pre-miRNA Information
pre-miRNA hsa-mir-4433a   
Genomic Coordinates chr2: 64340759 - 64340839
Description Homo sapiens miR-4433a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4433a-3p
Sequence 51| ACAGGAGUGGGGGUGGGACAU |71
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs751480515 9 dbSNP
rs557760377 15 dbSNP
rs1479580865 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCDC77   
Synonyms -
Description coiled-coil domain containing 77
Transcript NM_001130146   
Other Transcripts NM_001130147 , NM_001130148 , NM_032358   
Expression
Putative miRNA Targets on CCDC77
3'UTR of CCDC77
(miRNA target sites are highlighted)
>CCDC77|NM_001130146|3'UTR
   1 TGTCTACTTTTGGAAATGGCCCCCATTTAGAAGAGGTGTGCTTCTTGAAACCTGAGGACAAGGTCATCTGCTGCCAGAAA
  81 ATGTAAACCTGAGTTGACTAGAGTGGTGGTATTCATTATTGTAAAGACAGCTTGAAGAATCGGGGACCACTAGGAAAGCT
 161 TTTCTTGCATACTCAGCTTGCTTTATCATTTTTGCTGTCCTTTTAACACTTGCGAGGAGTAGGGGCCTGGTCCTGAATGA
 241 CTTGGAGGCTTTCATTATTTATCCTGTCTGTATTGACCGGTTTTTGTTTTTTCAGAAGGCAGTGATGATGAAAACTTAGG
 321 AAGAAGGTATTTTGCAATAAGCTTGGCTGAGTGTCCATGGGAAGAATACTTTCCCTAAAGAGAGAGAAGCACTCACAGAG
 401 GCTGCCTTTCTCCTGAGCTCGGGGAGAAGGCAGCACATCACAACCTGTCACATTGAAATAGGCGCTCATTCTGCTATTTC
 481 ACCTTCCGTCCTGAGCAGAGCCTGAATTACGTTTTTGGGCAATTTCATGGTGTTTCACCAGAGGGCGCTAGAGACTCAAA
 561 CGAAATGTCCATCTGGAAAGATTCGGGAGACACTTTGCCGAGGGGATGAAGCTGAGATGATGCTTGTATGGAAAGTTTGA
 641 TATTTTTATCAGTCACATGGCTTTTGAAAAATGATGTATATATTTTAAATTAACTATTTTCAATAAAATATTTCACTCAA
 721 AAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uacaggguggggguGAGGACa 5'
                        |||||| 
Target 5' cagaggctgcctttCTCCTGa 3'
396 - 416 120.00 -16.70
2
miRNA  3' uacaggguggGGGUGAGGACa 5'
                    :|:|||::|| 
Target 5' --------tgTCTACTTTTGg 3'
1 - 13 115.00 -9.70
3
miRNA  3' uacAGGGUGGGGGUGAGGACa 5'
             |::||||::|  ||||| 
Target 5' ctaTTTCACCTTCCGTCCTGa 3'
474 - 494 110.00 -19.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31538221 8 COSMIC
COSN26538136 41 COSMIC
COSN31882521 88 COSMIC
COSN19466265 120 COSMIC
COSN30160729 127 COSMIC
COSN30193371 165 COSMIC
COSN30124743 169 COSMIC
COSN30449809 188 COSMIC
COSN29573879 287 COSMIC
rs1048466 465 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767257837 2 dbSNP
rs752353061 4 dbSNP
rs1342102821 6 dbSNP
rs755600704 7 dbSNP
rs777279948 9 dbSNP
rs1356925996 12 dbSNP
rs757179323 14 dbSNP
rs1435503335 17 dbSNP
rs1292099295 18 dbSNP
rs778734287 21 dbSNP
rs745638443 22 dbSNP
rs968951291 23 dbSNP
rs1172081794 24 dbSNP
rs768903744 34 dbSNP
rs375923208 43 dbSNP
rs769782476 44 dbSNP
rs1185833773 52 dbSNP
rs1242825620 53 dbSNP
rs773280785 53 dbSNP
rs1195176968 80 dbSNP
rs1487271649 82 dbSNP
rs910177734 83 dbSNP
rs150049843 89 dbSNP
rs900322137 100 dbSNP
rs1341241244 115 dbSNP
rs1040496971 124 dbSNP
rs997581777 133 dbSNP
rs1030368478 135 dbSNP
rs11550736 140 dbSNP
rs923145146 142 dbSNP
rs929157074 143 dbSNP
rs1272256706 150 dbSNP
rs1220928183 153 dbSNP
rs77158484 154 dbSNP
rs1339106676 159 dbSNP
rs1047545809 171 dbSNP
rs1189524034 173 dbSNP
rs1361302348 181 dbSNP
rs1332409206 186 dbSNP
rs1414141056 196 dbSNP
rs1420265767 197 dbSNP
rs1004803447 198 dbSNP
rs1048462 204 dbSNP
rs1476916743 205 dbSNP
rs887732803 209 dbSNP
rs4980907 210 dbSNP
rs1044378078 214 dbSNP
rs905839674 215 dbSNP
rs1484101783 226 dbSNP
rs542031152 242 dbSNP
rs566411078 245 dbSNP
rs1274425825 260 dbSNP
rs1196192413 261 dbSNP
rs1316828952 262 dbSNP
rs1278085838 264 dbSNP
rs1234493412 266 dbSNP
rs1381733298 267 dbSNP
rs1282823530 271 dbSNP
rs1447487528 279 dbSNP
rs891864947 280 dbSNP
rs1189686128 287 dbSNP
rs1376659004 287 dbSNP
rs1333697884 297 dbSNP
rs75822891 309 dbSNP
rs77026311 320 dbSNP
rs1021799354 329 dbSNP
rs1311072066 337 dbSNP
rs1425522343 338 dbSNP
rs916782830 343 dbSNP
rs1181079274 347 dbSNP
rs1470421574 348 dbSNP
rs1239609278 354 dbSNP
rs970866922 367 dbSNP
rs968959607 369 dbSNP
rs985673316 370 dbSNP
rs2302258 375 dbSNP
rs934317256 377 dbSNP
rs1324032306 395 dbSNP
rs1327951273 397 dbSNP
rs12581017 401 dbSNP
rs564004792 402 dbSNP
rs145358618 404 dbSNP
rs567595479 405 dbSNP
rs914489055 409 dbSNP
rs1374560892 415 dbSNP
rs1311712743 419 dbSNP
rs149182859 421 dbSNP
rs1250684976 422 dbSNP
rs975757744 439 dbSNP
rs763112186 442 dbSNP
rs560285164 445 dbSNP
rs1164076368 454 dbSNP
rs1401039649 455 dbSNP
rs1381990522 456 dbSNP
rs900374045 458 dbSNP
rs1176343928 460 dbSNP
rs1438728901 462 dbSNP
rs1253005709 464 dbSNP
rs1048466 465 dbSNP
rs1487258289 469 dbSNP
rs1245455224 477 dbSNP
rs1277504033 477 dbSNP
rs1221543852 480 dbSNP
rs1051804109 485 dbSNP
rs181027281 488 dbSNP
rs1238164677 489 dbSNP
rs1353282013 491 dbSNP
rs909011507 491 dbSNP
rs941960609 498 dbSNP
rs1365628920 504 dbSNP
rs1263467116 511 dbSNP
rs886484740 512 dbSNP
rs1431421013 513 dbSNP
rs1156616676 523 dbSNP
rs1362175952 523 dbSNP
rs879249152 526 dbSNP
rs1193006466 542 dbSNP
rs1004855964 547 dbSNP
rs1016236977 548 dbSNP
rs1177845150 549 dbSNP
rs12582823 557 dbSNP
rs12317361 562 dbSNP
rs938709742 564 dbSNP
rs982236971 569 dbSNP
rs1057123680 570 dbSNP
rs1290835083 571 dbSNP
rs540652376 574 dbSNP
rs928388256 581 dbSNP
rs561934447 584 dbSNP
rs1235754699 585 dbSNP
rs891914863 586 dbSNP
rs1296520336 594 dbSNP
rs1219091835 596 dbSNP
rs955746722 600 dbSNP
rs527980457 601 dbSNP
rs1375892963 611 dbSNP
rs1010281302 612 dbSNP
rs544514358 615 dbSNP
rs1464261729 617 dbSNP
rs1021807722 624 dbSNP
rs76296488 638 dbSNP
rs947042218 639 dbSNP
rs1007165479 649 dbSNP
rs1018559480 658 dbSNP
rs1478551700 662 dbSNP
rs974720143 679 dbSNP
rs965646378 706 dbSNP
rs1192173866 709 dbSNP
rs1477684783 712 dbSNP
rs921815725 715 dbSNP
rs1202353566 716 dbSNP
rs2302259 717 dbSNP
rs1262121075 719 dbSNP
rs1484651801 721 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 84318.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' uacagggugggggUGAGGACa 5'
                       ||||||| 
Target 5' ------------aACUCCUGg 3'
1 - 9
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' uacagggugggggUGAGGACa 5'
                       ||||||| 
Target 5' -------cuuugaACUCCUGg 3'
1 - 14
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000239830.4 | 3UTR | AACUCCUGGGCUCAAGCAAUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000239830.4 | 3UTR | CUUUGAACUCCUGGGCUCAAGCAAUUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
256 hsa-miR-4433a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT088097 SEPT2 septin 2 2 2
MIRT143134 MGRN1 mahogunin ring finger 1 2 2
MIRT153912 NCOA3 nuclear receptor coactivator 3 2 2
MIRT154894 GNAS GNAS complex locus 2 4
MIRT200996 ZNF805 zinc finger protein 805 2 2
MIRT215729 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT235593 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT263250 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT317951 CDC5L cell division cycle 5 like 2 4
MIRT325572 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT354739 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT444552 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 4
MIRT446978 SUSD5 sushi domain containing 5 2 2
MIRT451036 ZNF610 zinc finger protein 610 2 2
MIRT451596 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT452025 NLRP6 NLR family pyrin domain containing 6 2 2
MIRT452594 CA6 carbonic anhydrase 6 2 2
MIRT452768 TCEA3 transcription elongation factor A3 2 4
MIRT452959 ZNF844 zinc finger protein 844 2 2
MIRT453191 ACSF2 acyl-CoA synthetase family member 2 2 2
MIRT453382 RHD Rh blood group D antigen 2 2
MIRT453685 CEBPD CCAAT/enhancer binding protein delta 2 2
MIRT455272 DDX39B DExD-box helicase 39B 2 8
MIRT455346 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT456494 SERAC1 serine active site containing 1 2 2
MIRT456585 NID1 nidogen 1 2 2
MIRT456888 DDA1 DET1 and DDB1 associated 1 2 2
MIRT457123 APOLD1 apolipoprotein L domain containing 1 2 2
MIRT457852 ZNF324B zinc finger protein 324B 2 2
MIRT457987 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT459278 APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F 2 2
MIRT459625 SLC25A33 solute carrier family 25 member 33 2 2
MIRT459715 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT460057 RPL22L1 ribosomal protein L22 like 1 2 2
MIRT460182 UNK unkempt family zinc finger 2 6
MIRT460288 PDE11A phosphodiesterase 11A 2 2
MIRT460841 EGF epidermal growth factor 2 4
MIRT460860 TBC1D19 TBC1 domain family member 19 2 2
MIRT461519 EMC7 ER membrane protein complex subunit 7 2 2
MIRT461729 SLC27A1 solute carrier family 27 member 1 2 4
MIRT461821 SNAP23 synaptosome associated protein 23 2 2
MIRT462066 CCDC77 coiled-coil domain containing 77 2 4
MIRT462084 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT462508 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 10
MIRT464239 VCP valosin containing protein 2 2
MIRT465316 TRAF5 TNF receptor associated factor 5 2 2
MIRT466549 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT467128 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 8
MIRT468091 SHCBP1 SHC binding and spindle associated 1 2 2
MIRT469630 RAD21 RAD21 cohesin complex component 2 6
MIRT471097 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT472704 MYBL1 MYB proto-oncogene like 1 2 2
MIRT472830 MTMR10 myotubularin related protein 10 2 2
MIRT472872 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT472895 MTDH metadherin 2 2
MIRT473728 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT473859 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT474047 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT474297 LAMC1 laminin subunit gamma 1 2 2
MIRT474658 KLF13 Kruppel like factor 13 2 2
MIRT475234 IKZF3 IKAROS family zinc finger 3 2 2
MIRT475500 HSP90B1 heat shock protein 90 beta family member 1 2 2
MIRT475742 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT475793 HDGF heparin binding growth factor 2 2
MIRT477254 ERGIC2 ERGIC and golgi 2 2 2
MIRT478228 DDX52 DExD-box helicase 52 2 2
MIRT478393 DCTN5 dynactin subunit 5 2 2
MIRT478754 CS citrate synthase 2 2
MIRT478827 CRKL CRK like proto-oncogene, adaptor protein 2 4
MIRT480234 C9orf41 carnosine N-methyltransferase 1 2 2
MIRT480597 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT484121 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT484689 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT486331 C11orf54 chromosome 11 open reading frame 54 2 4
MIRT488599 FAM3C family with sequence similarity 3 member C 2 8
MIRT488833 MRRF mitochondrial ribosome recycling factor 2 2
MIRT492523 RAB15 RAB15, member RAS oncogene family 2 4
MIRT493632 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT500026 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501075 SMAD7 SMAD family member 7 2 8
MIRT503094 BTG2 BTG anti-proliferation factor 2 2 4
MIRT503336 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT505465 STMN1 stathmin 1 2 4
MIRT505726 SERTAD3 SERTA domain containing 3 2 4
MIRT509333 MS4A4A membrane spanning 4-domains A4A 2 2
MIRT509978 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 4
MIRT513068 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT513446 EMP1 epithelial membrane protein 1 2 6
MIRT513736 PSD3 pleckstrin and Sec7 domain containing 3 2 4
MIRT513996 CENPQ centromere protein Q 2 4
MIRT516538 MIXL1 Mix paired-like homeobox 2 2
MIRT517606 SAV1 salvador family WW domain containing protein 1 2 2
MIRT518064 CEP89 centrosomal protein 89 2 2
MIRT518119 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT518325 WDR92 WD repeat domain 92 2 2
MIRT519048 ABCB11 ATP binding cassette subfamily B member 11 2 2
MIRT520972 SPPL2A signal peptide peptidase like 2A 2 4
MIRT521359 RPL35A ribosomal protein L35a 2 2
MIRT523359 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT523801 FAM63A MINDY lysine 48 deubiquitinase 1 2 2
MIRT524622 C7orf73 short transmembrane mitochondrial protein 1 2 2
MIRT525550 PHB2 prohibitin 2 2 4
MIRT529709 ZBTB49 zinc finger and BTB domain containing 49 2 2
MIRT531605 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT532387 UMPS uridine monophosphate synthetase 2 2
MIRT534468 SCD stearoyl-CoA desaturase 2 4
MIRT537546 ETNK1 ethanolamine kinase 1 2 2
MIRT541619 C11orf31 selenoprotein H 2 2
MIRT548380 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT549523 HDDC2 HD domain containing 2 2 2
MIRT549774 SOD2 superoxide dismutase 2 2 2
MIRT550578 SLC2A5 solute carrier family 2 member 5 2 2
MIRT551498 CENPN centromere protein N 2 4
MIRT552301 ITGA3 integrin subunit alpha 3 2 2
MIRT555400 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT556399 LUC7L LUC7 like 2 2
MIRT557047 HOXB3 homeobox B3 2 2
MIRT558072 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 2
MIRT559659 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT561239 ZNF354B zinc finger protein 354B 2 2
MIRT566899 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT568786 FAM120B family with sequence similarity 120B 2 2
MIRT574014 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT574885 Dnajc6 DnaJ heat shock protein family (Hsp40) member C6 2 2
MIRT575243 Serping1 serine (or cysteine) peptidase inhibitor, clade G, member 1 2 2
MIRT576194 Vsig2 V-set and immunoglobulin domain containing 2 2 2
MIRT576309 Acbd7 acyl-Coenzyme A binding domain containing 7 2 2
MIRT576484 Lhx4 LIM homeobox protein 4 2 3
MIRT576646 Mill2 MHC I like leukocyte 2 1 1
MIRT576708 Kras Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT576855 Socs6 suppressor of cytokine signaling 6 2 2
MIRT576950 Aldoa aldolase A, fructose-bisphosphate 2 2
MIRT617133 ZNF556 zinc finger protein 556 2 4
MIRT617928 ZNF783 zinc finger family member 783 2 2
MIRT618981 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT621100 SIX3 SIX homeobox 3 2 2
MIRT624537 BROX BRO1 domain and CAAX motif containing 2 2
MIRT625663 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT627059 DCTN6 dynactin subunit 6 2 2
MIRT628319 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT630859 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 2
MIRT632295 TMEM65 transmembrane protein 65 2 2
MIRT634115 ZNF207 zinc finger protein 207 2 2
MIRT634736 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT635655 NDST3 N-deacetylase and N-sulfotransferase 3 2 2
MIRT635772 PDCL3 phosducin like 3 2 2
MIRT635911 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT636365 OGFRL1 opioid growth factor receptor like 1 2 4
MIRT637251 GLRX2 glutaredoxin 2 2 2
MIRT638705 FZD4 frizzled class receptor 4 2 2
MIRT639640 PREX2 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 2 2 2
MIRT639676 PPEF2 protein phosphatase with EF-hand domain 2 2 4
MIRT642267 SMIM17 small integral membrane protein 17 2 2
MIRT642372 ZNF581 zinc finger protein 581 2 2
MIRT643545 SLC25A17 solute carrier family 25 member 17 2 2
MIRT647994 PDE12 phosphodiesterase 12 2 2
MIRT649094 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT650993 ZNF770 zinc finger protein 770 2 2
MIRT651956 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT652977 SUN2 Sad1 and UNC84 domain containing 2 2 2
MIRT654389 RBM12B RNA binding motif protein 12B 2 2
MIRT655637 OLFML2A olfactomedin like 2A 2 2
MIRT655729 NRXN3 neurexin 3 2 2
MIRT658171 FCHSD1 FCH and double SH3 domains 1 2 2
MIRT660937 ACOX1 acyl-CoA oxidase 1 2 2
MIRT662112 CERKL ceramide kinase like 2 2
MIRT662302 MPV17L MPV17 mitochondrial inner membrane protein like 2 2
MIRT662993 TMEM59 transmembrane protein 59 2 2
MIRT663071 SFR1 SWI5 dependent homologous recombination repair protein 1 2 2
MIRT663704 ABHD17B abhydrolase domain containing 17B 2 2
MIRT663864 MUC20 mucin 20, cell surface associated 2 2
MIRT665185 HAUS5 HAUS augmin like complex subunit 5 2 4
MIRT665402 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT665688 TNPO3 transportin 3 2 2
MIRT665795 TMEM170A transmembrane protein 170A 2 2
MIRT665847 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT666999 PDPN podoplanin 2 2
MIRT667598 LIPC lipase C, hepatic type 2 2
MIRT668576 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 4
MIRT670960 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT671187 ZNF891 zinc finger protein 891 2 2
MIRT671739 ZNF451 zinc finger protein 451 2 2
MIRT672745 ZNF585B zinc finger protein 585B 2 4
MIRT673446 ZNF583 zinc finger protein 583 2 2
MIRT679843 GPR75 G protein-coupled receptor 75 2 2
MIRT680556 ZNF584 zinc finger protein 584 2 2
MIRT680661 C1orf210 chromosome 1 open reading frame 210 2 2
MIRT681285 RFC2 replication factor C subunit 2 2 2
MIRT683264 ZNF329 zinc finger protein 329 2 2
MIRT684519 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT685065 GEMIN4 gem nuclear organelle associated protein 4 2 2
MIRT685157 DTWD2 DTW domain containing 2 2 2
MIRT685168 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT685470 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT686001 NEK4 NIMA related kinase 4 2 2
MIRT687027 RNF24 ring finger protein 24 2 2
MIRT687543 MOB1B MOB kinase activator 1B 2 2
MIRT687592 MANEAL mannosidase endo-alpha like 2 2
MIRT687753 KIAA1328 KIAA1328 2 2
MIRT688050 GLUL glutamate-ammonia ligase 2 2
MIRT688374 ENPP1 ectonucleotide pyrophosphatase/phosphodiesterase 1 2 2
MIRT688802 CBFA2T3 CBFA2/RUNX1 translocation partner 3 2 2
MIRT688957 ATXN3 ataxin 3 2 2
MIRT689281 C5AR2 complement component 5a receptor 2 2 2
MIRT689988 NNMT nicotinamide N-methyltransferase 2 2
MIRT689997 MMP17 matrix metallopeptidase 17 2 2
MIRT690014 LUZP2 leucine zipper protein 2 2 2
MIRT690161 ELP3 elongator acetyltransferase complex subunit 3 2 2
MIRT690379 ZSWIM7 zinc finger SWIM-type containing 7 2 2
MIRT690563 MICA MHC class I polypeptide-related sequence A 2 2
MIRT691891 EVC EvC ciliary complex subunit 1 2 2
MIRT693107 SCNM1 sodium channel modifier 1 2 2
MIRT693832 ZFP64 ZFP64 zinc finger protein 2 2
MIRT694105 ZNF446 zinc finger protein 446 2 2
MIRT694179 ZNF486 zinc finger protein 486 2 2
MIRT694475 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT694998 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT695031 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT695163 TCTN2 tectonic family member 2 2 2
MIRT695525 SLC25A34 solute carrier family 25 member 34 2 2
MIRT696067 ZNF264 zinc finger protein 264 2 2
MIRT696616 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT696661 AGXT2 alanine--glyoxylate aminotransferase 2 2 2
MIRT696705 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT697173 INMT indolethylamine N-methyltransferase 2 2
MIRT697303 ZNF652 zinc finger protein 652 2 2
MIRT697491 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT698657 TERF2 telomeric repeat binding factor 2 2 2
MIRT699042 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699185 SLX4IP SLX4 interacting protein 2 2
MIRT699598 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT700150 RNF115 ring finger protein 115 2 2
MIRT700720 PNO1 partner of NOB1 homolog 2 2
MIRT700870 PER2 period circadian clock 2 2 2
MIRT700912 PDXK pyridoxal kinase 2 2
MIRT701095 PAPOLG poly(A) polymerase gamma 2 2
MIRT701194 OTUD3 OTU deubiquitinase 3 2 2
MIRT702203 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT702272 LHX4 LIM homeobox 4 2 3
MIRT703125 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT703252 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT703262 GNL3L G protein nucleolar 3 like 2 2
MIRT703440 FYTTD1 forty-two-three domain containing 1 2 2
MIRT704321 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT704393 CTSS cathepsin S 2 2
MIRT704483 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT704880 CCSER2 coiled-coil serine rich protein 2 2 2
MIRT704926 CCDC36 coiled-coil domain containing 36 2 2
MIRT705175 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT706561 EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 2 2
MIRT707048 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT711497 PGD phosphogluconate dehydrogenase 2 2
MIRT716644 EPGN epithelial mitogen 2 2
MIRT720083 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT722288 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT725468 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4433a Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4433a Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-4433a Vincristine 5978 approved resistant cell line (W1)
hsa-mir-4433a Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4433a-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-4433a-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission