>ZNF385A|NM_001130967|3'UTR
   1 CCTCAACCCTGAACCCCTCCCATTCAACTCCCCACCTCCAGCCGGGACCCAGGCGTCCGGGCTCCCAGCCCGCCCCTCCT
  81 CCCGGCACTCCCTAAATGATCTCTCCTTCCCCCCCCCCACCCCGAGATACGGGGTTCCAGGAAAGGGGAGGGGTAGCGGG
 161 GGAGGGGGGCTTCAGAAGGGGGGGAACACCCCAGATCTCAGGGAACCCCGCCCCCTGCCTTTCCCTCTCCCCTAGAAAAG
 241 GGGGGGCCGTCTCACCCCCGAGCCCCCTTGGAGACACCCCCCCTCCCAAAAGCCATGTCCATCCAGCCCTTCCCCCCAAA
 321 CCTAGCACAAAACGGGGTTCACAAGCCATGGTCGGGGTCCGGGGGGGACAGAAATGGATTTTCTTGGCAATAAGCGGACT
 401 CTGGGACTCCGGCTCCCTACCCCAAACTGAAGCGCTTCCGTGAACACCCCCGTCCTCCGTAGGGGGAGGGGAGCAGGCGG
 481 GATCCTGGGTCCCTCATAAGCACTTTGGTTTTACCGCCTGCAACCTCACTGTGCCCGCCCCGCACCATGCCCTAGCCCCA
 561 GGTCTAGCCGGGCCCATTGCAGGGGGCAGCACTTGGGGGCATCTCCGGCACTTGGGTGGGACCAAGGAGATGCCACCATA
 641 GACCTTTCCCTCGCCTTCTTCCTCCCTAGTCCGGGTTCCATTCTTTTCACCAGCACCCATCGCCCAAGGGGTACCGAGGG
 721 GGGCAAGGGGTGTCCAGTCCAAGCCCACCCCCGCCTCGCCTTCCGCAAAACTGTGAGCAAAAAGCAATAGAAGCCTCGCC
 801 CCCGCCCTTCCCCTTCGCAGGATTCGCCGAGTCTGTAGCCTCCCCGATCCAAGTTCCTAGACCTCATGGCTGTCCCCTCC
 881 CACCAGTCACCTCCACTGCACAACTCGGGCGGGGGTGTGACACCTCTCCCCCACCCCCGACTCCGTGGTTTCCGTATCGT
 961 CAACCCTTCAGCCGCCGACCCGGGAGGGGTCTGGCCTACACTGGTCTTCCCCTTCCCATCAACTCTTTCTGCTTGACAAT
1041 GTAGCAACCCAGGCCCCCCACCCACGGTCCTCCCCTTTTTCCTCTCCCTGACAATAAAGTCTGAATTTGTTCTGCCCTCC
1121 GCCCCTA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ggGGGUAACGAUGUCGGCGGACa 5' | | ||| | : ||||||| Target 5' agCACTTTGGTTTTACCGCCTGc 3'	499 - 521	153.00	-15.70
2	miRNA 3' ggGGGUAACGAUGUCGGCGGAca 5' :||| | || |||||| Target 5' agTCCAAGCCCACCCCCGCCTcg 3'	736 - 758	133.00	-15.70
3	miRNA 3' gggGGUAACGAUGUCGGCGGaca 5' :|| || |||||||| Target 5' tcgTCAACCCTTCAGCCGCCgac 3'	957 - 979	124.00	-19.50

Mutant ID	Mutant Position	Mutant Source
COSN29726639	107	COSMIC
COSN27392678	119	COSMIC
COSN28700439	119	COSMIC
COSN31551778	124	COSMIC
COSN30116957	154	COSMIC
COSN31545579	235	COSMIC
COSN24618365	276	COSMIC
COSN7616952	304	COSMIC
COSN30175804	478	COSMIC
COSN31595907	633	COSMIC
COSN1149603	793	COSMIC
COSN30541472	803	COSMIC
COSN31483426	817	COSMIC
COSN17675612	826	COSMIC
COSN19658861	914	COSMIC
COSN31538548	944	COSMIC
COSN31578962	958	COSMIC
COSN30176096	969	COSMIC
COSN26670772	1060	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1373651471	1	dbSNP
rs1375791356	4	dbSNP
rs768672880	6	dbSNP
rs1335153310	7	dbSNP
rs374026213	10	dbSNP
rs369869855	11	dbSNP
rs1454012970	14	dbSNP
rs1189059803	21	dbSNP
rs1295429376	28	dbSNP
rs1038940603	29	dbSNP
rs894309794	34	dbSNP
rs1482908883	41	dbSNP
rs1229757118	45	dbSNP
rs1250090247	48	dbSNP
rs1323168564	52	dbSNP
rs1201947831	54	dbSNP
rs1158739932	58	dbSNP
rs944657155	62	dbSNP
rs911687762	71	dbSNP
rs1182401872	77	dbSNP
rs1261000587	79	dbSNP
rs1426655237	91	dbSNP
rs1194767202	101	dbSNP
rs978335925	103	dbSNP
rs1392719146	104	dbSNP
rs1423645882	106	dbSNP
rs1479908429	108	dbSNP
rs1173763220	109	dbSNP
rs1288626078	109	dbSNP
rs867290160	109	dbSNP
rs759681419	110	dbSNP
rs1192523730	111	dbSNP
rs1221951212	112	dbSNP
rs944135357	113	dbSNP
rs534737195	114	dbSNP
rs1224465424	115	dbSNP
rs1490029229	116	dbSNP
rs570607338	116	dbSNP
rs1431029216	117	dbSNP
rs552416715	117	dbSNP
rs563351038	118	dbSNP
rs1305025695	119	dbSNP
rs1368641189	119	dbSNP
rs1455813074	119	dbSNP
rs3215379	119	dbSNP
rs1223370108	120	dbSNP
rs1306025509	120	dbSNP
rs1314870195	120	dbSNP
rs1224481294	124	dbSNP
rs1286711778	124	dbSNP
rs1356209798	127	dbSNP
rs1219705794	140	dbSNP
rs1270399205	145	dbSNP
rs925587146	149	dbSNP
rs959355043	151	dbSNP
rs548434677	152	dbSNP
rs1003759989	153	dbSNP
rs1248906688	154	dbSNP
rs978331420	157	dbSNP
rs1385206494	158	dbSNP
rs1233726961	166	dbSNP
rs1423273735	167	dbSNP
rs1371603897	169	dbSNP
rs966907191	178	dbSNP
rs1025150319	179	dbSNP
rs1428581475	180	dbSNP
rs1375773113	182	dbSNP
rs1448769338	184	dbSNP
rs1243606405	185	dbSNP
rs959789537	185	dbSNP
rs992292875	185	dbSNP
rs1293327004	186	dbSNP
rs1321757941	189	dbSNP
rs529945522	214	dbSNP
rs1249311879	215	dbSNP
rs1015734515	219	dbSNP
rs1004354899	229	dbSNP
rs1421123736	232	dbSNP
rs1242854728	235	dbSNP
rs774565671	241	dbSNP
rs1185920959	245	dbSNP
rs745616068	247	dbSNP
rs888095264	247	dbSNP
rs1168379372	252	dbSNP
rs559354706	260	dbSNP
rs1027345980	263	dbSNP
rs1356562204	264	dbSNP
rs1466326990	276	dbSNP
rs1331809298	278	dbSNP
rs1454300381	279	dbSNP
rs994579712	282	dbSNP
rs1450397837	283	dbSNP
rs1213522693	284	dbSNP
rs1379782920	284	dbSNP
rs1472549430	284	dbSNP
rs1396382699	285	dbSNP
rs994051042	290	dbSNP
rs1198807418	292	dbSNP
rs1262939245	298	dbSNP
rs1460218930	300	dbSNP
rs1205944834	301	dbSNP
rs897046500	308	dbSNP
rs866424374	312	dbSNP
rs1184917696	315	dbSNP
rs900171894	316	dbSNP
rs1478273767	320	dbSNP
rs1040872203	334	dbSNP
rs1039110434	341	dbSNP
rs1474718050	352	dbSNP
rs141551740	358	dbSNP
rs944604189	360	dbSNP
rs890380407	363	dbSNP
rs1042332545	364	dbSNP
rs943852205	367	dbSNP
rs1341787722	368	dbSNP
rs889901179	368	dbSNP
rs1218882747	370	dbSNP
rs1050258979	375	dbSNP
rs925272637	378	dbSNP
rs978046726	381	dbSNP
rs768795669	383	dbSNP
rs1217030298	386	dbSNP
rs781321579	388	dbSNP
rs1488630585	390	dbSNP
rs945617530	395	dbSNP
rs1427516984	409	dbSNP
rs1481540615	418	dbSNP
rs1174166991	420	dbSNP
rs1425520250	421	dbSNP
rs915113835	434	dbSNP
rs1316069587	445	dbSNP
rs1362352130	447	dbSNP
rs989563837	449	dbSNP
rs1400122918	450	dbSNP
rs1301983662	451	dbSNP
rs1234888053	459	dbSNP
rs1278509958	459	dbSNP
rs541020609	462	dbSNP
rs576962147	466	dbSNP
rs1222585803	467	dbSNP
rs926611845	468	dbSNP
rs982535273	471	dbSNP
rs1212731722	473	dbSNP
rs564952574	479	dbSNP
rs1266851835	484	dbSNP
rs1016240773	486	dbSNP
rs1453543626	489	dbSNP
rs1241826358	494	dbSNP
rs1034129916	496	dbSNP
rs952458564	497	dbSNP
rs1026617913	499	dbSNP
rs755395745	501	dbSNP
rs1382167569	508	dbSNP
rs1420215870	512	dbSNP
rs993766768	515	dbSNP
rs543188354	516	dbSNP
rs1363092323	534	dbSNP
rs983023654	536	dbSNP
rs1019472764	539	dbSNP
rs1008045892	543	dbSNP
rs952873703	545	dbSNP
rs1440519192	547	dbSNP
rs1311915439	549	dbSNP
rs1378372418	562	dbSNP
rs1027146579	569	dbSNP
rs1353360167	574	dbSNP
rs1311844476	581	dbSNP
rs1289717712	587	dbSNP
rs1358493448	590	dbSNP
rs1434959118	593	dbSNP
rs4357739	595	dbSNP
rs1272610224	605	dbSNP
rs1176603470	606	dbSNP
rs1465749679	609	dbSNP
rs1167792157	615	dbSNP
rs900256315	616	dbSNP
rs903902025	627	dbSNP
rs557294349	643	dbSNP
rs1017240658	645	dbSNP
rs945334816	649	dbSNP
rs1008962677	652	dbSNP
rs1163304000	655	dbSNP
rs1395414105	671	dbSNP
rs1407849757	684	dbSNP
rs1333811829	690	dbSNP
rs918195472	700	dbSNP
rs1056716545	703	dbSNP
rs1452571105	704	dbSNP
rs1313614447	708	dbSNP
rs890159082	716	dbSNP
rs1245697998	724	dbSNP
rs1042323318	727	dbSNP
rs1200685709	728	dbSNP
rs926779338	730	dbSNP
rs1458007917	737	dbSNP
rs1194808122	739	dbSNP
rs1055626891	747	dbSNP
rs1254046454	750	dbSNP
rs945316950	761	dbSNP
rs984945542	765	dbSNP
rs1255875921	777	dbSNP
rs1187421721	791	dbSNP
rs893604244	794	dbSNP
rs1053626768	799	dbSNP
rs536105385	812	dbSNP
rs13514	813	dbSNP
rs1371942964	814	dbSNP
rs553298749	822	dbSNP
rs926720300	829	dbSNP
rs982240621	835	dbSNP
rs71899849	838	dbSNP
rs949400071	843	dbSNP
rs534675454	845	dbSNP
rs117241370	849	dbSNP
rs982992721	851	dbSNP
rs952964849	853	dbSNP
rs1019524901	862	dbSNP
rs1279136231	869	dbSNP
rs1323053592	879	dbSNP
rs1332327782	885	dbSNP
rs552604361	904	dbSNP
rs190388246	905	dbSNP
rs964467639	906	dbSNP
rs1017760541	911	dbSNP
rs1028582666	914	dbSNP
rs1195170936	915	dbSNP
rs1000674342	921	dbSNP
rs1479897738	929	dbSNP
rs1008683516	930	dbSNP
rs1174413589	934	dbSNP
rs1379665040	946	dbSNP
rs954525913	953	dbSNP
rs1359161841	954	dbSNP
rs758963587	958	dbSNP
rs1401971647	962	dbSNP
rs1020637148	963	dbSNP
rs557105191	965	dbSNP
rs1403275372	976	dbSNP
rs1042476027	980	dbSNP
rs569782023	982	dbSNP
rs1233670804	991	dbSNP
rs1260111662	1000	dbSNP
rs1351410453	1007	dbSNP
rs1053594868	1011	dbSNP
rs1263203765	1016	dbSNP
rs1490085252	1018	dbSNP
rs1189059460	1020	dbSNP
rs1269939710	1023	dbSNP
rs1171951210	1039	dbSNP
rs1056772077	1041	dbSNP
rs1158796832	1052	dbSNP
rs1467656197	1054	dbSNP
rs1416059358	1056	dbSNP
rs1002429884	1057	dbSNP
rs1422050718	1068	dbSNP
rs905053534	1072	dbSNP
rs1159344366	1074	dbSNP
rs1364970425	1087	dbSNP
rs1164728512	1090	dbSNP
rs1456614681	1092	dbSNP
rs1295551957	1097	dbSNP
rs1424591591	1100	dbSNP
rs1368529201	1101	dbSNP
rs1046908914	1112	dbSNP
rs373652873	1114	dbSNP
rs926868889	1116	dbSNP
rs535628277	1121	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.