>TMEM214|NM_001083590|3'UTR
   1 GCCCTGCCTTCCTGGCCACTGATTTCTGCATGGGTAGACCATCCAAGACTGCAGCGGGTAGAAGGTGGCAGTTCTTCATG
  81 GGAGTCTTTTTAACTTGGTGCCTGAGTTCTCTCCTAGGCAAGTGGCCAGTTGCCTCCACCTCAGTTCTTCCATCTTTGGT
 161 GGGGACAGGGCCCAGCAGCATCTCAGCCTCCTACCCACAATTCCACTGAACACTTTTCTGGCCCTACTGCACATGGCCCC
 241 CAGCCTCCATCCTTGTGCTGGTAGCCTCTCACAACTCCGCCCTTGCCCTCTGCCTTCCACTTCCTTCCATCTCATTTCTA
 321 AACCCCAAACAGCTCATCTCTAAAAAGATAGAACTCCCAGCAGGTGGCTTCTGTGTTCTTCTGACAAATGATTCCTGCTT
 401 CTCCAGACTTTAGCAGCCTCCTGTTCCCATTCTTGGTCACAGCTCTAGCCACAGCAGAAGGAAAGGGGCTTCCAGAAGAA
 481 TATAGCACCGCATTGGGAAACAGCAGCCTCACCTCCACCTGAAGCCTGGGTGTGGCTGTCAGTGGACATGGGGAGCTGGA
 561 TGGAAATGCCTCTCACTTCAAAATGCCCAGCCTGCCCCAAATGCCTCTAAGCCCCTCCCTGTCCCCTCCCTTGTAGTCCT
 641 ACTTCTTCCAACTTTCCATTCCCCATCATGCTGGGGGTCTTGGTCACAAGGCTCAGCTTCTCTCCACTGTCCATCCCTCC
 721 TATCATCTGTAGAGCAGAGCACAGGCAGTTGTGTGCCTTGGGCCCAGGGAACCCTCCATCAACCTGAGACAGGACTCAGT
 801 ATATGGTTCTTGGGTATGCCCTACCAGGTGGAATAAAGGACACAGATTTGATTTCTAGCAAAAAAAAAAAAAAAAAAAAA
 881 AAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' agaCAUUUAUAGGGAAACGGAcu 5' | ||:|: || |||||| Target 5' tagGCAAGTGGCCAGTTGCCTcc 3'	115 - 137	140.00	-13.20
2	miRNA 3' agacauuuauagggaaACGGACu 5' |||||| Target 5' agtctttttaacttggTGCCTGa 3'	83 - 105	120.00	-12.80
3	miRNA 3' agacaUUUAUAGGGAAACGGacu 5' || | || ||||| Target 5' ctcacAACTCCGCCCTTGCCctc 3'	268 - 290	110.00	-10.62

Mutant ID	Mutant Position	Mutant Source
COSM6803845	1	COSMIC
COSN30522649	35	COSMIC
COSN30168909	58	COSMIC
COSN31525735	75	COSMIC
COSN31527354	76	COSMIC
COSN26562375	101	COSMIC
COSN31586553	155	COSMIC
COSN31544625	157	COSMIC
COSN31575939	169	COSMIC
COSN31610394	170	COSMIC
COSN31586080	214	COSMIC
COSN30171569	256	COSMIC
COSN26556156	293	COSMIC
COSN31568377	348	COSMIC
COSN9369017	412	COSMIC
COSN31521746	422	COSMIC
COSN32161420	516	COSMIC
COSN30542235	569	COSMIC
COSN31603533	594	COSMIC
COSN31540840	672	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs368979896	1	dbSNP
rs761336413	6	dbSNP
rs764688398	10	dbSNP
rs1032564339	12	dbSNP
rs1263289164	13	dbSNP
rs1206436193	18	dbSNP
rs1293225702	19	dbSNP
rs779683698	23	dbSNP
rs774168971	26	dbSNP
rs199674846	29	dbSNP
rs758387710	35	dbSNP
rs766334709	37	dbSNP
rs1263776123	43	dbSNP
rs532496597	44	dbSNP
rs201411924	45	dbSNP
rs1264373000	46	dbSNP
rs996173172	50	dbSNP
rs777877436	53	dbSNP
rs559351193	56	dbSNP
rs143989329	57	dbSNP
rs1209287275	58	dbSNP
rs1384039382	59	dbSNP
rs373108350	60	dbSNP
rs1302217086	63	dbSNP
rs1482188850	71	dbSNP
rs746373379	72	dbSNP
rs146621629	73	dbSNP
rs1424649420	81	dbSNP
rs1167134959	86	dbSNP
rs745994889	87	dbSNP
rs961824931	95	dbSNP
rs1194655452	96	dbSNP
rs1440245461	108	dbSNP
rs1254626454	110	dbSNP
rs1200415965	125	dbSNP
rs867680730	126	dbSNP
rs1461990882	129	dbSNP
rs531680798	130	dbSNP
rs914912682	138	dbSNP
rs1160638091	146	dbSNP
rs550006545	152	dbSNP
rs1317492681	157	dbSNP
rs1446342844	163	dbSNP
rs750256021	183	dbSNP
rs139119676	188	dbSNP
rs1229644555	190	dbSNP
rs1301866566	194	dbSNP
rs1311838111	205	dbSNP
rs981444655	213	dbSNP
rs538978611	214	dbSNP
rs937034823	216	dbSNP
rs554466610	223	dbSNP
rs566216980	225	dbSNP
rs917043619	233	dbSNP
rs1471498623	234	dbSNP
rs1183452440	235	dbSNP
rs1367384045	235	dbSNP
rs1445748081	237	dbSNP
rs1245558076	238	dbSNP
rs189298059	240	dbSNP
rs1177141000	241	dbSNP
rs1457619585	243	dbSNP
rs117307953	246	dbSNP
rs1416266509	252	dbSNP
rs1354270389	259	dbSNP
rs1285838782	261	dbSNP
rs1264925659	266	dbSNP
rs1246889115	267	dbSNP
rs1327865932	274	dbSNP
rs1384867281	275	dbSNP
rs754196588	279	dbSNP
rs1041452509	283	dbSNP
rs902694451	293	dbSNP
rs1047140452	300	dbSNP
rs576247299	301	dbSNP
rs72852976	304	dbSNP
rs1403254291	305	dbSNP
rs1269998331	323	dbSNP
rs941459436	323	dbSNP
rs1310188222	337	dbSNP
rs1426065137	338	dbSNP
rs1209120307	341	dbSNP
rs1177352027	345	dbSNP
rs894044140	351	dbSNP
rs1184495646	355	dbSNP
rs1450078857	356	dbSNP
rs1268495096	361	dbSNP
rs1038296691	362	dbSNP
rs899864600	365	dbSNP
rs996613162	368	dbSNP
rs760295852	369	dbSNP
rs1483668701	376	dbSNP
rs1351050148	383	dbSNP
rs1028954756	390	dbSNP
rs376216746	399	dbSNP
rs1008950634	409	dbSNP
rs1029346478	412	dbSNP
rs1406206888	413	dbSNP
rs753379282	420	dbSNP
rs1157324554	424	dbSNP
rs577485245	432	dbSNP
rs550478377	446	dbSNP
rs1410851963	462	dbSNP
rs1160624822	465	dbSNP
rs890291080	475	dbSNP
rs571934817	478	dbSNP
rs1413297785	482	dbSNP
rs150815853	484	dbSNP
rs1200455283	490	dbSNP
rs754454814	491	dbSNP
rs1030847614	493	dbSNP
rs559601147	494	dbSNP
rs529905061	499	dbSNP
rs1028020036	502	dbSNP
rs1360119514	503	dbSNP
rs989246461	505	dbSNP
rs1021938276	507	dbSNP
rs969490329	509	dbSNP
rs779422027	513	dbSNP
rs958648368	521	dbSNP
rs1217219351	527	dbSNP
rs1344077728	531	dbSNP
rs981029098	533	dbSNP
rs567745513	535	dbSNP
rs991774834	538	dbSNP
rs1224981174	549	dbSNP
rs1436122625	553	dbSNP
rs1338045424	554	dbSNP
rs115132011	570	dbSNP
rs561120583	573	dbSNP
rs758798213	574	dbSNP
rs371141653	576	dbSNP
rs539361220	578	dbSNP
rs982881568	582	dbSNP
rs935526347	584	dbSNP
rs866722153	592	dbSNP
rs1218590155	601	dbSNP
rs1045062	608	dbSNP
rs1421836967	616	dbSNP
rs139628365	619	dbSNP
rs549845565	620	dbSNP
rs915517481	621	dbSNP
rs932261500	630	dbSNP
rs1205401593	632	dbSNP
rs1213273285	642	dbSNP
rs540053106	642	dbSNP
rs3172006	646	dbSNP
rs1272812614	652	dbSNP
rs566821725	653	dbSNP
rs747427718	654	dbSNP
rs1050609658	656	dbSNP
rs1214595183	657	dbSNP
rs1205909315	662	dbSNP
rs1272364462	677	dbSNP
rs1234692694	678	dbSNP
rs781335630	692	dbSNP
rs1337794358	695	dbSNP
rs1008835985	698	dbSNP
rs1045099	701	dbSNP
rs1477290925	702	dbSNP
rs3172004	703	dbSNP
rs1191125310	712	dbSNP
rs1426303605	720	dbSNP
rs180881796	723	dbSNP
rs1166301021	728	dbSNP
rs1369517266	736	dbSNP
rs554360844	738	dbSNP
rs1430029671	739	dbSNP
rs897903637	744	dbSNP
rs995120307	747	dbSNP
rs779355686	752	dbSNP
rs550128220	754	dbSNP
rs899823893	763	dbSNP
rs375554105	764	dbSNP
rs1185178715	769	dbSNP
rs566375325	770	dbSNP
rs1347616728	771	dbSNP
rs1250371853	773	dbSNP
rs958748091	777	dbSNP
rs1050355310	783	dbSNP
rs1024202793	798	dbSNP
rs890336018	799	dbSNP
rs971072833	800	dbSNP
rs1454882157	804	dbSNP
rs1045133	810	dbSNP
rs35626403	812	dbSNP
rs977072354	815	dbSNP
rs1372878988	819	dbSNP
rs924390201	824	dbSNP
rs745903011	827	dbSNP
rs769784917	839	dbSNP
rs3177274	843	dbSNP
rs957140131	844	dbSNP
rs1225950475	846	dbSNP
rs1008817701	849	dbSNP
rs149312354	850	dbSNP
rs1219821603	856	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.