miRTarBase - #MIRT462251


—
pre-miRNA Information
pre-miRNA hsa-mir-4291   
Genomic Coordinates chr9: 93819357 - 93819421
Description Homo sapiens miR-4291 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4291
Sequence 11| UUCAGCAGGAACAGCU |26
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1265713434 9 dbSNP
rs1433969451 12 dbSNP
rs1372852268 16 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LAMA4   
Synonyms CMD1JJ, LAMA3, LAMA4*-1
Description laminin subunit alpha 4
Transcript NM_001105206   
Other Transcripts NM_001105207 , NM_001105208 , NM_001105209 , NM_002290   
Expression
Putative miRNA Targets on LAMA4
3'UTR of LAMA4
(miRNA target sites are highlighted)		 
>LAMA4|NM_001105206|3'UTR
   1 CATGACAGAGCACAGCTGCCCAAATACAAAGTTCTTTAGAGCACTGAAAGAAACACAAAGCCAGCCAGGAGGAACAGTAA
  81 CTCTTCCTTCGGGTGGAAGCTTTCATCGAGTTGAACAGGACTTAAACGAATCATCAGGGACCGGATATTTCTTATTTCTC
 161 ATTTGGATTCTTAACCTTGAATCCAAAGTGTCTGCAATGGACAACAATTGAAGGAGTGGCAAACTTACTTGTATTGAGAG
 241 CACACGCAATTCCTACTGGTGAAATTACTGTTTCTGTTTCTAATAAAATAGAAGGGATTCCAAATAAACACTTGCACACA
 321 TTTTTGAAGTGCGGCTAGATTCTCAGATTCACCTTTCTTCCAGGGAAGATAACTTTCAATCTATATAAAAATCTCTGTCC
 401 TAAAACTACCTTTCTTTATTTTGAAGAGACTTACTAACTTACATATAATCTAAATTAGATGATAGATTTGTTTTTAGCCC
 481 TTTTGTTTGGTCTATCAGTATAAGAAGAATATTTTAGGTTTATAGCTGAAGTTATCAAGGTTTAATAAAGTAAATTTCTA
 561 ACAGAATACTAGAAAAATGCAGTATAATTTAATTTTTTCTAAATAAGAAACACAGGAAATCAACTACTTTTTCCCCTTCC
 641 TTATCTCCTTAAAAGAAAAATAAAATTGTACATGAGAGGAGGCTTCTGTAGGTTATTATTACCATTATTGTGTGTTCTAT
 721 GGGAATCATTGAGGATATCACAGCAAAAACAGTAGGACAAAATCATAAAATTCAATTTAAGAGTACACAAGTCCTTTTAT
 801 TAAAAGTTTGCTCCTAGCCTGGGCAACATAATGAGATCCCATCTCTGCAAAAAAATTTGTACATGGGCATACACCTGTAG
 881 TCCCAGCTACTTGGGAGGCTGAGACGGGAGGATCGCTTAAGCTCAGGAGTTCAAGGCTGCAGTGAGCTATGACTGCTGAC
 961 TGTACCTGCACTCCAGCCTGGGCAACAGAGTGAGATCCTGTCTCAAAAACAAAGTGTGCTCTCCACATACCTGCAACACA
1041 ACTAGTCTTATTTCTAAAATGTTATAATCTTTTTTCCAAGTAGCTACATTAATATAGTCTAGAAAAAAATGGACTTGAAT
1121 AGCTGGTAGAATATTAAAATATAGAAATGAAATAAAAGAATTATATCTAAAAACCTCAACTCAGAAGACAGAAAAAGAGA
1201 AAATAGGCCCTGATATCAACAGAATTAACAATACATAAAAGGAGTAACTTTTGAGGGGAGAGGATATAAAATATTTTGAG
1281 GAATTACCAAGGGGAATAAAACAATGTTACCTTGAAATGATTATATATATATTACATATTGGTATATATGTCCATACCTA
1361 CCTATATCCCCTGCTACCCTTCTGTCTGAAATATACAAATAATGATAATGTTGAAGATATCGATAAACATAGCTAATGTC
1441 TGTTCATAGAGGACTTACTAAGTGCCAGCCACCATGATAAGCTAAAGTTAATTATTTTATTTGTTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucGACAAGGACGACUu 5'
            || |  ||||||| 
Target 5' agCTATGACTGCTGAc 3'
 945 - 960 146.00 -12.60
2 
miRNA  3' ucgacaAGGAC-GACUu 5'
                |:||| |||| 
Target 5' ctacccTTCTGTCTGAa 3'
 1374 - 1390 114.00 -8.20
3 
miRNA  3' ucgacAAG---GACGACUu 5'
               |||   ||| ||| 
Target 5' cgcaaTTCCTACTGGTGAa 3'
 245 - 263 111.00 -9.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
178046 1 ClinVar
COSN8493486 11 COSMIC
COSN31522646 12 COSMIC
COSN31525771 34 COSMIC
COSN31497239 37 COSMIC
COSN30478162 39 COSMIC
COSN30505548 58 COSMIC
COSN7594075 65 COSMIC
COSN30171683 75 COSMIC
COSN30178042 98 COSMIC
COSN31584830 101 COSMIC
COSN30172063 142 COSMIC
COSN22427168 341 COSMIC
COSN8351494 655 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs148811960 1 dbSNP
rs782803177 10 dbSNP
rs782115194 14 dbSNP
rs1187169953 20 dbSNP
rs782002196 28 dbSNP
rs761421093 31 dbSNP
rs782344792 39 dbSNP
rs782229546 41 dbSNP
rs11495 47 dbSNP
rs781917619 50 dbSNP
rs1376465897 55 dbSNP
rs1436902329 59 dbSNP
rs1296037770 66 dbSNP
rs1339435917 70 dbSNP
rs1430893288 76 dbSNP
rs1271399982 83 dbSNP
rs1364828315 85 dbSNP
rs1052741455 90 dbSNP
rs1279170000 91 dbSNP
rs1349788538 93 dbSNP
rs1214168929 108 dbSNP
rs1284214779 113 dbSNP
rs936598654 117 dbSNP
rs1194039085 121 dbSNP
rs1243945783 127 dbSNP
rs1477052191 130 dbSNP
rs925225189 135 dbSNP
rs189040379 138 dbSNP
rs1396208648 142 dbSNP
rs587621110 143 dbSNP
rs969216710 169 dbSNP
rs185261611 184 dbSNP
rs587656054 192 dbSNP
rs57051984 196 dbSNP
rs1359547665 197 dbSNP
rs1400964698 198 dbSNP
rs1319829488 208 dbSNP
rs1347627412 208 dbSNP
rs1050447 217 dbSNP
rs915968148 218 dbSNP
rs1304153822 219 dbSNP
rs992882163 234 dbSNP
rs1237750552 237 dbSNP
rs181373793 241 dbSNP
rs587704634 245 dbSNP
rs1205965044 246 dbSNP
rs1286531097 252 dbSNP
rs1450011843 254 dbSNP
rs879999948 267 dbSNP
rs1254238482 273 dbSNP
rs188676874 276 dbSNP
rs1177271294 290 dbSNP
rs1380101227 291 dbSNP
rs587751148 295 dbSNP
rs1159946225 301 dbSNP
rs1411173530 319 dbSNP
rs1404304861 320 dbSNP
rs1325969661 321 dbSNP
rs371835413 331 dbSNP
rs1444509416 333 dbSNP
rs1330530815 344 dbSNP
rs1336139246 354 dbSNP
rs1240836372 364 dbSNP
rs1281553537 380 dbSNP
rs1354485893 383 dbSNP
rs1232797075 395 dbSNP
rs1273926701 407 dbSNP
rs1469841817 410 dbSNP
rs782738278 412 dbSNP
rs1438822048 414 dbSNP
rs1184408363 430 dbSNP
rs952982630 436 dbSNP
rs1027264967 438 dbSNP
rs587640670 449 dbSNP
rs868916635 454 dbSNP
rs12208872 460 dbSNP
rs1463551444 461 dbSNP
rs369885712 463 dbSNP
rs1169875931 465 dbSNP
rs1397113056 475 dbSNP
rs1392973543 483 dbSNP
rs1331920857 489 dbSNP
rs900013410 494 dbSNP
rs1040780453 495 dbSNP
rs1007978322 497 dbSNP
rs1414420346 499 dbSNP
rs1294072021 503 dbSNP
rs1337048203 507 dbSNP
rs1216872364 510 dbSNP
rs587698214 511 dbSNP
rs1340648146 528 dbSNP
rs587619742 532 dbSNP
rs1276986396 539 dbSNP
rs1485518857 555 dbSNP
rs1188229674 568 dbSNP
rs1259093672 579 dbSNP
rs1476591821 588 dbSNP
rs1192277106 589 dbSNP
rs1373616203 592 dbSNP
rs1463494963 609 dbSNP
rs6568718 613 dbSNP
rs1401251919 624 dbSNP
rs1435032350 625 dbSNP
rs1313791102 628 dbSNP
rs1357590546 631 dbSNP
rs1398279737 633 dbSNP
rs1294905970 640 dbSNP
rs1327058941 654 dbSNP
rs936362446 666 dbSNP
rs1254709642 668 dbSNP
rs587688411 682 dbSNP
rs868914090 700 dbSNP
rs1487087903 701 dbSNP
rs782151894 702 dbSNP
rs947857649 705 dbSNP
rs1261851306 706 dbSNP
rs1429715244 710 dbSNP
rs1196672916 712 dbSNP
rs371387469 723 dbSNP
rs7758910 728 dbSNP
rs775359336 729 dbSNP
rs782343119 733 dbSNP
rs769754588 739 dbSNP
rs1418132305 758 dbSNP
rs1288459201 783 dbSNP
rs1385775043 786 dbSNP
rs1383924980 790 dbSNP
rs587735428 792 dbSNP
rs72948387 800 dbSNP
rs1235531487 811 dbSNP
rs1306131542 812 dbSNP
rs1351905723 813 dbSNP
rs1237895138 820 dbSNP
rs1260882513 822 dbSNP
rs1486601021 829 dbSNP
rs184701179 837 dbSNP
rs114244600 841 dbSNP
rs7738331 847 dbSNP
rs7758715 853 dbSNP
rs113012969 854 dbSNP
rs1195381679 856 dbSNP
rs1378276955 856 dbSNP
rs192805682 857 dbSNP
rs1158656757 864 dbSNP
rs782267736 865 dbSNP
rs1364591615 868 dbSNP
rs782022284 872 dbSNP
rs1291831539 885 dbSNP
rs964165785 886 dbSNP
rs1442316351 891 dbSNP
rs1328452561 897 dbSNP
rs1019789160 905 dbSNP
rs113422687 906 dbSNP
rs1318331012 914 dbSNP
rs782425461 915 dbSNP
rs75232337 929 dbSNP
rs782811911 936 dbSNP
rs1000512326 943 dbSNP
rs1215501716 949 dbSNP
rs903537612 952 dbSNP
rs1236214573 953 dbSNP
rs1044921870 960 dbSNP
rs587720600 963 dbSNP
rs1251573420 965 dbSNP
rs1421144259 971 dbSNP
rs947971158 973 dbSNP
rs782585192 974 dbSNP
rs587640990 977 dbSNP
rs587757621 978 dbSNP
rs1417270148 990 dbSNP
rs13219197 1006 dbSNP
rs782350692 1018 dbSNP
rs1056289178 1024 dbSNP
rs781858474 1027 dbSNP
rs782234322 1038 dbSNP
rs1398722690 1047 dbSNP
rs190712536 1049 dbSNP
rs782533231 1051 dbSNP
rs1299068563 1054 dbSNP
rs1375926217 1059 dbSNP
rs1393947148 1060 dbSNP
rs1355547574 1069 dbSNP
rs1234588282 1076 dbSNP
rs931294349 1077 dbSNP
rs587637018 1080 dbSNP
rs1205088156 1085 dbSNP
rs868934654 1093 dbSNP
rs1252880060 1097 dbSNP
rs1482121047 1115 dbSNP
rs1186081376 1126 dbSNP
rs1257077123 1130 dbSNP
rs1475612227 1131 dbSNP
rs144567444 1148 dbSNP
rs1418043301 1154 dbSNP
rs587685119 1162 dbSNP
rs1171671783 1167 dbSNP
rs587634158 1175 dbSNP
rs370077528 1180 dbSNP
rs587773318 1184 dbSNP
rs1433170548 1193 dbSNP
rs964279046 1204 dbSNP
rs587713303 1209 dbSNP
rs1375661734 1211 dbSNP
rs1416142186 1222 dbSNP
rs1275721269 1226 dbSNP
rs587633645 1232 dbSNP
rs1215102400 1233 dbSNP
rs1019906271 1236 dbSNP
rs1310288467 1239 dbSNP
rs1209877906 1245 dbSNP
rs1279945995 1248 dbSNP
rs1486105204 1251 dbSNP
rs1213235058 1252 dbSNP
rs1240449851 1258 dbSNP
rs1187615106 1276 dbSNP
rs115801187 1278 dbSNP
rs1453026987 1286 dbSNP
rs114196782 1296 dbSNP
rs1030716585 1305 dbSNP
rs1001026713 1319 dbSNP
rs1315719451 1322 dbSNP
rs140825403 1324 dbSNP
rs1430820352 1329 dbSNP
rs1023249854 1334 dbSNP
rs1290624505 1346 dbSNP
rs1368674817 1357 dbSNP
rs1233349013 1358 dbSNP
rs1303922019 1364 dbSNP
rs1349721471 1384 dbSNP
rs587729304 1394 dbSNP
rs1282337051 1396 dbSNP
rs896391423 1407 dbSNP
rs1216573370 1412 dbSNP
rs1244380422 1420 dbSNP
rs138998230 1421 dbSNP
rs1193514598 1422 dbSNP
rs1396085061 1424 dbSNP
rs1056805237 1428 dbSNP
rs1156514918 1435 dbSNP
rs940508604 1449 dbSNP
rs1400837776 1460 dbSNP
rs1160622313 1462 dbSNP
rs886278006 1465 dbSNP
rs1391604789 1468 dbSNP
rs781871102 1471 dbSNP
rs1326426006 1472 dbSNP
rs186748135 1477 dbSNP
rs182188232 1484 dbSNP
rs782095833 1488 dbSNP
rs920040269 1495 dbSNP
rs1350200134 1497 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucgacaagGACGACUu 5'
                  ||||||| 
Target 5' ----augaCUGCUGAc 3'
 		1 - 12
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001105206 | 3UTR | AGGCUGCAGUGAGCUAUGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_001105206 | 3UTR | GCUGCAGUGAGCUAUGACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001105206 | 3UTR | AGGCUGCAGUGAGCUAUGACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001105206 | 3UTR | UUCAAGGCUGCAGUGAGCUAUGACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000230538.7 | 3UTR | AUGACUGCUGACUGUACCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
82 hsa-miR-4291 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT102445 CALU calumenin 2 4
MIRT108677 ZBTB33 zinc finger and BTB domain containing 33 2 4
MIRT125969 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT179018 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 4
MIRT379033 CDK6 cyclin dependent kinase 6 2 6
MIRT442473 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 2
MIRT442910 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT442979 ZNF736 zinc finger protein 736 2 2
MIRT445663 TNFSF15 TNF superfamily member 15 2 2
MIRT446237 FZD6 frizzled class receptor 6 2 2
MIRT448860 FAM49B family with sequence similarity 49 member B 2 2
MIRT455559 TRAF1 TNF receptor associated factor 1 2 2
MIRT459704 ZNF641 zinc finger protein 641 2 2
MIRT460608 FEM1A fem-1 homolog A 2 2
MIRT462251 LAMA4 laminin subunit alpha 4 2 2
MIRT462469 FIZ1 FLT3 interacting zinc finger 1 2 2
MIRT466656 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 6
MIRT466841 STX6 syntaxin 6 2 2
MIRT471403 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT471517 PCGF3 polycomb group ring finger 3 2 2
MIRT471681 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT472858 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT474813 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 2 2
MIRT474931 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT475814 HDGF heparin binding growth factor 2 2
MIRT480434 C17orf49 chromosome 17 open reading frame 49 2 2
MIRT480903 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT481478 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT484982 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 8
MIRT485019 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 8
MIRT485036 TMEM189 transmembrane protein 189 2 8
MIRT495074 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT496004 CD180 CD180 molecule 2 2
MIRT500675 TRIM37 tripartite motif containing 37 2 2
MIRT504544 ZNF417 zinc finger protein 417 2 6
MIRT506782 KLHL15 kelch like family member 15 2 6
MIRT507256 FGF2 fibroblast growth factor 2 2 6
MIRT507386 EN2 engrailed homeobox 2 2 2
MIRT512505 BTBD19 BTB domain containing 19 2 2
MIRT516903 CTSB cathepsin B 2 2
MIRT528124 PPP1R10 protein phosphatase 1 regulatory subunit 10 2 2
MIRT528874 ATF3 activating transcription factor 3 2 2
MIRT536091 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT541079 RLIM ring finger protein, LIM domain interacting 2 2
MIRT541099 RAF1 Raf-1 proto-oncogene, serine/threonine kinase 2 2
MIRT545360 LIN7C lin-7 homolog C, crumbs cell polarity complex component 2 2
MIRT545831 ZNF367 zinc finger protein 367 2 4
MIRT547115 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT547312 NPTN neuroplastin 2 2
MIRT547959 HIGD1A HIG1 hypoxia inducible domain family member 1A 2 4
MIRT549943 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT550749 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT565145 TUBB2A tubulin beta 2A class IIa 2 2
MIRT571050 POLQ DNA polymerase theta 2 2
MIRT571361 ZNF45 zinc finger protein 45 2 2
MIRT610133 FOXI2 forkhead box I2 2 2
MIRT613145 DSE dermatan sulfate epimerase 2 2
MIRT613379 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT615752 C6 complement C6 2 2
MIRT616460 ADRA2B adrenoceptor alpha 2B 2 2
MIRT616719 FEM1B fem-1 homolog B 2 2
MIRT618312 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT631491 RASSF4 Ras association domain family member 4 2 2
MIRT643134 PLCXD2 phosphatidylinositol specific phospholipase C X domain containing 2 2 2
MIRT643482 DISC1 disrupted in schizophrenia 1 2 2
MIRT649715 TWSG1 twisted gastrulation BMP signaling modulator 1 2 2
MIRT653542 SLC38A7 solute carrier family 38 member 7 2 2
MIRT666307 SLC22A3 solute carrier family 22 member 3 2 2
MIRT692005 NAP1L4 nucleosome assembly protein 1 like 4 2 2
MIRT696838 ARL2BP ADP ribosylation factor like GTPase 2 binding protein 2 2
MIRT698204 TMEM248 transmembrane protein 248 2 2
MIRT703316 GDPD5 glycerophosphodiester phosphodiesterase domain containing 5 2 2
MIRT709376 FAM13A family with sequence similarity 13 member A 2 2
MIRT710112 MED23 mediator complex subunit 23 2 2
MIRT711975 HOMER2 homer scaffolding protein 2 2 2
MIRT712275 PPIP5K2 diphosphoinositol pentakisphosphate kinase 2 2 2
MIRT714108 TMED9 transmembrane p24 trafficking protein 9 2 2
MIRT719113 MAML1 mastermind like transcriptional coactivator 1 2 2
MIRT719727 SLC39A11 solute carrier family 39 member 11 2 2
MIRT720018 TFAP2C transcription factor AP-2 gamma 2 2
MIRT720358 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT720372 NUDT3 nudix hydrolase 3 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4291 Platinum-based doublet chemotherapy resistant High Lung Adenocarcinoma tissue
hsa-miR-4291 Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-4291 Paclitaxel 36314 NSC125973 approved resistant High Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-4291 Doxorubicin 31703 NSC123127 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-4291 Radioactivity Iodine resistant High Papillary Thyroid Cancer tissue
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-4291 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4291 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-4291 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4291 Platinum-based doublet chemotherapy resistant tissue (lung adenocarcinoma)
hsa-miR-4291 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4291 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-4291 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission