>CCDC77|NM_001130146|3'UTR
   1 TGTCTACTTTTGGAAATGGCCCCCATTTAGAAGAGGTGTGCTTCTTGAAACCTGAGGACAAGGTCATCTGCTGCCAGAAA
  81 ATGTAAACCTGAGTTGACTAGAGTGGTGGTATTCATTATTGTAAAGACAGCTTGAAGAATCGGGGACCACTAGGAAAGCT
 161 TTTCTTGCATACTCAGCTTGCTTTATCATTTTTGCTGTCCTTTTAACACTTGCGAGGAGTAGGGGCCTGGTCCTGAATGA
 241 CTTGGAGGCTTTCATTATTTATCCTGTCTGTATTGACCGGTTTTTGTTTTTTCAGAAGGCAGTGATGATGAAAACTTAGG
 321 AAGAAGGTATTTTGCAATAAGCTTGGCTGAGTGTCCATGGGAAGAATACTTTCCCTAAAGAGAGAGAAGCACTCACAGAG
 401 GCTGCCTTTCTCCTGAGCTCGGGGAGAAGGCAGCACATCACAACCTGTCACATTGAAATAGGCGCTCATTCTGCTATTTC
 481 ACCTTCCGTCCTGAGCAGAGCCTGAATTACGTTTTTGGGCAATTTCATGGTGTTTCACCAGAGGGCGCTAGAGACTCAAA
 561 CGAAATGTCCATCTGGAAAGATTCGGGAGACACTTTGCCGAGGGGATGAAGCTGAGATGATGCTTGTATGGAAAGTTTGA
 641 TATTTTTATCAGTCACATGGCTTTTGAAAAATGATGTATATATTTTAAATTAACTATTTTCAATAAAATATTTCACTCAA
 721 AAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugugAGA--UUUC----CCUUC-GUGAAACa 5' ||| |||| ||:|| ||||||| Target 5' tccaTCTGGAAAGATTCGGGAGACACTTTGc 3'	568 - 598	164.00	-17.70
2	miRNA 3' ugUGAGAUUUCCCUUCGUGAAACa 5' |||: ::| | |:|:|:|||| Target 5' aaACTTAGGAAGAAGGTATTTTGc 3'	312 - 335	138.00	-11.50
3	miRNA 3' ugugagauUUCCCUUC--GUGAAAca 5' | |||||| :||||| Target 5' gagtgtccATGGGAAGAATACTTTcc 3'	349 - 374	126.00	-10.70

Mutant ID	Mutant Position	Mutant Source
COSN31538221	8	COSMIC
COSN26538136	41	COSMIC
COSN31882521	88	COSMIC
COSN19466265	120	COSMIC
COSN30160729	127	COSMIC
COSN30193371	165	COSMIC
COSN30124743	169	COSMIC
COSN30449809	188	COSMIC
COSN29573879	287	COSMIC
rs1048466	465	GWAS

Mutant ID	Mutant Position	Mutant Source
rs767257837	2	dbSNP
rs752353061	4	dbSNP
rs1342102821	6	dbSNP
rs755600704	7	dbSNP
rs777279948	9	dbSNP
rs1356925996	12	dbSNP
rs757179323	14	dbSNP
rs1435503335	17	dbSNP
rs1292099295	18	dbSNP
rs778734287	21	dbSNP
rs745638443	22	dbSNP
rs968951291	23	dbSNP
rs1172081794	24	dbSNP
rs768903744	34	dbSNP
rs375923208	43	dbSNP
rs769782476	44	dbSNP
rs1185833773	52	dbSNP
rs1242825620	53	dbSNP
rs773280785	53	dbSNP
rs1195176968	80	dbSNP
rs1487271649	82	dbSNP
rs910177734	83	dbSNP
rs150049843	89	dbSNP
rs900322137	100	dbSNP
rs1341241244	115	dbSNP
rs1040496971	124	dbSNP
rs997581777	133	dbSNP
rs1030368478	135	dbSNP
rs11550736	140	dbSNP
rs923145146	142	dbSNP
rs929157074	143	dbSNP
rs1272256706	150	dbSNP
rs1220928183	153	dbSNP
rs77158484	154	dbSNP
rs1339106676	159	dbSNP
rs1047545809	171	dbSNP
rs1189524034	173	dbSNP
rs1361302348	181	dbSNP
rs1332409206	186	dbSNP
rs1414141056	196	dbSNP
rs1420265767	197	dbSNP
rs1004803447	198	dbSNP
rs1048462	204	dbSNP
rs1476916743	205	dbSNP
rs887732803	209	dbSNP
rs4980907	210	dbSNP
rs1044378078	214	dbSNP
rs905839674	215	dbSNP
rs1484101783	226	dbSNP
rs542031152	242	dbSNP
rs566411078	245	dbSNP
rs1274425825	260	dbSNP
rs1196192413	261	dbSNP
rs1316828952	262	dbSNP
rs1278085838	264	dbSNP
rs1234493412	266	dbSNP
rs1381733298	267	dbSNP
rs1282823530	271	dbSNP
rs1447487528	279	dbSNP
rs891864947	280	dbSNP
rs1189686128	287	dbSNP
rs1376659004	287	dbSNP
rs1333697884	297	dbSNP
rs75822891	309	dbSNP
rs77026311	320	dbSNP
rs1021799354	329	dbSNP
rs1311072066	337	dbSNP
rs1425522343	338	dbSNP
rs916782830	343	dbSNP
rs1181079274	347	dbSNP
rs1470421574	348	dbSNP
rs1239609278	354	dbSNP
rs970866922	367	dbSNP
rs968959607	369	dbSNP
rs985673316	370	dbSNP
rs2302258	375	dbSNP
rs934317256	377	dbSNP
rs1324032306	395	dbSNP
rs1327951273	397	dbSNP
rs12581017	401	dbSNP
rs564004792	402	dbSNP
rs145358618	404	dbSNP
rs567595479	405	dbSNP
rs914489055	409	dbSNP
rs1374560892	415	dbSNP
rs1311712743	419	dbSNP
rs149182859	421	dbSNP
rs1250684976	422	dbSNP
rs975757744	439	dbSNP
rs763112186	442	dbSNP
rs560285164	445	dbSNP
rs1164076368	454	dbSNP
rs1401039649	455	dbSNP
rs1381990522	456	dbSNP
rs900374045	458	dbSNP
rs1176343928	460	dbSNP
rs1438728901	462	dbSNP
rs1253005709	464	dbSNP
rs1048466	465	dbSNP
rs1487258289	469	dbSNP
rs1245455224	477	dbSNP
rs1277504033	477	dbSNP
rs1221543852	480	dbSNP
rs1051804109	485	dbSNP
rs181027281	488	dbSNP
rs1238164677	489	dbSNP
rs1353282013	491	dbSNP
rs909011507	491	dbSNP
rs941960609	498	dbSNP
rs1365628920	504	dbSNP
rs1263467116	511	dbSNP
rs886484740	512	dbSNP
rs1431421013	513	dbSNP
rs1156616676	523	dbSNP
rs1362175952	523	dbSNP
rs879249152	526	dbSNP
rs1193006466	542	dbSNP
rs1004855964	547	dbSNP
rs1016236977	548	dbSNP
rs1177845150	549	dbSNP
rs12582823	557	dbSNP
rs12317361	562	dbSNP
rs938709742	564	dbSNP
rs982236971	569	dbSNP
rs1057123680	570	dbSNP
rs1290835083	571	dbSNP
rs540652376	574	dbSNP
rs928388256	581	dbSNP
rs561934447	584	dbSNP
rs1235754699	585	dbSNP
rs891914863	586	dbSNP
rs1296520336	594	dbSNP
rs1219091835	596	dbSNP
rs955746722	600	dbSNP
rs527980457	601	dbSNP
rs1375892963	611	dbSNP
rs1010281302	612	dbSNP
rs544514358	615	dbSNP
rs1464261729	617	dbSNP
rs1021807722	624	dbSNP
rs76296488	638	dbSNP
rs947042218	639	dbSNP
rs1007165479	649	dbSNP
rs1018559480	658	dbSNP
rs1478551700	662	dbSNP
rs974720143	679	dbSNP
rs965646378	706	dbSNP
rs1192173866	709	dbSNP
rs1477684783	712	dbSNP
rs921815725	715	dbSNP
rs1202353566	716	dbSNP
rs2302259	717	dbSNP
rs1262121075	719	dbSNP
rs1484651801	721	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.