miRTarBase - #MIRT463214


—
pre-miRNA Information
pre-miRNA hsa-mir-8055   
Genomic Coordinates chr8: 6622124 - 6622220
Description Homo sapiens miR-8055 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-8055
Sequence 65| CUUUGAGCACAUGAGCAGACGGA |87
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN29106641 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1387051240 1 dbSNP
rs773940954 2 dbSNP
rs1007521391 11 dbSNP
rs1425192922 13 dbSNP
rs1168057456 15 dbSNP
rs79123647 20 dbSNP
rs1049046267 21 dbSNP
rs561312343 22 dbSNP
Putative Targets

Gene Information
Gene Symbol ZNF131   
Synonyms ZBTB35, pHZ-10
Description zinc finger protein 131
Transcript NM_003432   
Expression
Putative miRNA Targets on ZNF131
3'UTR of ZNF131
(miRNA target sites are highlighted)		 
>ZNF131|NM_003432|3'UTR
   1 AATTACACATGAATATATTTTTAAATTTACTTGTTGGGTTTTTGAACTGATTATGGGCAGTTTGACTGTCCTTAATTAAG
  81 CCTAACAGACAAGTGGACCAAAGTTAAGCTGTTTCCTGTTGTGCTGAACTGTTGTCCGTTGAAACACATTGATTCCCCTC
 161 CCCCTACTTATTGCCACAGAGGAGGGATCTTTTCCATAACTGAAGGGGAGTTTTGAGAAGTATATTTCTGGAAACTTAAA
 241 TGGATTATATTCTTATTATATAGTTGGGTACGAATGTATCTATTTTCATTGTGGTAAAAGTTCTTCCTTTTCTCTTTCCC
 321 AGGTCATGTTCTTCCTCAAATTTTTTCCATATTGTAAAATCAAACTTAAATCATTAGAATACAAGTTTATGTATTCTAAT
 401 GCATGTTAGAAAATTGAATAATATAGGAAACACAAGGCTGCATGATGAAAAGTGCATTGTTACTGTGCAGTTAAATTTTG
 481 GCTTCTGGCTTTCTTTAGTTTGAACAAACGTTCTTGTCTACCCCAGTAGTCACAGATGCCATCTTTGCAACAGAAAGAGT
 561 GGTGGTGGCAAAATTTCTAGAATGTTAAAAAAAAAAAAAAATCCACACCCATGTGCCTTCTCAAAACCAACTGAACTTCT
 641 ATAAAGCATCTCTGGTTCTTTCAAAGTTTGTGTTGTAAGGAGCAATGTAGATGATGCTATAATACTTTATATTTTTGGTT
 721 ATAATGACAACCACCAGTTCTTTTTCACTTAAGTTAGGTTGAGAAATTTTATTTAATGGCCACTGAAGGGCCATTTTCAA
 801 TTGGGAAAATTTATTTACATCTGTGGTAAACTTTATTTTGATGAAAAGTTGCACTAGTATTTTACCACCAGATGAGAAAA
 881 AGATGAGCAGCATTTAAAAATTAATGTATTTAAAATAAAGTACAGAGAAAGACATGTATATAATTATCAGGCTTTGTTTT
 961 GAATGGAATCTTTTCCCCCAATTCTTAATGTAAAGATCTTGTGCTATAACTTTTAAAGCCATACAAATAAGAGTGCTAAA
1041 CTGTGGACTTAAAAGTAGGTGTGTAAATATTTTTAATCAGTATTACTTGGAAAATAAAATATAACAAACCCATAGACCAA
1121 TATGCTATTTTTTTTACCTGTTAAATATTGGGAGTTCTTTACATTTTTTAAGTAAACTTTAAAATTATGTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aggCAG-ACGAGUACACGAGUUUc 5'
             ||| ||:|| |   |||||| 
Target 5' cagGTCATGTTCTTC--CTCAAAt 3'
 320 - 341 131.00 -10.80
2 
miRNA  3' agGCAGACGAGUACACGAGUUuc 5'
            :||:| ||  |||||| ||  
Target 5' gcTGTTTCCTGTTGTGCTGAAct 3'
 108 - 130 121.00 -15.10
3 
miRNA  3' aggcagacGAGUAC----ACGAGUUUc 5'
                  | ||||    | |||||| 
Target 5' aatccacaCCCATGTGCCTTCTCAAAa 3'
 600 - 626 121.00 -10.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30184754 3 COSMIC
COSN20075248 25 COSMIC
COSN31610019 28 COSMIC
COSN26823380 38 COSMIC
COSN30493353 42 COSMIC
COSN16932219 49 COSMIC
COSN28800955 135 COSMIC
COSN31593588 248 COSMIC
COSN30164349 313 COSMIC
COSN31517900 373 COSMIC
COSN31521889 427 COSMIC
COSN31542999 486 COSMIC
COSN19728581 510 COSMIC
COSN24872560 534 COSMIC
COSN6511676 603 COSMIC
COSN6297962 804 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760735508 3 dbSNP
rs747997516 8 dbSNP
rs771971738 10 dbSNP
rs542907736 16 dbSNP
rs760655998 20 dbSNP
rs1035383735 25 dbSNP
rs751487607 26 dbSNP
rs770705632 31 dbSNP
rs1293095345 36 dbSNP
rs776784979 38 dbSNP
rs960086184 45 dbSNP
rs9716139 49 dbSNP
rs754829310 51 dbSNP
rs759564011 53 dbSNP
rs1405903387 55 dbSNP
rs1193066612 56 dbSNP
rs983273445 59 dbSNP
rs907717447 61 dbSNP
rs200270135 63 dbSNP
rs371413978 63 dbSNP
rs759152437 63 dbSNP
rs1466612166 65 dbSNP
rs973310325 66 dbSNP
rs1314549994 67 dbSNP
rs778465739 73 dbSNP
rs369323993 80 dbSNP
rs559417404 92 dbSNP
rs79883858 93 dbSNP
rs145346530 94 dbSNP
rs1436958325 108 dbSNP
rs1389133599 110 dbSNP
rs1211366851 119 dbSNP
rs35855029 135 dbSNP
rs1343503377 138 dbSNP
rs564845581 139 dbSNP
rs1052577703 148 dbSNP
rs1192014880 149 dbSNP
rs1194674862 153 dbSNP
rs759703301 158 dbSNP
rs893974826 160 dbSNP
rs1011106618 164 dbSNP
rs745430766 171 dbSNP
rs1023838711 172 dbSNP
rs1168564587 176 dbSNP
rs1277690093 178 dbSNP
rs765527525 182 dbSNP
rs905476125 184 dbSNP
rs1388882033 190 dbSNP
rs753051833 197 dbSNP
rs1035329896 201 dbSNP
rs1436928945 203 dbSNP
rs1374946854 205 dbSNP
rs1171944601 212 dbSNP
rs1431862298 220 dbSNP
rs1391158699 223 dbSNP
rs1170251473 224 dbSNP
rs959792007 225 dbSNP
rs550853000 245 dbSNP
rs1014723914 246 dbSNP
rs1485025908 249 dbSNP
rs752382191 253 dbSNP
rs1206851111 256 dbSNP
rs181538465 257 dbSNP
rs1250525921 260 dbSNP
rs368826800 268 dbSNP
rs1225019114 272 dbSNP
rs1360882738 274 dbSNP
rs1228628965 275 dbSNP
rs1300290223 279 dbSNP
rs1357666370 281 dbSNP
rs551154512 283 dbSNP
rs931902309 288 dbSNP
rs567849739 290 dbSNP
rs1213794075 292 dbSNP
rs1354822339 293 dbSNP
rs1241564170 295 dbSNP
rs1465540580 303 dbSNP
rs14208 304 dbSNP
rs1411876886 306 dbSNP
rs1190703691 309 dbSNP
rs1267116317 312 dbSNP
rs1371450318 318 dbSNP
rs1391802014 318 dbSNP
rs1297855678 319 dbSNP
rs987445635 320 dbSNP
rs1442481241 334 dbSNP
rs536894255 335 dbSNP
rs1475206600 338 dbSNP
rs1414503335 341 dbSNP
rs764504022 342 dbSNP
rs1483160877 343 dbSNP
rs1315645004 352 dbSNP
rs1387212067 356 dbSNP
rs751806460 362 dbSNP
rs137965423 363 dbSNP
rs1380116856 364 dbSNP
rs935396222 371 dbSNP
rs1184235736 375 dbSNP
rs1489304711 376 dbSNP
rs1265813492 379 dbSNP
rs1052941253 380 dbSNP
rs1332652785 386 dbSNP
rs201172885 390 dbSNP
rs1222526930 391 dbSNP
rs1283681597 393 dbSNP
rs1164350365 394 dbSNP
rs753434784 403 dbSNP
rs1210830214 404 dbSNP
rs946866468 410 dbSNP
rs1389895130 419 dbSNP
rs1261787170 424 dbSNP
rs1294547303 425 dbSNP
rs1461357705 426 dbSNP
rs1392966127 428 dbSNP
rs1464009394 431 dbSNP
rs1472604974 436 dbSNP
rs1313459259 442 dbSNP
rs1186161959 464 dbSNP
rs1045235824 475 dbSNP
rs76797695 478 dbSNP
rs1434608267 483 dbSNP
rs1003768680 486 dbSNP
rs1035279221 491 dbSNP
rs557488678 497 dbSNP
rs1177227730 501 dbSNP
rs1466997621 505 dbSNP
rs755664370 510 dbSNP
rs895477930 511 dbSNP
rs1004593189 512 dbSNP
rs1279108702 522 dbSNP
rs1237139034 523 dbSNP
rs1333094201 524 dbSNP
rs1304584199 525 dbSNP
rs1015070638 526 dbSNP
rs1160567803 527 dbSNP
rs1323066357 547 dbSNP
rs1469427618 549 dbSNP
rs577269183 555 dbSNP
rs1383609338 557 dbSNP
rs963189033 564 dbSNP
rs1467235371 571 dbSNP
rs536742615 576 dbSNP
rs1373073996 581 dbSNP
rs1441625584 583 dbSNP
rs1193778322 584 dbSNP
rs1252912778 585 dbSNP
rs1453160409 586 dbSNP
rs1161704388 587 dbSNP
rs1172558373 587 dbSNP
rs1432552399 587 dbSNP
rs386403691 587 dbSNP
rs59888761 587 dbSNP
rs770240391 587 dbSNP
rs1329182815 588 dbSNP
rs1364759175 603 dbSNP
rs1453273066 604 dbSNP
rs1157053173 605 dbSNP
rs1396715897 607 dbSNP
rs1475024544 612 dbSNP
rs1328055472 616 dbSNP
rs1240242205 622 dbSNP
rs1206217971 632 dbSNP
rs1274568758 636 dbSNP
rs72752507 639 dbSNP
rs953239177 642 dbSNP
rs782982 645 dbSNP
rs1210429751 649 dbSNP
rs911848065 653 dbSNP
rs1277182419 655 dbSNP
rs1267086750 656 dbSNP
rs956916985 663 dbSNP
rs1431757813 665 dbSNP
rs1339167256 668 dbSNP
rs1268878252 670 dbSNP
rs988180572 688 dbSNP
rs1355535615 698 dbSNP
rs1184467029 700 dbSNP
rs915296676 706 dbSNP
rs13665 719 dbSNP
rs1409104135 724 dbSNP
rs1157022731 725 dbSNP
rs1396833435 734 dbSNP
rs190257031 739 dbSNP
rs71608693 749 dbSNP
rs869156112 749 dbSNP
rs1292820512 751 dbSNP
rs778585580 751 dbSNP
rs1388530183 763 dbSNP
rs1057108899 764 dbSNP
rs780974775 769 dbSNP
rs1484751209 773 dbSNP
rs1307458496 785 dbSNP
rs1205510983 791 dbSNP
rs1349482490 794 dbSNP
rs573077876 801 dbSNP
rs1294565001 806 dbSNP
rs1158241970 815 dbSNP
rs1212140250 821 dbSNP
rs1336176929 822 dbSNP
rs1292102173 824 dbSNP
rs1230881301 842 dbSNP
rs1351820521 851 dbSNP
rs1279710630 852 dbSNP
rs1441031878 855 dbSNP
rs1352535343 860 dbSNP
rs1325343784 874 dbSNP
rs1461871316 884 dbSNP
rs75951636 885 dbSNP
rs1036042058 889 dbSNP
rs181948445 891 dbSNP
rs994593682 905 dbSNP
rs1177997695 909 dbSNP
rs1487797885 911 dbSNP
rs1197907869 915 dbSNP
rs747137734 918 dbSNP
rs1469871488 922 dbSNP
rs530967794 923 dbSNP
rs752528158 924 dbSNP
rs1028798650 926 dbSNP
rs953185820 936 dbSNP
rs1253067580 939 dbSNP
rs544714387 940 dbSNP
rs1180352622 941 dbSNP
rs1273050055 954 dbSNP
rs534652604 962 dbSNP
rs1330520794 964 dbSNP
rs1284426027 968 dbSNP
rs1019258962 971 dbSNP
rs956676363 975 dbSNP
rs988516874 976 dbSNP
rs1441308958 980 dbSNP
rs1366587855 981 dbSNP
rs915261761 982 dbSNP
rs1458823221 985 dbSNP
rs1159988795 986 dbSNP
rs968065106 986 dbSNP
rs1400310018 988 dbSNP
rs1406016306 990 dbSNP
rs1195755209 996 dbSNP
rs1308408751 999 dbSNP
rs553095690 1003 dbSNP
rs1369764028 1007 dbSNP
rs771017947 1009 dbSNP
rs1192303941 1010 dbSNP
rs187466485 1012 dbSNP
rs1407596849 1025 dbSNP
rs577626169 1029 dbSNP
rs15650 1042 dbSNP
rs1227183712 1046 dbSNP
rs1310027604 1050 dbSNP
rs200356533 1054 dbSNP
rs745541520 1055 dbSNP
rs1275768816 1058 dbSNP
rs908758937 1059 dbSNP
rs1301054564 1061 dbSNP
rs1437167675 1086 dbSNP
rs1482904840 1087 dbSNP
rs1362628514 1088 dbSNP
rs940304083 1090 dbSNP
rs1288251800 1098 dbSNP
rs73751047 1101 dbSNP
rs898842788 1103 dbSNP
rs1175684713 1105 dbSNP
rs1483709912 1106 dbSNP
rs1435640772 1107 dbSNP
rs1181341262 1110 dbSNP
rs1172217381 1113 dbSNP
rs1430779591 1119 dbSNP
rs1017296706 1123 dbSNP
rs201125814 1128 dbSNP
rs994541187 1128 dbSNP
rs901736674 1129 dbSNP
rs1411802731 1130 dbSNP
rs534335149 1132 dbSNP
rs1277891187 1140 dbSNP
rs888890390 1155 dbSNP
rs997442380 1157 dbSNP
rs1389509931 1158 dbSNP
rs1307884578 1162 dbSNP
rs546892062 1170 dbSNP
rs1212738222 1173 dbSNP
rs1359944954 1175 dbSNP
rs1018789800 1178 dbSNP
rs1415605225 1179 dbSNP
rs1375111376 1180 dbSNP
rs1427542604 1184 dbSNP
rs1175291383 1189 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aggcagacGAGUAC----ACGAGUUUc 5'
                  | ||||    | |||||| 
Target 5' -----acaCCCAUGUGCCUUCUCAAAa 3'
 		1 - 22
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000505606.2 | 3UTR | ACACCCAUGUGCCUUCUCAAAACCAACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
192 hsa-miR-8055 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT104178 PHTF2 putative homeodomain transcription factor 2 2 6
MIRT109489 KLHL15 kelch like family member 15 2 2
MIRT138601 HIF1A hypoxia inducible factor 1 alpha subunit 2 2
MIRT207609 COX5B cytochrome c oxidase subunit 5B 2 2
MIRT246311 HIST2H2AA3 histone cluster 2 H2A family member a3 2 4
MIRT246323 HIST2H2AA4 histone cluster 2 H2A family member a4 2 4
MIRT267508 FEN1 flap structure-specific endonuclease 1 2 2
MIRT271002 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT378038 SMAD5 SMAD family member 5 2 4
MIRT442382 CLVS2 clavesin 2 2 2
MIRT443996 METRN meteorin, glial cell differentiation regulator 2 4
MIRT444222 TMEM136 transmembrane protein 136 2 2
MIRT445870 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT463214 ZNF131 zinc finger protein 131 2 2
MIRT464523 UBXN2B UBX domain protein 2B 2 2
MIRT471509 PCGF3 polycomb group ring finger 3 2 6
MIRT474035 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT481566 ARIH2 ariadne RBR E3 ubiquitin protein ligase 2 2 2
MIRT485415 LZIC leucine zipper and CTNNBIP1 domain containing 2 8
MIRT485724 CALM2 calmodulin 2 2 2
MIRT500745 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT502790 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT503164 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT504842 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT506559 MNX1 motor neuron and pancreas homeobox 1 2 4
MIRT511372 IKZF3 IKAROS family zinc finger 3 2 6
MIRT522117 NUDT3 nudix hydrolase 3 2 4
MIRT523755 FBXO27 F-box protein 27 2 4
MIRT525160 PGPEP1 pyroglutamyl-peptidase I 2 4
MIRT537294 FZD5 frizzled class receptor 5 2 2
MIRT537493 FAM168B family with sequence similarity 168 member B 2 2
MIRT538375 CRIM1 cysteine rich transmembrane BMP regulator 1 2 2
MIRT539394 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT544124 PPIL1 peptidylprolyl isomerase like 1 2 2
MIRT547269 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT548034 GOLIM4 golgi integral membrane protein 4 2 2
MIRT551641 CCDC127 coiled-coil domain containing 127 2 2
MIRT552585 ZCCHC9 zinc finger CCHC-type containing 9 2 2
MIRT552605 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT554174 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT556914 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 2
MIRT564288 MED26 mediator complex subunit 26 2 2
MIRT571375 TTPAL alpha tocopherol transfer protein like 2 4
MIRT572009 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT572339 CKAP2L cytoskeleton associated protein 2 like 2 4
MIRT572612 CNTLN centlein 2 2
MIRT572779 ZNF277 zinc finger protein 277 2 2
MIRT573258 DCAF10 DDB1 and CUL4 associated factor 10 2 2
MIRT573353 PDE3A phosphodiesterase 3A 2 4
MIRT573362 MAP2K6 mitogen-activated protein kinase kinase 6 2 2
MIRT574194 LMNB1 lamin B1 2 2
MIRT574453 RPS16 ribosomal protein S16 2 2
MIRT574849 C12orf73 chromosome 12 open reading frame 73 2 2
MIRT575356 Zxda zinc finger, X-linked, duplicated A 2 3
MIRT612192 CCDC77 coiled-coil domain containing 77 2 2
MIRT612974 GGCX gamma-glutamyl carboxylase 2 2
MIRT613749 UNKL unkempt family like zinc finger 2 2
MIRT614085 PDE4C phosphodiesterase 4C 2 2
MIRT614405 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT614441 WDR92 WD repeat domain 92 2 2
MIRT614518 SUB1 SUB1 homolog, transcriptional regulator 2 2
MIRT614653 NIPAL3 NIPA like domain containing 3 2 2
MIRT614720 TEAD3 TEA domain transcription factor 3 2 2
MIRT615556 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT616636 LRAT lecithin retinol acyltransferase 2 4
MIRT617210 CERS4 ceramide synthase 4 2 2
MIRT618934 SF3A3 splicing factor 3a subunit 3 2 2
MIRT619995 C1orf64 steroid receptor associated and regulated protein 2 2
MIRT620819 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT621254 PDZD2 PDZ domain containing 2 2 2
MIRT622307 SETD5 SET domain containing 5 2 2
MIRT623324 MAN1C1 mannosidase alpha class 1C member 1 2 2
MIRT625066 ACSM2A acyl-CoA synthetase medium chain family member 2A 2 2
MIRT625443 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT626182 SRFBP1 serum response factor binding protein 1 2 2
MIRT626701 TRIM65 tripartite motif containing 65 2 2
MIRT628925 TBRG4 transforming growth factor beta regulator 4 2 2
MIRT630883 SLC25A33 solute carrier family 25 member 33 2 2
MIRT631653 BRI3BP BRI3 binding protein 2 2
MIRT631696 C1QTNF6 C1q and TNF related 6 2 2
MIRT632864 GSPT1 G1 to S phase transition 1 2 2
MIRT635185 NFKBID NFKB inhibitor delta 2 2
MIRT636917 ZNF845 zinc finger protein 845 2 2
MIRT637048 RAB27A RAB27A, member RAS oncogene family 2 2
MIRT637599 ZNF554 zinc finger protein 554 2 2
MIRT638204 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT638839 CPE carboxypeptidase E 2 2
MIRT639005 ACO1 aconitase 1 2 2
MIRT640894 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT641402 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT642083 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT643179 HYPK huntingtin interacting protein K 2 2
MIRT644205 CBS cystathionine-beta-synthase 2 2
MIRT645453 ANKS6 ankyrin repeat and sterile alpha motif domain containing 6 2 2
MIRT645797 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT645960 TTF2 transcription termination factor 2 2 2
MIRT646334 CLIC6 chloride intracellular channel 6 2 2
MIRT646484 APBB3 amyloid beta precursor protein binding family B member 3 2 2
MIRT646611 SMOC2 SPARC related modular calcium binding 2 2 2
MIRT649392 SH2D4A SH2 domain containing 4A 2 2
MIRT650540 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT650679 CD82 CD82 molecule 2 2
MIRT652118 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT652588 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654807 PPT1 palmitoyl-protein thioesterase 1 2 2
MIRT655318 PCYOX1 prenylcysteine oxidase 1 2 2
MIRT655411 PAN2 PAN2 poly(A) specific ribonuclease subunit 2 2
MIRT659671 CD86 CD86 molecule 2 2
MIRT660190 BMPR1A bone morphogenetic protein receptor type 1A 2 2
MIRT660883 ADCYAP1R1 ADCYAP receptor type I 2 2
MIRT661695 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT661765 BIVM basic, immunoglobulin-like variable motif containing 2 2
MIRT662787 TBC1D25 TBC1 domain family member 25 2 2
MIRT663733 ZNF285 zinc finger protein 285 2 2
MIRT663787 DDX53 DEAD-box helicase 53 2 2
MIRT664663 IMPA2 inositol monophosphatase 2 2 2
MIRT665702 TMX4 thioredoxin related transmembrane protein 4 2 2
MIRT667444 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT667946 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 2
MIRT668776 DAAM1 dishevelled associated activator of morphogenesis 1 2 4
MIRT669824 ISCA2 iron-sulfur cluster assembly 2 2 2
MIRT670398 ZXDA zinc finger, X-linked, duplicated A 2 3
MIRT670402 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT671112 ZNF573 zinc finger protein 573 2 2
MIRT671129 CD226 CD226 molecule 2 2
MIRT671145 ANKRD9 ankyrin repeat domain 9 2 2
MIRT671315 ACTR1A ARP1 actin related protein 1 homolog A 2 2
MIRT671329 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT671857 ZNF429 zinc finger protein 429 2 2
MIRT672009 PXMP4 peroxisomal membrane protein 4 2 2
MIRT672054 KIAA0930 KIAA0930 2 2
MIRT672466 RTTN rotatin 2 2
MIRT672642 SLC25A16 solute carrier family 25 member 16 2 4
MIRT672660 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT672755 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT672839 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT672917 LRRC2 leucine rich repeat containing 2 2 2
MIRT672983 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT673051 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT673078 AK1 adenylate kinase 1 2 2
MIRT673143 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT673303 UBE2G2 ubiquitin conjugating enzyme E2 G2 2 2
MIRT673319 THAP1 THAP domain containing 1 2 2
MIRT673339 SLC35F6 solute carrier family 35 member F6 2 2
MIRT673554 PLA2G16 phospholipase A2 group XVI 2 2
MIRT673656 ZNF440 zinc finger protein 440 2 2
MIRT673693 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT673720 EMCN endomucin 2 2
MIRT673840 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT673869 KLF2 Kruppel like factor 2 2 2
MIRT673888 DCTN6 dynactin subunit 6 2 2
MIRT674180 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT674579 SLC35B4 solute carrier family 35 member B4 2 2
MIRT674604 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT674737 SLC16A1 solute carrier family 16 member 1 2 2
MIRT674824 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 2 2
MIRT674993 STRN3 striatin 3 2 2
MIRT675058 FGD6 FYVE, RhoGEF and PH domain containing 6 2 2
MIRT675072 CCR6 C-C motif chemokine receptor 6 2 2
MIRT675116 FSD2 fibronectin type III and SPRY domain containing 2 2 2
MIRT675158 YARS2 tyrosyl-tRNA synthetase 2 2 2
MIRT675254 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT675434 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT675687 PIWIL1 piwi like RNA-mediated gene silencing 1 2 2
MIRT675772 YIPF4 Yip1 domain family member 4 2 2
MIRT675883 SNAP29 synaptosome associated protein 29 2 2
MIRT677923 SLC35E1 solute carrier family 35 member E1 2 2
MIRT678991 MBD1 methyl-CpG binding domain protein 1 2 2
MIRT679010 MTMR10 myotubularin related protein 10 2 2
MIRT679024 ZNF419 zinc finger protein 419 2 2
MIRT679392 IL10RB interleukin 10 receptor subunit beta 2 2
MIRT679407 GMCL1 germ cell-less, spermatogenesis associated 1 2 2
MIRT683745 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT689266 ZNF99 zinc finger protein 99 2 2
MIRT690502 MDM2 MDM2 proto-oncogene 2 2
MIRT700939 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT702073 PCDHB11 protocadherin beta 11 2 2
MIRT705020 CALU calumenin 2 2
MIRT706196 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706253 MKLN1 muskelin 1 2 2
MIRT706540 GJD2 gap junction protein delta 2 2 2
MIRT707358 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT707407 RRP7A ribosomal RNA processing 7 homolog A 2 2
MIRT710638 GLUL glutamate-ammonia ligase 2 2
MIRT714213 C10orf71 chromosome 10 open reading frame 71 2 2
MIRT715646 USP6NL USP6 N-terminal like 2 2
MIRT717751 KCNRG potassium channel regulator 2 2
MIRT720793 GCH1 GTP cyclohydrolase 1 2 2
MIRT722254 POLQ DNA polymerase theta 2 2
MIRT723765 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT724965 TNS1 tensin 1 2 2
MIRT736568 TP53INP1 tumor protein p53 inducible nuclear protein 1 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-8055 Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)

Error report submission