dbSNP
rs534175283 309 dbSNP
rs1435326635 320 dbSNP
rs201881933 327 dbSNP
rs776268336 330 dbSNP
rs1477073992 336 dbSNP
rs1253995512 338 dbSNP
rs1222901003 340 dbSNP
rs553923610 341 dbSNP
rs1482828865 347 dbSNP
rs1272783131 348 dbSNP
rs1202157021 349 dbSNP
rs889859116 352 dbSNP
rs1301893837 355 dbSNP
rs1006938017 358 dbSNP
rs1343585304 371 dbSNP
rs1289633592 372 dbSNP
rs1056617531 383 dbSNP
rs1349469560 386 dbSNP
rs1296130454 394 dbSNP
rs916298241 405 dbSNP
rs1019616889 406 dbSNP
rs965371654 411 dbSNP
rs1198565354 433 dbSNP
rs1373643729 436 dbSNP
rs1476398505 440 dbSNP
rs1166231591 443 dbSNP
rs1419020776 446 dbSNP
rs1472334980 451 dbSNP
rs997843555 452 dbSNP
rs1183890258 453 dbSNP
rs577256948 461 dbSNP
rs539558497 462 dbSNP
rs1044561933 463 dbSNP
rs181654094 467 dbSNP
rs956079255 468 dbSNP
rs1228438297 469 dbSNP
rs866393586 472 dbSNP
rs989927787 477 dbSNP
rs1305240109 482 dbSNP
rs914345878 488 dbSNP
rs904801383 495 dbSNP
rs576729451 498 dbSNP
rs1302593733 499 dbSNP
rs886696923 509 dbSNP
rs1450943377 517 dbSNP
rs969772794 530 dbSNP
rs1160608871 533 dbSNP
rs1319539019 542 dbSNP
rs1409929047 543 dbSNP
rs1167022507 545 dbSNP
rs139914618 545 dbSNP
rs1255759845 549 dbSNP
rs1181042796 550 dbSNP
rs185545020 551 dbSNP
rs1249810609 559 dbSNP
rs938339134 567 dbSNP
rs1267931150 591 dbSNP
rs562349763 592 dbSNP
rs1352681137 593 dbSNP
rs1053161302 598 dbSNP
rs1246387922 609 dbSNP
rs1258364509 609 dbSNP
rs1338288046 615 dbSNP
rs1244201121 617 dbSNP
rs1311631296 617 dbSNP
rs766836227 617 dbSNP
rs1243771609 630 dbSNP
rs75635089 631 dbSNP
rs1246235948 632 dbSNP
rs62019290 633 dbSNP
rs918834547 634 dbSNP
rs1221547089 637 dbSNP
rs367817702 637 dbSNP
rs891789230 645 dbSNP
rs1048593127 646 dbSNP
rs1262258900 647 dbSNP
rs1448691305 649 dbSNP
rs1191049534 654 dbSNP
rs572699561 658 dbSNP
rs1391722524 660 dbSNP
rs1008860315 665 dbSNP
rs564171566 670 dbSNP
rs1259601675 671 dbSNP
rs964737123 675 dbSNP
rs1190062002 676 dbSNP
rs1383678887 677 dbSNP
rs1424353500 678 dbSNP
rs1228174974 681 dbSNP
rs995988923 682 dbSNP
rs1027430616 690 dbSNP
rs1041109178 697 dbSNP
rs1304098436 698 dbSNP
rs952030559 700 dbSNP
rs1390179376 701 dbSNP
rs1159516251 704 dbSNP
rs1301385658 707 dbSNP
rs1431788195 709 dbSNP
rs901186860 710 dbSNP
rs1168937622 711 dbSNP
rs541013228 713 dbSNP
rs1387728131 719 dbSNP
rs999502886 721 dbSNP
rs1032033928 725 dbSNP
rs1433252882 730 dbSNP
rs1363794412 752 dbSNP
rs1452822171 756 dbSNP
rs983770194 758 dbSNP
rs528376253 759 dbSNP
rs1244918630 765 dbSNP
rs960657715 767 dbSNP
rs189831391 770 dbSNP
rs1352629581 771 dbSNP
rs1203278427 773 dbSNP
rs776675829 774 dbSNP
rs762393881 775 dbSNP
rs1411765377 786 dbSNP
rs947768884 788 dbSNP
rs765866602 794 dbSNP
rs926109336 795 dbSNP
rs1351317059 798 dbSNP
rs73404763 801 dbSNP
rs1185512985 803 dbSNP
rs1394143430 807 dbSNP
rs1053782508 814 dbSNP
rs892014349 815 dbSNP
rs1428557261 816 dbSNP
rs1196594326 819 dbSNP
rs944717852 833 dbSNP
rs1365890496 836 dbSNP
rs1452141016 839 dbSNP
rs1040333459 840 dbSNP
rs142265126 841 dbSNP
rs1435727483 843 dbSNP
rs1407550783 844 dbSNP
rs563109682 854 dbSNP
rs767221469 855 dbSNP
rs1344863499 868 dbSNP
rs996208860 869 dbSNP
rs1261867945 872 dbSNP
rs1230269049 876 dbSNP
rs1330003528 878 dbSNP
rs1338165759 883 dbSNP
rs1287951819 885 dbSNP
rs1440222565 887 dbSNP
rs1380055507 888 dbSNP
rs1395064596 895 dbSNP
rs529038195 896 dbSNP
rs1396417955 901 dbSNP
rs1405219843 902 dbSNP
rs11022 903 dbSNP
rs1458358060 904 dbSNP
rs200587308 906 dbSNP
rs386783476 906 dbSNP
rs1060265 907 dbSNP
rs114902006 909 dbSNP
rs547726640 910 dbSNP
rs116060757 922 dbSNP
rs1261367277 925 dbSNP
rs1188642313 927 dbSNP
rs190885244 940 dbSNP
rs901245569 943 dbSNP
rs879945358 945 dbSNP
rs1253011703 948 dbSNP
rs935354356 952 dbSNP
rs1283575578 955 dbSNP
rs1222158717 956 dbSNP
rs1417695104 966 dbSNP
rs1285042748 972 dbSNP
rs117057596 976 dbSNP
rs1181560003 987 dbSNP
rs1430557182 993 dbSNP
rs1381855966 995 dbSNP
rs1334453999 996 dbSNP
rs1437119611 999 dbSNP
rs960631688 1000 dbSNP
rs1316971441 1002 dbSNP
rs1398491869 1003 dbSNP
rs1415482138 1004 dbSNP
rs372744266 1009 dbSNP
rs1444394353 1016 dbSNP
rs778364151 1018 dbSNP
rs1190922006 1033 dbSNP
rs1450583219 1052 dbSNP
rs1242075443 1056 dbSNP
rs1213688927 1058 dbSNP
rs570194556 1061 dbSNP
rs749800807 1062 dbSNP
rs1011450764 1064 dbSNP
rs879264878 1069 dbSNP
rs1221944319 1074 dbSNP
rs1357575211 1088 dbSNP
rs925017421 1093 dbSNP
rs1398200210 1101 dbSNP
rs1389392278 1118 dbSNP
rs905717052 1119 dbSNP
rs936175930 1135 dbSNP
rs1001309274 1136 dbSNP
rs536055791 1140 dbSNP
rs1351182778 1142 dbSNP
rs1346019167 1144 dbSNP
rs988967627 1158 dbSNP
rs913494462 1159 dbSNP
rs1225246848 1163 dbSNP
rs1423543150 1172 dbSNP
rs1363352352 1174 dbSNP
rs1281345550 1180 dbSNP
rs1035869211 1189 dbSNP
rs1430840677 1193 dbSNP
rs1419393495 1200 dbSNP
rs1185358554 1202 dbSNP
rs944945623 1206 dbSNP
rs1479294330 1215 dbSNP
rs1247308948 1223 dbSNP
rs1198821541 1226 dbSNP
rs959811578 1227 dbSNP
rs1040385682 1246 dbSNP
rs1025319552 1251 dbSNP
rs1307918386 1252 dbSNP
rs757183689 1258 dbSNP
rs900508352 1258 dbSNP
rs1272197625 1268 dbSNP
rs952319935 1272 dbSNP
rs144566655 1279 dbSNP
rs1049140956 1280 dbSNP
rs183136741 1282 dbSNP
rs1403830230 1285 dbSNP
rs942876657 1293 dbSNP
rs1430787222 1307 dbSNP
rs1354248195 1311 dbSNP
rs1168796519 1318 dbSNP
rs1005140425 1337 dbSNP
rs1416610650 1340 dbSNP
rs1479785235 1372 dbSNP
rs757907520 1385 dbSNP
rs1426525608 1391 dbSNP
rs1175763870 1394 dbSNP
rs1195539959 1397 dbSNP
rs1479526384 1398 dbSNP
rs1270018547 1400 dbSNP
rs1183248419 1407 dbSNP
rs1490953190 1420 dbSNP
rs976929388 1421 dbSNP
rs1014740082 1426 dbSNP
rs896424894 1442 dbSNP
rs374958141 1450 dbSNP
rs1263718329 1453 dbSNP
rs1432033887 1453 dbSNP
rs1052908466 1454 dbSNP
rs145629787 1455 dbSNP
rs1391554210 1461 dbSNP
rs1372189640 1471 dbSNP
rs946689805 1477 dbSNP
rs1161809355 1481 dbSNP
rs1374394392 1495 dbSNP
rs1460173034 1502 dbSNP
rs1307080905 1506 dbSNP
rs1365929938 1510 dbSNP
rs1360231056 1526 dbSNP
rs1023347644 1530 dbSNP
rs969047851 1531 dbSNP
rs1336717045 1549 dbSNP
rs1000499677 1561 dbSNP
rs1160017688 1563 dbSNP
rs1042981556 1573 dbSNP
rs1406615498 1574 dbSNP
rs770053744 1581 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gagugugugacaGAGGGACCu 5'
                      |||||||| 
Target 5' -----------cCUCCCUGGu 3'
 		1 - 10
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000249647.3 | 3UTR | CCUCCCUGGUUCAAGCAAUUCUCCUGCCUUGCCUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
104 hsa-miR-7113-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059935 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT083388 E2F1 E2F transcription factor 1 2 4
MIRT183511 BTG2 BTG anti-proliferation factor 2 2 2
MIRT192333 KLF13 Kruppel like factor 13 2 2
MIRT347200 SIN3B SIN3 transcription regulator family member B 2 2
MIRT451431 TJP3 tight junction protein 3 2 2
MIRT452499 HMGXB3 HMG-box containing 3 2 2
MIRT453830 SAA1 serum amyloid A1 2 2
MIRT454309 ZNF134 zinc finger protein 134 2 2
MIRT454833 POLR2J3 RNA polymerase II subunit J3 2 2
MIRT454890 RAD50 RAD50 double strand break repair protein 2 2
MIRT455881 KIF2C kinesin family member 2C 2 2
MIRT456161 TTF2 transcription termination factor 2 2 2
MIRT456945 LRP10 LDL receptor related protein 10 2 2
MIRT457627 UPK3BL uroplakin 3B like 1 2 2
MIRT459486 CCL11 C-C motif chemokine ligand 11 2 2
MIRT459585 NLGN2 neuroligin 2 2 2
MIRT460719 FN3KRP fructosamine 3 kinase related protein 2 2
MIRT461576 SCO1 SCO1, cytochrome c oxidase assembly protein 2 4
MIRT461817 SNAP23 synaptosome associated protein 23 2 2
MIRT462409 RBM28 RNA binding motif protein 28 2 2
MIRT462434 GTPBP10 GTP binding protein 10 2 4
MIRT462523 ZNF500 zinc finger protein 500 2 2
MIRT462787 ZNF8 zinc finger protein 8 2 2
MIRT463898 WNT7B Wnt family member 7B 2 4
MIRT466954 STAT3 signal transducer and activator of transcription 3 2 2
MIRT467035 SRSF1 serine and arginine rich splicing factor 1 2 4
MIRT467436 SND1 staphylococcal nuclease and tudor domain containing 1 2 2
MIRT468780 SCD stearoyl-CoA desaturase 2 2
MIRT469765 RAB2B RAB2B, member RAS oncogene family 2 2
MIRT470784 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT471842 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT472222 NGFR nerve growth factor receptor 2 2
MIRT472538 NACC1 nucleus accumbens associated 1 2 2
MIRT472937 MSN moesin 2 2
MIRT477462 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 2
MIRT479077 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT479260 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT480254 C8orf58 chromosome 8 open reading frame 58 2 2
MIRT480552 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT480929 BCAT1 branched chain amino acid transaminase 1 2 2
MIRT482048 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT483182 HIST1H2AH histone cluster 1 H2A family member h 2 8
MIRT486998 ZFAND2B zinc finger AN1-type containing 2B 2 2
MIRT488253 DNLZ DNL-type zinc finger 2 4
MIRT488588 ST7L suppression of tumorigenicity 7 like 2 2
MIRT491068 ACVR1B activin A receptor type 1B 2 2
MIRT492618 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT493817 FSCN1 fascin actin-bundling protein 1 2 2
MIRT495988 LTBP2 latent transforming growth factor beta binding protein 2 2 2
MIRT499248 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT500451 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT508311 RPL18 ribosomal protein L18 2 4
MIRT509711 ANKRD23 ankyrin repeat domain 23 2 2
MIRT531511 NONO non-POU domain containing octamer binding 2 2
MIRT531711 ABCB6 ATP binding cassette subfamily B member 6 (Langereis blood group) 2 2
MIRT533753 TMEM184B transmembrane protein 184B 2 2
MIRT535987 MED28 mediator complex subunit 28 2 4
MIRT537865 EDA2R ectodysplasin A2 receptor 2 2
MIRT539922 DUSP28 dual specificity phosphatase 28 2 2
MIRT541124 RAB34 RAB34, member RAS oncogene family 2 2
MIRT543053 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT562618 BCL7A BCL tumor suppressor 7A 2 2
MIRT563606 ZNF277 zinc finger protein 277 2 2
MIRT573680 HES6 hes family bHLH transcription factor 6 2 2
MIRT609224 TMEM178B transmembrane protein 178B 2 2
MIRT611658 LIPC lipase C, hepatic type 2 2
MIRT612822 KLHL3 kelch like family member 3 2 2
MIRT613217 CCDC85C coiled-coil domain containing 85C 2 4
MIRT617687 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT618536 TMEM241 transmembrane protein 241 2 2
MIRT622094 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT627600 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT637157 PCDHA6 protocadherin alpha 6 2 4
MIRT642156 AQR aquarius intron-binding spliceosomal factor 2 2
MIRT643941 WIPF3 WAS/WASL interacting protein family member 3 2 2
MIRT646855 SLC35E4 solute carrier family 35 member E4 2 2
MIRT647401 SPNS2 sphingolipid transporter 2 2 2
MIRT648708 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT655571 OXSR1 oxidative stress responsive 1 2 2
MIRT655878 NFASC neurofascin 2 2
MIRT660309 BHLHE40 basic helix-loop-helix family member e40 2 2
MIRT664073 ZNF417 zinc finger protein 417 2 2
MIRT667522 LUC7L2 LUC7 like 2, pre-mRNA splicing factor 2 2
MIRT667852 IPCEF1 interaction protein for cytohesin exchange factors 1 2 2
MIRT669240 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 2 2
MIRT674763 QRSL1 glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 2 2
MIRT679704 GRK4 G protein-coupled receptor kinase 4 2 2
MIRT681445 CIITA class II major histocompatibility complex transactivator 2 2
MIRT684814 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT694604 AAR2 AAR2 splicing factor homolog 2 2
MIRT696944 CERK ceramide kinase 2 2
MIRT704430 CTNNBIP1 catenin beta interacting protein 1 2 2
MIRT708304 MPPE1 metallophosphoesterase 1 2 2
MIRT708874 TMEM151B transmembrane protein 151B 2 2
MIRT713557 TBC1D22B TBC1 domain family member 22B 2 2
MIRT714998 TSPAN11 tetraspanin 11 2 2
MIRT715993 ACOT2 acyl-CoA thioesterase 2 2 2
MIRT718872 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT719664 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT720825 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT723357 ASCL2 achaete-scute family bHLH transcription factor 2 2 2
MIRT724561 SIT1 signaling threshold regulating transmembrane adaptor 1 2 2
MIRT732592 WNT10B Wnt family member 10B 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-7113 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-7113 Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)
hsa-miR-7113-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-7113-5p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-7113-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-7113-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)

Error report submission