miRTarBase - #MIRT463409


—
pre-miRNA Information
pre-miRNA hsa-mir-4316   
Genomic Coordinates chr17: 77396984 - 77397054
Description Homo sapiens miR-4316 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4316
Sequence 11| GGUGAGGCUAGCUGGUG |27
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs989002279 5 dbSNP
rs957742923 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZC3HAV1L   
Synonyms C7orf39
Description zinc finger CCCH-type containing, antiviral 1 like
Transcript NM_080660   
Expression
Putative miRNA Targets on ZC3HAV1L
3'UTR of ZC3HAV1L
(miRNA target sites are highlighted)		 
>ZC3HAV1L|NM_080660|3'UTR
   1 AGAAGATGGAAAAGGAGAAAATGTCCTTTTGGAAGAATACATTTGGGCATGGGTGGTTGGGGATGGGGTGGGACATTGAA
  81 CAGGCAAAGAGAGGCTAAAATTGAGTGCAGATGGGGCTAGTCCAGGGCAAGTGCTGAAGATGGCAGCTGCTATCTGCAGC
 161 TCCTAGGTGCTTTCCTCAGGCTGGGTAGATGGAGCTCTGCTGACTTCTGTGGTCCACCATTGTTTTTCTATCAATTTATA
 241 TTGTGGCAATCCTAGAGTACTTTGCACTCATTTTTTTTTTTCACTTAATATTGTCTCATAAGCATCTTTCTATATTTGTT
 321 CACATCGTACATAATCATGTTTTTGCACAGATACATTAATATTATCATAGTTTGTTTAACTACTTGGCTTTTTCTAACAG
 401 TTTTTTTTTTTGAGATGGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGACGTGATCTCGGCTCACTGCAGCCTTGACT
 481 TCCTGGGCTCAAGTGATCATCCCACCTCAGCCTCCTGAGTAGCTGGGACTACAGGTATGCACCACGACCAGCTAATTTTT
 561 TGTATTTTTTTTTTGTAGAGAGGGTATTTTGCCATGTTGCCCAGGCTAGTCTTGAACTCCTGGGCTCAAGCGATCTGCCT
 641 GCTTCAGCCTCCCAGAGTGCTAGGATTACAGGCATGAGCCACTGCACCCAGCCTCTTAACAAATTTTGAATATAACTCCT
 721 GTCTTAAAATCTGCAGAATATTGAATTTTTCCAGCTATTTTTTACTTTTGCTTAGCTTATAGATGCTAAAGGATACTGTC
 801 ATTTGCATTTTTAAAAATATATGTATGAGTGAATAGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
 881 AAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guGGUCGA--UCGGAGUGg 5'
            || |||  |||||| | 
Target 5' tgCCTGCTTCAGCCTCCCa 3'
 636 - 654 125.00 -18.90
2 
miRNA  3' guGGUCGA-UCGGAGugg 5'
            ||| || ||||||   
Target 5' tcCCACCTCAGCCTCctg 3'
 500 - 517 119.00 -13.70
3 
miRNA  3' guggUCGAUCGGAGUGg 5'
              | || | ||||| 
Target 5' cgtgATCTCGGCTCACt 3'
 452 - 468 117.00 -8.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30510389 21 COSMIC
COSN19121951 25 COSMIC
COSN27005549 27 COSMIC
COSN27005550 27 COSMIC
COSN27005551 56 COSMIC
COSN30537309 72 COSMIC
COSN27005552 78 COSMIC
COSN30527012 192 COSMIC
COSN20104862 270 COSMIC
COSN27589700 271 COSMIC
COSN28490554 564 COSMIC
COSN6353940 586 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1376637662 1 dbSNP
rs947907641 7 dbSNP
rs765419069 11 dbSNP
rs1336542248 14 dbSNP
rs781634462 17 dbSNP
rs759784808 20 dbSNP
rs111891533 31 dbSNP
rs894983722 37 dbSNP
rs556361392 41 dbSNP
rs771009734 43 dbSNP
rs115015323 44 dbSNP
rs1180234812 45 dbSNP
rs773656153 48 dbSNP
rs939267774 49 dbSNP
rs1245749767 51 dbSNP
rs532924358 56 dbSNP
rs867239563 63 dbSNP
rs150537133 68 dbSNP
rs923835216 81 dbSNP
rs977813485 84 dbSNP
rs77941163 86 dbSNP
rs915034411 90 dbSNP
rs115752120 94 dbSNP
rs1400454685 103 dbSNP
rs1370434817 104 dbSNP
rs953760331 105 dbSNP
rs1029131696 110 dbSNP
rs141661116 116 dbSNP
rs1227927738 126 dbSNP
rs112444031 127 dbSNP
rs1015580898 131 dbSNP
rs551368712 136 dbSNP
rs946719068 137 dbSNP
rs1467678895 145 dbSNP
rs1192250748 164 dbSNP
rs1264515397 177 dbSNP
rs1429412112 178 dbSNP
rs1409835306 193 dbSNP
rs1371757622 208 dbSNP
rs913879425 214 dbSNP
rs1165978954 215 dbSNP
rs189911848 216 dbSNP
rs550650377 228 dbSNP
rs939425157 229 dbSNP
rs1027619024 230 dbSNP
rs1012346505 231 dbSNP
rs757123559 233 dbSNP
rs928510353 234 dbSNP
rs767975062 239 dbSNP
rs1294570607 257 dbSNP
rs1338194753 263 dbSNP
rs562662249 265 dbSNP
rs1234722320 266 dbSNP
rs1257038935 266 dbSNP
rs542739746 267 dbSNP
rs1484374515 270 dbSNP
rs1238069907 271 dbSNP
rs76876234 271 dbSNP
rs1188866842 282 dbSNP
rs1486470190 282 dbSNP
rs369793399 282 dbSNP
rs879880075 282 dbSNP
rs969831772 283 dbSNP
rs1474228980 290 dbSNP
rs1161394535 299 dbSNP
rs1056334824 300 dbSNP
rs1023318672 301 dbSNP
rs939153378 303 dbSNP
rs1259978273 310 dbSNP
rs1358337816 310 dbSNP
rs1293451817 321 dbSNP
rs902460859 327 dbSNP
rs76416666 329 dbSNP
rs560777662 330 dbSNP
rs374018128 337 dbSNP
rs137891636 339 dbSNP
rs185983316 346 dbSNP
rs932422466 352 dbSNP
rs145210962 353 dbSNP
rs1212050476 355 dbSNP
rs1257007727 365 dbSNP
rs1484807395 369 dbSNP
rs1179243930 370 dbSNP
rs1408777709 372 dbSNP
rs10265929 387 dbSNP
rs1158235908 389 dbSNP
rs1439467323 392 dbSNP
rs576179189 401 dbSNP
rs1173503491 402 dbSNP
rs908157689 408 dbSNP
rs1044387918 412 dbSNP
rs1445314107 412 dbSNP
rs373451520 412 dbSNP
rs899968505 412 dbSNP
rs1299580550 414 dbSNP
rs1011139231 422 dbSNP
rs1390350626 423 dbSNP
rs984113653 427 dbSNP
rs1417536550 428 dbSNP
rs1163141826 431 dbSNP
rs1235745247 436 dbSNP
rs1280060855 437 dbSNP
rs952296622 439 dbSNP
rs1027674781 440 dbSNP
rs1310855396 443 dbSNP
rs866135024 443 dbSNP
rs1012235252 447 dbSNP
rs1257206423 452 dbSNP
rs1176672961 453 dbSNP
rs1052384325 456 dbSNP
rs1456537626 458 dbSNP
rs777541847 460 dbSNP
rs959472076 465 dbSNP
rs111743133 469 dbSNP
rs1412570667 472 dbSNP
rs1270974400 483 dbSNP
rs1354760857 485 dbSNP
rs1440757787 485 dbSNP
rs143088993 487 dbSNP
rs1442245259 501 dbSNP
rs902345072 503 dbSNP
rs1303339496 507 dbSNP
rs1365878201 510 dbSNP
rs1045099913 523 dbSNP
rs1273906769 525 dbSNP
rs948580518 532 dbSNP
rs1197054772 535 dbSNP
rs1275090104 536 dbSNP
rs915729916 537 dbSNP
rs112290712 542 dbSNP
rs1246089521 543 dbSNP
rs1476882680 545 dbSNP
rs536005983 546 dbSNP
rs1188065990 550 dbSNP
rs1420037245 551 dbSNP
rs1409008177 562 dbSNP
rs1168148203 564 dbSNP
rs77991415 565 dbSNP
rs1011251016 567 dbSNP
rs1461535500 568 dbSNP
rs1325740310 570 dbSNP
rs565459142 571 dbSNP
rs1433566444 575 dbSNP
rs893702696 575 dbSNP
rs962653088 575 dbSNP
rs1221544232 577 dbSNP
rs547042386 580 dbSNP
rs1295376366 592 dbSNP
rs1335509444 594 dbSNP
rs1213151607 595 dbSNP
rs769430504 596 dbSNP
rs1449781384 601 dbSNP
rs1217949207 603 dbSNP
rs1242457124 614 dbSNP
rs192029353 616 dbSNP
rs1419575911 617 dbSNP
rs1475215648 619 dbSNP
rs1390117542 620 dbSNP
rs112889923 622 dbSNP
rs1405041979 623 dbSNP
rs1388033018 624 dbSNP
rs1292145802 625 dbSNP
rs1402919119 631 dbSNP
rs1319610398 632 dbSNP
rs1459818533 635 dbSNP
rs1398575103 636 dbSNP
rs1314930002 641 dbSNP
rs1040768986 642 dbSNP
rs113856201 650 dbSNP
rs35318154 669 dbSNP
rs1282500710 671 dbSNP
rs1352988270 672 dbSNP
rs1225377646 691 dbSNP
rs908044388 693 dbSNP
rs768762390 702 dbSNP
rs1158699145 703 dbSNP
rs746889256 718 dbSNP
rs952420993 719 dbSNP
rs779966544 725 dbSNP
rs1366178294 726 dbSNP
rs754470649 745 dbSNP
rs537825870 755 dbSNP
rs115731935 758 dbSNP
rs549056439 762 dbSNP
rs906521852 764 dbSNP
rs1265255670 768 dbSNP
rs1211392422 770 dbSNP
rs1175903548 776 dbSNP
rs1376519152 783 dbSNP
rs1414370216 788 dbSNP
rs1337563180 795 dbSNP
rs959356426 800 dbSNP
rs116354985 813 dbSNP
rs1213950730 819 dbSNP
rs1352878081 823 dbSNP
rs1237948704 829 dbSNP
rs980289644 831 dbSNP
rs1348383257 836 dbSNP
rs187276264 839 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guggucgaucGGAGUGg 5'
                    |||||| 
Target 5' cuucuuccuaCCUCACa 3'
 		7 - 23
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000275766.1 | 3UTR | CCAUUCCUUCUUCCUACCUCACAACCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
74 hsa-miR-4316 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT080624 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT095088 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT123331 CALU calumenin 2 2
MIRT154964 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT370850 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT442955 SGCD sarcoglycan delta 2 2
MIRT448240 ZNF774 zinc finger protein 774 2 2
MIRT451710 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT452072 ATP6V0B ATPase H+ transporting V0 subunit b 2 2
MIRT455665 GLO1 glyoxalase I 2 2
MIRT460354 TXNDC16 thioredoxin domain containing 16 2 2
MIRT461908 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT462047 HOXC13 homeobox C13 2 2
MIRT462735 EFNB1 ephrin B1 2 2
MIRT463409 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT464952 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT465052 TSR1 TSR1, ribosome maturation factor 2 2
MIRT467549 SMARCD1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 2 4
MIRT470226 PRRC2A proline rich coiled-coil 2A 2 2
MIRT474081 LMBR1L limb development membrane protein 1 like 2 2
MIRT474481 KLHDC8B kelch domain containing 8B 2 2
MIRT474704 KIF3A kinesin family member 3A 2 2
MIRT474897 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT475203 IL2RB interleukin 2 receptor subunit beta 2 2
MIRT477664 EFHD2 EF-hand domain family member D2 2 2
MIRT477775 E2F3 E2F transcription factor 3 2 2
MIRT477940 DPM2 dolichyl-phosphate mannosyltransferase subunit 2, regulatory 2 2
MIRT478224 DDX52 DExD-box helicase 52 2 2
MIRT479904 CCDC117 coiled-coil domain containing 117 2 2
MIRT480639 BSCL2 BSCL2, seipin lipid droplet biogenesis associated 2 2
MIRT482435 ADM adrenomedullin 2 10
MIRT483908 GNB1L G protein subunit beta 1 like 2 2
MIRT484161 FAM71B family with sequence similarity 71 member B 2 2
MIRT484405 SNX19 sorting nexin 19 2 2
MIRT485426 LASP1 LIM and SH3 protein 1 2 2
MIRT489788 KRT80 keratin 80 2 4
MIRT490813 ASB1 ankyrin repeat and SOCS box containing 1 2 4
MIRT491176 LAMA5 laminin subunit alpha 5 2 2
MIRT491573 HSDL1 hydroxysteroid dehydrogenase like 1 2 2
MIRT492633 PLXNA1 plexin A1 2 2
MIRT492984 NAV1 neuron navigator 1 2 2
MIRT496441 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501829 NCOA3 nuclear receptor coactivator 3 2 2
MIRT502165 KIAA0195 transmembrane protein 94 2 2
MIRT508652 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT509554 ACTG1 actin gamma 1 2 4
MIRT520033 YOD1 YOD1 deubiquitinase 2 6
MIRT523969 DVL3 dishevelled segment polarity protein 3 2 2
MIRT526150 KIAA1456 KIAA1456 2 2
MIRT530330 ARHGAP1 Rho GTPase activating protein 1 2 2
MIRT539985 SLC24A4 solute carrier family 24 member 4 2 4
MIRT540851 NUP155 nucleoporin 155 2 2
MIRT542326 LIMD1 LIM domains containing 1 2 2
MIRT558908 CBX5 chromobox 5 2 2
MIRT563663 SMC4 structural maintenance of chromosomes 4 2 2
MIRT565433 SURF4 surfeit 4 2 2
MIRT567773 DGAT2 diacylglycerol O-acyltransferase 2 2 2
MIRT615573 NCS1 neuronal calcium sensor 1 2 2
MIRT627336 TTLL7 tubulin tyrosine ligase like 7 2 2
MIRT632965 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT634307 SNTN sentan, cilia apical structure protein 2 2
MIRT641569 RAX retina and anterior neural fold homeobox 2 2
MIRT660509 ARL5A ADP ribosylation factor like GTPase 5A 2 2
MIRT662703 C10orf111 chromosome 10 open reading frame 111 2 4
MIRT663214 ZNF277 zinc finger protein 277 2 2
MIRT665318 YIPF4 Yip1 domain family member 4 2 2
MIRT695264 CD209 CD209 molecule 2 2
MIRT696231 LIN9 lin-9 DREAM MuvB core complex component 2 2
MIRT698867 SRPR SRP receptor alpha subunit 2 2
MIRT702700 IPO9 importin 9 2 2
MIRT704236 DHDDS dehydrodolichyl diphosphate synthase subunit 2 2
MIRT704935 CCDC120 coiled-coil domain containing 120 2 2
MIRT724285 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT735579 VEGFA vascular endothelial growth factor A 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4316 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-miR-4316 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4316 Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission