miRTarBase - #MIRT464031


—
pre-miRNA Information
pre-miRNA hsa-mir-379   
Genomic Coordinates chr14: 101022066 - 101022132
Synonyms MIRN379, hsa-mir-379, MIR379
Description Homo sapiens miR-379 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-379-5p
Sequence 6| UGGUAGACUAUGGAACGUAGG |26
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 14 + 101022075 16594986, 18684997, 21912681, 22499667, 24964909, 25692236, 26449202, 27229138, 28411194, 28550310, 29267965, 20591823, 27587585, 30022565, 29976955, 31682236, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1316049475 1 dbSNP
rs775428399 3 dbSNP
rs61991156 7 dbSNP
rs748621194 16 dbSNP
rs72631818 17 dbSNP
rs750490770 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol WASL   
Synonyms N-WASP, NWASP, WASPB
Description Wiskott-Aldrich syndrome like
Transcript NM_003941   
Expression
Putative miRNA Targets on WASL
3'UTR of WASL
(miRNA target sites are highlighted)		 
>WASL|NM_003941|3'UTR
   1 TCTATATATTATATATATATATATATTTTTAAGGTGAAATACTAAACACTACTTTCTGTCTGTGGATTCTGTAAAATTAT
  81 CATGTAAATGTTCTACCAATTTGCTGTATATTTTTGTTGCCTTTTTTGCTTTTTTTTAATCTGTGCAATACCTCATTTAA
 161 TCTGTAAAGGTTTGTCGTAATCCTCTACAAAGCTACTCCCTGTTATTGTGTGCAAGTTTACACCAGGATGCTCACTTGAT
 241 TTGTGAATATTTTTCATTCCATCAACAAGGGAGTTTAAATACTATATGTGAGACTGACAAAAACCTTAATGTAATTTACT
 321 TATAATGCCAGAAGGAAAACACTATTTTCATACCCTACTTTTTCTGTACCTAAATTTTCTTAAAAAAAAATCTAGTATAG
 401 CACTACATTCTTTTTTAAGTGATGCAGACCTTAGTTTCTTTAGCCCCTTTATTTTGAATACAATGCTACATATGAATGTT
 481 GAAGCTGATACATTGCACAGTTCTGTAGACATCACTACACCGATGTAGTTTCTCAAATTTTAGCAATATGCTCTACATAA
 561 AATCACTACAGAGATACTAGTGGGGAAGACGATTAACACACCTCTTACAGTAATACTGCCTGTTATTGGTATAGCAGTGG
 641 TATTTGCAGACTGGGATCATAAGGAGCCCTTAAATACTTGTTATTGACTGGGGTTATTTTTATGCTGTAGCAAATGTGAC
 721 AGGCTCTTTTTAGCAAAATTTTTGAAAATTTTTTTGGTATTACTCTGAAACAAAATTTAAGTTGGAGTTTCAGGGATTTA
 801 GGGAGTAGTTTTCATTCTACATGAACTGAGGTAATATTATGGTAACTCCAATATTTGGTTAAAAAAACTATACAAATCAG
 881 AATAGTACTAAAATACTGTAGAATTTTAGCATTTTTATTTTGCACTTTGTGTGGATTGAGGTGTTCAGAAATACCAACCA
 961 TAAAAATGTAATCTAGTTGGCAAAGGTGTGCGCTAAAACACGGAACCGAACATGCATTGATTTGGATAACTTTTGAGGGT
1041 TTTTGTCAAATAGCATGTGAAGAGTTACATTTTTCTTAAAAGATTGGTGGTCCCAATGTCAGAGTTCTTGGAACAGATAA
1121 CTGAATGATAGATTTTTTTTTTTTAAAGATAAAACTTTACAACCTGCACATTTGTTATGCATACTAAATGGTGTGTTAAA
1201 ATTAGGGTTTCTTTGCCTCTCTACACTACACTAATCTGCCTAAAGGTGGTTGTTTCATATTTATAATGCTAATTATCATA
1281 CCTACCTACTTTAAATTTTAGGTAGAAAATTATCTGATTTAAATACAAACATATTTTTCTCACATTGAGTAATATGCATA
1361 ATGTAGTTCCAAATGTATTTCATTACTATAGTCACAATATCCAACTAAAAATTACGCTATCTAGAATTGTACCAACCAAA
1441 ATCTCGTATTGGCAGATCTTGACAGGCTGGACCTGCAAGATGTGGCTTGAATTTTAACCATTTATTACATAATCTCTAGT
1521 GATCATGCATCTAGTTATCATAAGAAATAATTTAAAAGGTTTTGTTGCTGAAAGCAGTAAGTGGTGCAGTAAAATACTTA
1601 AGTTATTCAAAGAATGTTATCTTTCTTGCAAGAGTAATTTAAGCACATGGGAAAGATTCTAGACTTTTTGTTTCTTGCAA
1681 CAACAGTGCCCTCTGCTGCTAGAAACCTTTTTCTACTTACTATCATTTTTATTGTGGCTTGAGCTCAGTCAATCTGGTGC
1761 AGATGAGGCTGGACAACTACTAACCAATAAAATCAGGAGTTTGTACAAAAGTTAAATGGAACATTATAATTATTTTAAGT
1841 AATGTTAATTGAAAAAATTTTTTCTTTTTGACAATATAAAAAACATTTTAAATTTCCTAGAAATGTCTTCAGGGTAATGC
1921 CAATTTAAGATCTCTCTTAACTTGTGGCCAAGAAATTCTAGATTTTCCAGCTGACTTTGGTATAATATATATTTATCAGG
2001 AACTTCTCTCAGCAGAGAGTACCCATTCTTCGAGTTCAAAGCACAATTTTAAACATGTAAAATGGATATATAATTTGCCA
2081 AAGGTAATTAATTTATTCTTTTTTTCTTAAAGAAGAAAAAGACATTGGTTGTTGTTACAAAAAGTCTAAATTACTGTTGG
2161 TTGAAACACAGCAGCTGTGGAGTTCAGTCCAGGCATGAAGACTAAATCTGCTTTACCAAGTAAGGTGTAAGGTTGCATGT
2241 TTCAGTCCTCTACCATCCTGCACTGTGAGCAGCACTATACCTGTGCGTTGTCTGAAAGCCTTCCGTATATTCTCCAGCTA
2321 AATGGTCGTCTGGTAGCCTTTGCATTTAACAAACTAGCATGAGGCTTTTTATATCTAAATGCTACGTGATAGACAATTTC
2401 AGCTAGCCACATATTGTATGTATGAGATTCATAAAGACTTTCAATCATTTCATTTTCAGACAACTGAAATTTTGTTTAGT
2481 ATGTGAATTCTTTTTTTGAAATGTATAGTGAATAGGATGTTGCACTGGTGGCAATTCATCATGGAGCATAATAAAATTAA
2561 TTTGACCCAAATAGAATAAAATAATGTGTTTC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggaUGCAAGGU-AUCAGAUGGu 5'
             |:|||:|| |  |||||| 
Target 5' tgcATGTTTCAGTCCTCTACCa 3'
 2234 - 2255 134.00 -16.70
2 
miRNA  3' ggaUGCAAGGUAUCAGAUGGu 5'
             |:| |  ||: |||||| 
Target 5' atcATG-TAAATGTTCTACCa 3'
 79 - 98 121.00 -12.70
3 
miRNA  3' ggAU-GCA-AGGUAUCAGAUGgu 5'
            || :|| | || |||:|||  
Target 5' gtTATTGTGTGCA-AGTTTACac 3'
 202 - 223 118.00 -11.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN18719185 10 COSMIC
COSN26960751 10 COSMIC
COSN18719183 11 COSMIC
COSN30115645 27 COSMIC
COSN6348643 76 COSMIC
COSN30449700 81 COSMIC
COSN31495940 81 COSMIC
COSN30491718 97 COSMIC
COSN26552631 120 COSMIC
COSN31531339 121 COSMIC
COSN27004811 129 COSMIC
COSN18732019 130 COSMIC
COSN27004810 137 COSMIC
COSN30469932 167 COSMIC
COSN31487020 238 COSMIC
COSN18719182 265 COSMIC
COSN24989305 358 COSMIC
COSN6348642 476 COSMIC
COSN21366362 482 COSMIC
COSN28977471 1132 COSMIC
COSN9921686 1183 COSMIC
COSN23296207 2053 COSMIC
COSN6348641 2308 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1382524182 2 dbSNP
rs371404957 4 dbSNP
rs1300943204 6 dbSNP
rs1465164900 8 dbSNP
rs1375505436 9 dbSNP
rs201860827 10 dbSNP
rs200858194 11 dbSNP
rs3034923 13 dbSNP
rs975823718 13 dbSNP
rs1427391226 14 dbSNP
rs776725305 15 dbSNP
rs766372952 17 dbSNP
rs528013016 18 dbSNP
rs772822525 19 dbSNP
rs771676427 21 dbSNP
rs751093113 22 dbSNP
rs1460882968 23 dbSNP
rs763894667 24 dbSNP
rs747829927 25 dbSNP
rs762690383 26 dbSNP
rs36091907 27 dbSNP
rs552754946 27 dbSNP
rs555423312 27 dbSNP
rs55817638 27 dbSNP
rs564174505 27 dbSNP
rs5887151 27 dbSNP
rs775430217 27 dbSNP
rs1275544874 29 dbSNP
rs776588318 31 dbSNP
rs1227891428 33 dbSNP
rs185176239 44 dbSNP
rs1035875556 47 dbSNP
rs770740362 50 dbSNP
rs770207097 51 dbSNP
rs200077672 56 dbSNP
rs1250675225 64 dbSNP
rs1408052685 65 dbSNP
rs202087929 75 dbSNP
rs1159999120 78 dbSNP
rs1044287292 79 dbSNP
rs1277941935 80 dbSNP
rs1485439257 83 dbSNP
rs1188960160 84 dbSNP
rs771619446 95 dbSNP
rs543500893 105 dbSNP
rs1426791109 111 dbSNP
rs947289793 116 dbSNP
rs1432178398 121 dbSNP
rs1172103701 128 dbSNP
rs893098260 137 dbSNP
rs1056260849 138 dbSNP
rs1435767967 138 dbSNP
rs1003580470 142 dbSNP
rs1380021119 144 dbSNP
rs182751703 147 dbSNP
rs1479192850 148 dbSNP
rs935350727 152 dbSNP
rs1230549076 154 dbSNP
rs1300935078 164 dbSNP
rs1245396602 166 dbSNP
rs924032824 176 dbSNP
rs987980754 177 dbSNP
rs1485055899 185 dbSNP
rs150676186 186 dbSNP
rs190149222 187 dbSNP
rs1451831736 190 dbSNP
rs1052689705 192 dbSNP
rs1353104637 194 dbSNP
rs1395059966 198 dbSNP
rs922765050 200 dbSNP
rs1360464327 202 dbSNP
rs922100382 205 dbSNP
rs139339597 206 dbSNP
rs1369432646 215 dbSNP
rs543223036 220 dbSNP
rs187100563 222 dbSNP
rs1016503854 227 dbSNP
rs1435663509 228 dbSNP
rs1301131679 235 dbSNP
rs1370234091 243 dbSNP
rs983066247 265 dbSNP
rs950410324 268 dbSNP
rs1303144906 271 dbSNP
rs778444906 273 dbSNP
rs1315297373 277 dbSNP
rs1238635525 284 dbSNP
rs1003045029 286 dbSNP
rs533175443 295 dbSNP
rs181689874 300 dbSNP
rs1299991883 309 dbSNP
rs1211961455 310 dbSNP
rs1252912932 318 dbSNP
rs768212876 322 dbSNP
rs76044696 325 dbSNP
rs144877608 335 dbSNP
rs1406269707 347 dbSNP
rs1011450152 353 dbSNP
rs1157877324 359 dbSNP
rs564155187 362 dbSNP
rs971999177 373 dbSNP
rs1323389945 374 dbSNP
rs1393560202 379 dbSNP
rs962310401 382 dbSNP
rs1415878708 383 dbSNP
rs781744464 384 dbSNP
rs999504842 386 dbSNP
rs1423501604 389 dbSNP
rs1003344513 390 dbSNP
rs138928779 391 dbSNP
rs199935466 391 dbSNP
rs905261983 391 dbSNP
rs1190909184 392 dbSNP
rs1322795090 394 dbSNP
rs902526966 397 dbSNP
rs1475954314 401 dbSNP
rs61387239 406 dbSNP
rs1011435805 408 dbSNP
rs190813937 412 dbSNP
rs1281189221 417 dbSNP
rs1162104039 420 dbSNP
rs572049530 428 dbSNP
rs1416561521 429 dbSNP
rs933401980 430 dbSNP
rs922077155 439 dbSNP
rs1039167730 446 dbSNP
rs763405767 462 dbSNP
rs942232059 463 dbSNP
rs1352746280 467 dbSNP
rs554940170 468 dbSNP
rs909449135 470 dbSNP
rs1052901873 474 dbSNP
rs1352495050 486 dbSNP
rs1413191352 487 dbSNP
rs935556406 488 dbSNP
rs1278188296 490 dbSNP
rs983686231 493 dbSNP
rs1218364034 497 dbSNP
rs950380610 500 dbSNP
rs58071570 503 dbSNP
rs942866849 521 dbSNP
rs981170220 522 dbSNP
rs543056991 524 dbSNP
rs1339263338 529 dbSNP
rs768914160 535 dbSNP
rs1183161881 536 dbSNP
rs970204842 537 dbSNP
rs751838941 539 dbSNP
rs1429039784 545 dbSNP
rs911418563 546 dbSNP
rs1372210780 549 dbSNP
rs1432672492 551 dbSNP
rs1011398833 555 dbSNP
rs1360025226 556 dbSNP
rs985887154 570 dbSNP
rs575689695 577 dbSNP
rs920271828 589 dbSNP
rs140758886 590 dbSNP
rs147242768 591 dbSNP
rs187198730 593 dbSNP
rs778267190 599 dbSNP
rs1277469283 601 dbSNP
rs1442643805 608 dbSNP
rs997558574 608 dbSNP
rs1477811945 610 dbSNP
rs900570644 615 dbSNP
rs1239881434 618 dbSNP
rs1258307470 622 dbSNP
rs1183600986 626 dbSNP
rs554103596 633 dbSNP
rs1039117962 637 dbSNP
rs942179766 642 dbSNP
rs909398367 659 dbSNP
rs181758680 671 dbSNP
rs1010987463 677 dbSNP
rs1205544950 678 dbSNP
rs929546056 684 dbSNP
rs1416396407 693 dbSNP
rs568776536 696 dbSNP
rs1259820601 702 dbSNP
rs1402293674 710 dbSNP
rs1030965263 711 dbSNP
rs1435961849 718 dbSNP
rs773631756 729 dbSNP
rs1369510130 732 dbSNP
rs999945953 736 dbSNP
rs901403815 743 dbSNP
rs1345222690 744 dbSNP
rs1041302586 745 dbSNP
rs141909609 748 dbSNP
rs1464032187 758 dbSNP
rs1208871014 759 dbSNP
rs531755466 761 dbSNP
rs1249813450 776 dbSNP
rs1397219623 776 dbSNP
rs1467088496 779 dbSNP
rs889952402 780 dbSNP
rs1378013798 781 dbSNP
rs1479108066 793 dbSNP
rs969775755 795 dbSNP
rs915642234 805 dbSNP
rs1049079553 811 dbSNP
rs1442546643 813 dbSNP
rs188228425 814 dbSNP
rs556742299 819 dbSNP
rs1392844024 829 dbSNP
rs532532666 832 dbSNP
rs1386726748 833 dbSNP
rs1324571618 834 dbSNP
rs1333157478 836 dbSNP
rs1036004547 837 dbSNP
rs940342967 839 dbSNP
rs1419136435 840 dbSNP
rs552819778 841 dbSNP
rs1269493446 859 dbSNP
rs564297624 861 dbSNP
rs1422103527 862 dbSNP
rs1209201438 865 dbSNP
rs1268024475 868 dbSNP
rs981986028 868 dbSNP
rs1179473524 870 dbSNP
rs1251266969 882 dbSNP
rs1177988064 886 dbSNP
rs1459314701 887 dbSNP
rs1184414140 893 dbSNP
rs10253979 895 dbSNP
rs1196464616 908 dbSNP
rs765477308 909 dbSNP
rs527534912 913 dbSNP
rs1164294384 919 dbSNP
rs1457173182 924 dbSNP
rs1265918126 928 dbSNP
rs1393535087 931 dbSNP
rs183533763 937 dbSNP
rs1307881030 941 dbSNP
rs1349481149 949 dbSNP
rs1246950249 951 dbSNP
rs1319381108 954 dbSNP
rs1031509137 957 dbSNP
rs989724910 962 dbSNP
rs1240413835 973 dbSNP
rs1338148405 974 dbSNP
rs557046124 980 dbSNP
rs1328886668 985 dbSNP
rs1031525019 989 dbSNP
rs999641879 991 dbSNP
rs1193847829 992 dbSNP
rs199631514 999 dbSNP
rs955462033 1001 dbSNP
rs1029607482 1002 dbSNP
rs148528467 1007 dbSNP
rs1007147276 1008 dbSNP
rs900527991 1012 dbSNP
rs1017613868 1022 dbSNP
rs1006264900 1026 dbSNP
rs1474746349 1034 dbSNP
rs1159837342 1036 dbSNP
rs1441640552 1038 dbSNP
rs1048522507 1039 dbSNP
rs1378649517 1042 dbSNP
rs1178293443 1051 dbSNP
rs996092153 1054 dbSNP
rs897344924 1057 dbSNP
rs1394875916 1059 dbSNP
rs191800655 1068 dbSNP
rs1342175535 1070 dbSNP
rs1226145816 1075 dbSNP
rs1296828097 1075 dbSNP
rs940477311 1076 dbSNP
rs1278382047 1078 dbSNP
rs927629703 1082 dbSNP
rs1046047131 1086 dbSNP
rs1483085950 1086 dbSNP
rs947937497 1089 dbSNP
rs753968721 1090 dbSNP
rs866463582 1092 dbSNP
rs1188439501 1096 dbSNP
rs1211551656 1098 dbSNP
rs755954352 1102 dbSNP
rs1047878261 1116 dbSNP
rs916495896 1121 dbSNP
rs929521112 1123 dbSNP
rs907432641 1127 dbSNP
rs1046000451 1128 dbSNP
rs1375563941 1129 dbSNP
rs1216621589 1133 dbSNP
rs1355252637 1134 dbSNP
rs189508744 1144 dbSNP
rs3802009 1145 dbSNP
rs923827768 1145 dbSNP
rs978165909 1145 dbSNP
rs1306575587 1146 dbSNP
rs989857565 1146 dbSNP
rs78339489 1147 dbSNP
rs201393261 1148 dbSNP
rs1332030693 1149 dbSNP
rs935731845 1149 dbSNP
rs1019589071 1151 dbSNP
rs576902249 1154 dbSNP
rs760736884 1158 dbSNP
rs1299366596 1161 dbSNP
rs955257879 1171 dbSNP
rs1029968546 1172 dbSNP
rs1267157779 1178 dbSNP
rs537114708 1181 dbSNP
rs1434153390 1183 dbSNP
rs975369061 1184 dbSNP
rs185455844 1185 dbSNP
rs1158248495 1190 dbSNP
rs1455126301 1191 dbSNP
rs1435635575 1192 dbSNP
rs1377984891 1204 dbSNP
rs1200645706 1207 dbSNP
rs1437248970 1210 dbSNP
rs192898738 1215 dbSNP
rs1366595477 1216 dbSNP
rs1387156908 1225 dbSNP
rs188493399 1226 dbSNP
rs1266524405 1228 dbSNP
rs1303601821 1229 dbSNP
rs1327343890 1231 dbSNP
rs1227852377 1232 dbSNP
rs557958386 1233 dbSNP
rs1268906076 1234 dbSNP
rs1331805086 1241 dbSNP
rs995801397 1242 dbSNP
rs1265397544 1248 dbSNP
rs897306083 1251 dbSNP
rs1006212412 1252 dbSNP
rs771844777 1259 dbSNP
rs1269015377 1260 dbSNP
rs1026423905 1263 dbSNP
rs1180798284 1264 dbSNP
rs1488973825 1265 dbSNP
rs538019215 1271 dbSNP
rs1162536756 1278 dbSNP
rs1215443836 1280 dbSNP
rs534895044 1280 dbSNP
rs1345209116 1281 dbSNP
rs555324749 1284 dbSNP
rs906298864 1285 dbSNP
rs1046374023 1292 dbSNP
rs949003517 1306 dbSNP
rs1409491110 1311 dbSNP
rs1289257066 1319 dbSNP
rs1058168 1322 dbSNP
rs1226698045 1324 dbSNP
rs1054113125 1329 dbSNP
rs894837487 1331 dbSNP
rs1322925004 1333 dbSNP
rs1224220438 1335 dbSNP
rs1272995396 1341 dbSNP
rs569222027 1345 dbSNP
rs936637462 1350 dbSNP
rs935679766 1354 dbSNP
rs924336845 1355 dbSNP
rs923769367 1356 dbSNP
rs977215982 1362 dbSNP
rs933789487 1363 dbSNP
rs1179609668 1372 dbSNP
rs944070659 1373 dbSNP
rs922468848 1377 dbSNP
rs1166617160 1387 dbSNP
rs183445008 1388 dbSNP
rs963921106 1397 dbSNP
rs909833451 1404 dbSNP
rs1308805897 1415 dbSNP
rs954171981 1416 dbSNP
rs1445909853 1419 dbSNP
rs1283732937 1424 dbSNP
rs1380501620 1436 dbSNP
rs1027020067 1445 dbSNP
rs974727494 1446 dbSNP
rs144717536 1449 dbSNP
rs1404541016 1454 dbSNP
rs566855138 1458 dbSNP
rs1236434651 1463 dbSNP
rs1483311095 1476 dbSNP
rs1015679858 1482 dbSNP
rs1003007589 1485 dbSNP
rs1073682 1489 dbSNP
rs979604138 1496 dbSNP
rs749082660 1500 dbSNP
rs1026789294 1504 dbSNP
rs1024660275 1505 dbSNP
rs1413029873 1508 dbSNP
rs1333555789 1509 dbSNP
rs1359771251 1510 dbSNP
rs1012029031 1512 dbSNP
rs1319059345 1522 dbSNP
rs894797731 1527 dbSNP
rs748780787 1531 dbSNP
rs1300332383 1532 dbSNP
rs1478802022 1533 dbSNP
rs1217153377 1540 dbSNP
rs777623805 1541 dbSNP
rs542411390 1544 dbSNP
rs1205025311 1547 dbSNP
rs971935680 1549 dbSNP
rs149514540 1567 dbSNP
rs1464435032 1571 dbSNP
rs1188941397 1583 dbSNP
rs1024472863 1587 dbSNP
rs1042216865 1588 dbSNP
rs1476936563 1620 dbSNP
rs1172163857 1623 dbSNP
rs912429042 1628 dbSNP
rs1157116834 1634 dbSNP
rs1013122863 1638 dbSNP
rs1442519561 1640 dbSNP
rs1388527185 1643 dbSNP
rs985534287 1647 dbSNP
rs894715462 1649 dbSNP
rs1054734450 1650 dbSNP
rs999837895 1661 dbSNP
rs1198415919 1668 dbSNP
rs1273813999 1670 dbSNP
rs1367952923 1678 dbSNP
rs1344727682 1682 dbSNP
rs902860852 1685 dbSNP
rs1259174093 1686 dbSNP
rs932790101 1686 dbSNP
rs1041824605 1689 dbSNP
rs933758807 1692 dbSNP
rs922379975 1713 dbSNP
rs1039526048 1720 dbSNP
rs942561600 1721 dbSNP
rs974107531 1722 dbSNP
rs1245546309 1723 dbSNP
rs961899986 1725 dbSNP
rs1015814284 1732 dbSNP
rs200599879 1741 dbSNP
rs549920849 1745 dbSNP
rs1411373711 1746 dbSNP
rs1457860981 1752 dbSNP
rs909781100 1752 dbSNP
rs1389216396 1756 dbSNP
rs984018352 1759 dbSNP
rs1324692760 1766 dbSNP
rs952014739 1776 dbSNP
rs971527553 1785 dbSNP
rs1349280860 1786 dbSNP
rs1023126494 1787 dbSNP
rs879156080 1789 dbSNP
rs779751168 1792 dbSNP
rs17695264 1794 dbSNP
rs894899812 1811 dbSNP
rs1209002825 1816 dbSNP
rs1032391125 1817 dbSNP
rs972515714 1821 dbSNP
rs1331717197 1823 dbSNP
rs1000551414 1828 dbSNP
rs971496756 1856 dbSNP
rs13044 1857 dbSNP
rs547654619 1858 dbSNP
rs573804313 1858 dbSNP
rs1367806039 1864 dbSNP
rs367628010 1864 dbSNP
rs932693749 1867 dbSNP
rs958878275 1868 dbSNP
rs34699981 1870 dbSNP
rs1033232708 1876 dbSNP
rs527494140 1884 dbSNP
rs902809272 1886 dbSNP
rs1460646807 1889 dbSNP
rs76620812 1897 dbSNP
rs998288503 1899 dbSNP
rs1338600792 1902 dbSNP
rs1244019921 1903 dbSNP
rs1315679126 1904 dbSNP
rs748485639 1916 dbSNP
rs1039448134 1920 dbSNP
rs1274188292 1923 dbSNP
rs916041755 1924 dbSNP
rs942510142 1927 dbSNP
rs959354210 1932 dbSNP
rs1441948031 1933 dbSNP
rs545487851 1945 dbSNP
rs1032112255 1950 dbSNP
rs1387645886 1957 dbSNP
rs1447971151 1958 dbSNP
rs1001046398 1961 dbSNP
rs909728900 1962 dbSNP
rs1462219077 1963 dbSNP
rs1048262426 1980 dbSNP
rs1169106827 1982 dbSNP
rs1399380497 1986 dbSNP
rs1358531156 1987 dbSNP
rs1337240696 1989 dbSNP
rs1394966991 1989 dbSNP
rs1384992340 1992 dbSNP
rs1432624641 2003 dbSNP
rs1282569720 2009 dbSNP
rs929895420 2010 dbSNP
rs1296667529 2018 dbSNP
rs1244168613 2020 dbSNP
rs1229835130 2023 dbSNP
rs1254509739 2025 dbSNP
rs918530974 2030 dbSNP
rs1201110931 2031 dbSNP
rs972074633 2032 dbSNP
rs1463980763 2034 dbSNP
rs576834254 2038 dbSNP
rs1058175 2040 dbSNP
rs917315470 2041 dbSNP
rs991582972 2044 dbSNP
rs958826037 2046 dbSNP
rs1172020078 2054 dbSNP
rs1033180385 2056 dbSNP
rs1375582838 2059 dbSNP
rs1049995945 2066 dbSNP
rs779086044 2070 dbSNP
rs1408187123 2072 dbSNP
rs542919715 2079 dbSNP
rs996709552 2081 dbSNP
rs1319845705 2094 dbSNP
rs560008877 2094 dbSNP
rs540803893 2098 dbSNP
rs978964801 2099 dbSNP
rs1328076243 2103 dbSNP
rs1362339483 2105 dbSNP
rs1405943092 2109 dbSNP
rs755233993 2112 dbSNP
rs1038438955 2115 dbSNP
rs1330806401 2115 dbSNP
rs940144746 2118 dbSNP
rs1443495496 2121 dbSNP
rs182201918 2122 dbSNP
rs1180153919 2127 dbSNP
rs1020979528 2130 dbSNP
rs1208601622 2134 dbSNP
rs7456658 2136 dbSNP
rs908549833 2144 dbSNP
rs1045712790 2149 dbSNP
rs1189911146 2155 dbSNP
rs1264813150 2174 dbSNP
rs1232711216 2175 dbSNP
rs1222948950 2180 dbSNP
rs1432290863 2185 dbSNP
rs555236822 2190 dbSNP
rs950270876 2198 dbSNP
rs1288370578 2202 dbSNP
rs916177703 2202 dbSNP
rs992044399 2215 dbSNP
rs900848923 2217 dbSNP
rs1017946955 2225 dbSNP
rs1390259991 2232 dbSNP
rs753915066 2237 dbSNP
rs1238309684 2251 dbSNP
rs781356286 2252 dbSNP
rs1405823234 2253 dbSNP
rs1285459833 2254 dbSNP
rs191577596 2255 dbSNP
rs575895793 2261 dbSNP
rs1374368730 2262 dbSNP
rs1348654043 2272 dbSNP
rs1006599679 2273 dbSNP
rs1227873877 2274 dbSNP
rs1278806285 2275 dbSNP
rs888237319 2281 dbSNP
rs137982024 2284 dbSNP
rs929825484 2286 dbSNP
rs538664387 2287 dbSNP
rs1219799732 2294 dbSNP
rs1265272610 2297 dbSNP
rs373351453 2304 dbSNP
rs1270612653 2305 dbSNP
rs74335087 2310 dbSNP
rs1180913031 2314 dbSNP
rs917261359 2319 dbSNP
rs1160058632 2325 dbSNP
rs1417539627 2327 dbSNP
rs1406800536 2328 dbSNP
rs1367630966 2337 dbSNP
rs750310164 2339 dbSNP
rs1479223901 2348 dbSNP
rs536373184 2352 dbSNP
rs1368952165 2365 dbSNP
rs937405824 2370 dbSNP
rs1409275292 2372 dbSNP
rs1298871160 2375 dbSNP
rs1007909583 2380 dbSNP
rs11881 2385 dbSNP
rs761616982 2386 dbSNP
rs1360543744 2391 dbSNP
rs967969994 2396 dbSNP
rs1020507125 2407 dbSNP
rs1293489321 2408 dbSNP
rs977418424 2414 dbSNP
rs1203179614 2428 dbSNP
rs1214721011 2431 dbSNP
rs774333947 2432 dbSNP
rs763804118 2434 dbSNP
rs757110193 2436 dbSNP
rs1242467141 2440 dbSNP
rs1165307305 2442 dbSNP
rs1444940076 2442 dbSNP
rs1388529479 2444 dbSNP
rs1429397611 2445 dbSNP
rs997193577 2454 dbSNP
rs898318968 2458 dbSNP
rs1445929994 2459 dbSNP
rs187958786 2463 dbSNP
rs1302711719 2475 dbSNP
rs1017895177 2481 dbSNP
rs531628557 2482 dbSNP
rs1279617949 2485 dbSNP
rs1454907162 2489 dbSNP
rs1295921493 2491 dbSNP
rs1219538841 2498 dbSNP
rs562021765 2499 dbSNP
rs1272967303 2505 dbSNP
rs552119151 2508 dbSNP
rs532036060 2512 dbSNP
rs1404304732 2532 dbSNP
rs993989931 2534 dbSNP
rs1185171294 2535 dbSNP
rs117675292 2537 dbSNP
rs1474975714 2540 dbSNP
rs1187273969 2543 dbSNP
rs540317353 2547 dbSNP
rs1344192041 2552 dbSNP
rs950074941 2557 dbSNP
rs1407447014 2560 dbSNP
rs1046276664 2565 dbSNP
rs1319167667 2569 dbSNP
rs183083397 2576 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggaugcaagguaucAGAUGGu 5'
                        |||||| 
Target 5' -----------uccUCUACCa 3'
 		1 - 10
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000223023.4 | 3UTR | UCCUCUACCAUCCUGCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells 0.641 4.9e-4 0.609 1.0e-3 23 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.532 3.1e-3 0.205 1.6e-1 25 Click to see details
GSE38226 Liver fibrosis -0.552 4.7e-3 -0.542 5.6e-3 21 Click to see details
GSE27834 Pluripotent stem cells 0.612 5.9e-3 0.597 7.3e-3 16 Click to see details
GSE32688 Pancreatic cancer 0.363 2.1e-2 0.355 2.3e-2 32 Click to see details
GSE28260 Renal cortex and medulla 0.554 2.5e-2 0.533 3.0e-2 13 Click to see details
GSE19536 Breast cancer -0.145 7.5e-2 -0.150 6.8e-2 100 Click to see details
GSE21032 Prostate cancer -0.133 1.2e-1 -0.100 1.8e-1 83 Click to see details
GSE19783 ER- ER- breast cancer -0.126 1.3e-1 -0.147 9.8e-2 79 Click to see details
GSE17306 Multiple myeloma -0.148 1.6e-1 -0.109 2.3e-1 49 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.178 2.0e-1 0.026 4.5e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.162 2.2e-1 -0.016 4.7e-1 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.698 2.5e-1 0.500 3.3e-1 3 Click to see details
GSE21687 Ependynoma primary tumors 0.072 2.9e-1 -0.131 1.5e-1 64 Click to see details
GSE19783 ER+ ER+ breast cancer 0.126 3.0e-1 0.095 3.5e-1 20 Click to see details
GSE14794 Lymphoblastoid cells 0.034 3.8e-1 -0.002 4.9e-1 90 Click to see details
GSE17498 Multiple myeloma 0.039 4.1e-1 0.104 2.6e-1 40 Click to see details
GSE28544 Breast cancer 0.049 4.1e-1 -0.022 4.6e-1 24 Click to see details
GSE21849 B cell lymphoma 0.031 4.4e-1 0.450 7.2e-3 29 Click to see details
GSE19350 CNS germ cell tumors 0.046 4.4e-1 -0.133 3.4e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.028 4.5e-1 0.272 1.2e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC -0.327 0.02 -0.274 0.05 38 Click to see details
CHOL -0.665 0.03 -0.517 0.08 9 Click to see details
PRAD 0.231 0.05 0.245 0.04 50 Click to see details
PCPG -0.985 0.06 -1.000 0.5 3 Click to see details
PAAD 0.887 0.06 1.000 0.5 4 Click to see details
HNSC -0.203 0.1 -0.056 0.36 42 Click to see details
KIRC -0.133 0.14 0.021 0.43 68 Click to see details
LUAD -0.327 0.15 -0.385 0.11 12 Click to see details
COAD -0.317 0.22 -0.071 0.43 8 Click to see details
UCEC 0.184 0.23 0.196 0.21 19 Click to see details
BRCA 0.068 0.27 0.073 0.25 84 Click to see details
STAD -0.111 0.27 -0.043 0.41 32 Click to see details
CESC 0.652 0.27 0.500 0.33 3 Click to see details
ESCA -0.199 0.28 -0.073 0.42 11 Click to see details
BLCA -0.125 0.31 -0.139 0.29 18 Click to see details
KICH -0.092 0.33 -0.127 0.27 25 Click to see details
LIHC -0.036 0.4 -0.063 0.33 49 Click to see details
KIRP -0.019 0.46 -0.034 0.43 32 Click to see details
THCA 0.008 0.48 0.023 0.43 59 Click to see details
THCA 0.008 0.48 0.023 0.43 59 Click to see details
THCA 0.008 0.48 0.023 0.43 59 Click to see details
70 hsa-miR-379-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007025 IL11 interleukin 11 1 1
MIRT068534 NHLRC3 NHL repeat containing 3 2 6
MIRT094166 PCGF3 polycomb group ring finger 3 2 6
MIRT100098 ABT1 activator of basal transcription 1 2 8
MIRT120926 PDE12 phosphodiesterase 12 2 8
MIRT179051 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT202043 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT215726 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT254608 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT266219 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT297447 SLC20A1 solute carrier family 20 member 1 2 4
MIRT315444 SLC16A10 solute carrier family 16 member 10 2 2
MIRT442137 C3orf17 nucleolus and neural progenitor protein 2 2
MIRT453878 IFRD1 interferon related developmental regulator 1 2 12
MIRT456258 TDRKH tudor and KH domain containing 2 12
MIRT456412 MTRF1L mitochondrial translational release factor 1 like 2 2
MIRT459729 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT461474 METTL1 methyltransferase like 1 2 2
MIRT463791 YBX1 Y-box binding protein 1 2 6
MIRT464031 WASL Wiskott-Aldrich syndrome like 2 2
MIRT464206 VGLL4 vestigial like family member 4 2 2
MIRT466712 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT467957 SLC16A1 solute carrier family 16 member 1 2 4
MIRT469224 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT473958 LRRC58 leucine rich repeat containing 58 2 2
MIRT475309 IFNLR1 interferon lambda receptor 1 2 2
MIRT476945 FAM83G family with sequence similarity 83 member G 2 4
MIRT477747 EDN1 endothelin 1 2 2
MIRT478260 DDX19B DEAD-box helicase 19B 2 2
MIRT478680 CSRP2 cysteine and glycine rich protein 2 2 4
MIRT490255 HAAO 3-hydroxyanthranilate 3,4-dioxygenase 2 2
MIRT493289 LNPEP leucyl and cystinyl aminopeptidase 2 2
MIRT493564 HSPA5 heat shock protein family A (Hsp70) member 5 2 2
MIRT495960 TBC1D19 TBC1 domain family member 19 2 2
MIRT497106 BEST3 bestrophin 3 2 2
MIRT498348 CISD1 CDGSH iron sulfur domain 1 2 2
MIRT500783 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 8
MIRT501091 SLC5A6 solute carrier family 5 member 6 2 4
MIRT505309 TPD52 tumor protein D52 2 2
MIRT511107 NFIB nuclear factor I B 2 4
MIRT512737 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT514269 ZNF519 zinc finger protein 519 2 2
MIRT514602 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 2 4
MIRT515378 RPL7 ribosomal protein L7 2 2
MIRT518564 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT520459 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT529765 SF3B1 splicing factor 3b subunit 1 2 2
MIRT538005 DNAL1 dynein axonemal light chain 1 2 2
MIRT538250 CUL3 cullin 3 2 4
MIRT543777 RBM12B RNA binding motif protein 12B 2 4
MIRT546203 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT547201 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT548440 ELMOD2 ELMO domain containing 2 2 2
MIRT551634 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT553334 TSC22D2 TSC22 domain family member 2 2 2
MIRT556169 MCC mutated in colorectal cancers 2 2
MIRT557968 FAM222B family with sequence similarity 222 member B 2 2
MIRT560021 TM2D2 TM2 domain containing 2 2 2
MIRT560716 ZNF749 zinc finger protein 749 2 2
MIRT564114 ZYG11B zyg-11 family member B, cell cycle regulator 2 4
MIRT564374 MRPS18B mitochondrial ribosomal protein S18B 2 2
MIRT566935 LIN28B lin-28 homolog B 5 2
MIRT573340 TUBD1 tubulin delta 1 2 2
MIRT607186 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT698515 TGFBR1 transforming growth factor beta receptor 1 2 2
MIRT704039 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT714582 PRRC1 proline rich coiled-coil 1 2 2
MIRT732163 PTK2 protein tyrosine kinase 2 3 1
MIRT732827 LINC00665 long intergenic non-protein coding RNA 665 3 0
MIRT735832 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-379 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-379 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 up-regulated
miR-379 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-379 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-379 Rifampicin approved 5381226 TaqMan low-density array hepatocellular carcinoma HepG2 cells 21540293 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-379 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-379 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-379-5p (1Z)-2-anilino-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-oxoethanimidoyl cyanide 5466279 NSC683605 resistant
hsa-miR-379-5p (2e)-2-hydroxyimino-4-(3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-4-oxo-n-(2,4,5-trichlorophenyl)butanamide 6399319 NSC635544 resistant
hsa-miR-379-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-379-5p (2R)-2-(1H-benzimidazol-2-yl)-2-(2-chloro-6-methylpyrimidin-4-yl)acetonitrile 390694 NSC688326 resistant
hsa-miR-379-5p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 resistant
hsa-miR-379-5p (2S,6S,7S,12R)-16-bromo-9-tert-butyl-4-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 372657 NSC648154 sensitive
hsa-miR-379-5p (3-(trifluoromethyl)anilino)(2-(trifluoromethyl)phenyl)acetonitrile 375079 NSC654017 resistant
hsa-miR-379-5p (3e)-3-[(6-methylimidazo[2,1-b]thiazol-5-yl)methylene]-1,3-dihydro-2h-indol-2-one 10755270 NSC726902 resistant
hsa-miR-379-5p (3e)-4-chloro-3-[(6-chloro-2-methylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471424 NSC711079 sensitive
hsa-miR-379-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-5-hydroxy-3-(4-methoxyphenyl)-4h-pyrazol-1-yl]methanone 400818 NSC713324 resistant
hsa-miR-379-5p (4-chlorophenyl) 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxylate 24204990 NSC733906 sensitive
hsa-miR-379-5p (4-chlorophenyl) 3-methyl-5-nitroimidazole-4-sulfonate 236063 NSC38086 resistant
hsa-miR-379-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-379-5p (4e,12z,27z,43z)-hexatetraconta-4,12,27,43-tetraen-1,18,21,45-tetrayne-3,20-diol 5470605 NSC703544 resistant
hsa-miR-379-5p (5e)-5-[(3,4-dimethoxyphenyl)methylidene]-3-phenyl-2-propylimino-1,3-thiazolidin-4-one 5471348 NSC710598 sensitive
hsa-miR-379-5p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 resistant
hsa-miR-379-5p (E)-3-(3-chlorophenyl)-N-[2-[(1,1-dioxothian-4-yl)-methylamino]-2-oxoethyl]prop-2-enamide 51003603 NSC761184 resistant
hsa-miR-379-5p (e)-phenyl(2-pyridinyl)methanone (6-chloro-4-pyrimidinyl)hydrazone 9571636 NSC693248 resistant
hsa-miR-379-5p (NE)-N-[(6E)-2-[(hydroxyamino)-(4-phenylmethoxyphenyl)methyl]-6-[(4-phenylmethoxyphenyl)methylidene]cyclohexylidene]hydroxylamine 5928828 NSC632824 resistant
hsa-miR-379-5p [(1h-benzimidazole-2-yl)dithio]-9h-purine 54613148 NSC750485 resistant
hsa-miR-379-5p [(4S,5R,6S)-4-[(3,4-dimethoxyphenyl)methyl]-6-(2,2-diphenylcyclopentyl)oxy-4-ethyl-2-oxido-5,6-dihydrooxazin-2-ium-5-yl] benzoate 395287 NSC699767 resistant
hsa-miR-379-5p [(5R,6S)-4-cyclohexyl-6-(2,2-diphenylcyclopentyl)oxy-2-oxido-5,6-dihydro-4H-oxazin-2-ium-5-yl] acetate 395278 NSC699756 resistant
hsa-miR-379-5p [(6z)-1-thiacyclodec-6-en-3,8-diyn-5-yl] 9,10-dioxoanthracene-2-carboxylate 5468578 NSC671898 sensitive
hsa-miR-379-5p [(6Z,10Z)-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (Z)-4-hydroxy-2-(hydroxymethyl)but-2-enoate 6477984 NSC659936 resistant
hsa-miR-379-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 sensitive
hsa-miR-379-5p [(E)-1-chlorobutylideneamino] N-[4-(trifluoromethoxy)phenyl]carbamate 5466270 NSC682840 resistant
hsa-miR-379-5p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-379-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(4-bromophenyl)carbamate 9556248 NSC682825 resistant
hsa-miR-379-5p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 resistant
hsa-miR-379-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-379-5p [3,4,5-triacetyloxy-6-(3-cyano-6-phenyl-2-sulfanyl-4-thiophen-2-yl-4h-pyridin-1-yl)oxan-2-yl]methyl acetate 381303 NSC667740 sensitive
hsa-miR-379-5p [3,4,5-triacetyloxy-6-[(e)-2-(azidomethyl)-3-oxobut-1-enoxy]oxan-2-yl]methyl acetate 5471355 NSC710716 resistant
hsa-miR-379-5p [3,4,5-triacetyloxy-6-[6-(4-chlorophenyl)-3-cyano-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 386296 NSC678057 sensitive
hsa-miR-379-5p [4-[(4-bromophenyl)carbamothioyl]phenyl] n-(4-chlorophenyl)carbamate 5471250 NSC710003 resistant
hsa-miR-379-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl [5-[5-fluoro-4-(octadecylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate 390213 NSC687370 sensitive
hsa-miR-379-5p [5-[[2-chloroethyl(nitroso)carbamoyl]amino]-3-hydroxy-2-(hydroxymethyl)-6-methoxyoxan-4-yl] tetradecanoate 370169 NSC642913 sensitive
hsa-miR-379-5p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-379-5p 1-(2-methoxyphenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5367237 NSC668297 resistant
hsa-miR-379-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-379-5p 1-[(4-bromophenyl)amino]cyclopentanecarbonitrile 238637 NSC43101 resistant
hsa-miR-379-5p 1-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]-3-(2-pyridin-2-ylethyl)thiourea 9571616 NSC689531 resistant
hsa-miR-379-5p 1-[1-(3,4-dimethoxyphenyl)-5-ethyl-7,8-dimethoxy-4-methyl-2,3-benzodiazepin-3-yl]ethanone 343249 NSC382585 resistant
hsa-miR-379-5p 1-[3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-(4-methylphenyl)-3,4-dihydropyrazol-2-yl]ethanone 155808269 NSC762557 sensitive
hsa-miR-379-5p 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-2,5-dihydrofuran-2-yl]-5-methylpyrimidine-2,4-dione 404846 NSC721390 sensitive
hsa-miR-379-5p 1-benzyl-2-methyl-1-(2-phenylethyl)-4,5-dihydroimidazol-1-ium 413544 NSC49460 sensitive
hsa-miR-379-5p 1-cyclopentyl-3-[(Z)-1-pyridin-2-ylethylideneamino]thiourea 5468465 NSC670783 resistant
hsa-miR-379-5p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 sensitive
hsa-miR-379-5p 17-acetyl-15-benzyl-9,14-dihydroxy-16-methyl-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 24203201 NSC727113 resistant
hsa-miR-379-5p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-379-5p 2'-(4-chlorobenzoyl)-1'-(4-chlorophenyl)-1'-hydroxyspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione 388188 NSC682756 sensitive
hsa-miR-379-5p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 resistant
hsa-miR-379-5p 2-(2-(dimethylamino)ethylamino)naphthazarin 376950 NSC658145 resistant
hsa-miR-379-5p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 resistant
hsa-miR-379-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-379-5p 2-[(1-anilino-4h-thiochromeno[3,4-d]imidazol-2-yl)sulfanyl]-n-[4-(4-chlorophenyl)-1,3-thiazol-2-yl]acetamide 60148157 NSC753769 sensitive
hsa-miR-379-5p 2-[[4-[methyl-[(2,4,7-triaminopteridin-6-yl)methyl]amino]benzoyl]amino]pentanedioic acid 387951 NSC682306 resistant
hsa-miR-379-5p 2-[2-(aziridin-1-yl)ethoxy]quinoline 268715 NSC109084 resistant
hsa-miR-379-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-379-5p 2-[2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenoxy]acetic acid 5934333 NSC643813 sensitive
hsa-miR-379-5p 2-azaadenine 5480214 NSC57048 resistant
hsa-miR-379-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-379-5p 2-hydroxy discorhabdin d 362391 NSC626161 resistant
hsa-miR-379-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-379-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-379-5p 2-methylolivacinium acetate 5458752 NSC336003 sensitive
hsa-miR-379-5p 2-n-methyl-6-oxaellipticinium acetate 10018975 NSC638788 sensitive
hsa-miR-379-5p 2-n-methyl-6-thiaellipticinum iodide 367888 NSC638066 sensitive
hsa-miR-379-5p 2-phenyl-6-((1-phenyl-1h-tetraazol-5-yl)oxy)-4h-chromen-4-one 386037 NSC677603 sensitive
hsa-miR-379-5p 2,4-dinitro-1-benzofuran 332391 NSC329127 resistant
hsa-miR-379-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-379-5p 2,5,12-trimethyl-[1,4]benzodioxino[3,2-g]isoquinolin-2-ium acetate 388316 NSC683048 sensitive
hsa-miR-379-5p 2,9-dimethylellipticinium acetate 10472068 NSC639364 sensitive
hsa-miR-379-5p 3-(4-bromophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388536 NSC683517 sensitive
hsa-miR-379-5p 3-(4-chlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 396385 NSC702338 resistant
hsa-miR-379-5p 3-(hydroxymethyl)-5-(6-methylsulfanylpurin-9-yl)-1,4-dioxane-2,6-diol 269951 NSC111702 resistant
hsa-miR-379-5p 3-[(e)-1-(2-hydroxy-4-methoxy-phenyl)ethylideneamino]-1,1-dimethyl-thiourea 135493996 NSC689547 resistant
hsa-miR-379-5p 3-[(E)-3-(4-chlorophenyl)prop-2-enoyl]-2-hydroxycyclohepta-2,4,6-trien-1-one 5918418 NSC356777 resistant
hsa-miR-379-5p 3-[10-(3-cyanophenyl)-3,5,9,11-tetraoxo-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-en-4-yl]benzonitrile 365552 NSC633258 sensitive
hsa-miR-379-5p 3-bromo-4-(3,3-dimethyl-but-1-ynyl)-2(5h)-furanone 11413833 NSC726328 resistant
hsa-miR-379-5p 3-chloro-6-[(4-fluorophenoxy)methyl]-2-phenylquinoxaline 392817 NSC693773 sensitive
hsa-miR-379-5p 3-methoxy-1-[(2-methoxyphenyl)methyl]-5-nitroindazole 386342 NSC678125 sensitive
hsa-miR-379-5p 3-methyl-1-(4-nitrobenzoyl)-5-(2-phenylethyl)-2-[[4-tri(propan-2-yl)silyloxyphenyl]methyl]pyrrolidine-3-carbaldehyde 401723 NSC715453 sensitive
hsa-miR-379-5p 3-phenacyliden-5-brom-2-indolinon 5351299 NSC294961 resistant
hsa-miR-379-5p 3,3-bis(3-(trifluoromethyl)phenyl)naphtho[1,2-c]furan-1(3h)-one 362080 NSC625603 sensitive
hsa-miR-379-5p 3no2-2pyrid-so2-ph 371687 NSC646125 resistant
hsa-miR-379-5p 4-((3-chlorobenzyl)oxy)-n-hydroxybenzamide 392397 NSC692761 resistant
hsa-miR-379-5p 4-(4-methoxyphenyl)-16-methyl-9-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390919 NSC689140 sensitive
hsa-miR-379-5p 4-(4-methoxyphenyl)-16-phenylmethoxy-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390917 NSC689138 sensitive
hsa-miR-379-5p 4-(bromomethyl)-2,2,5,5-tetramethyl-1-imidazolidinol 3-oxide 378673 NSC661470 resistant
hsa-miR-379-5p 4-[(5s,8ar)-5-(4-fluoroanilino)-5,5a,6,8,8a,9-hexahydro-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-2,6-dimethoxyphenol 378224 NSC660027 sensitive
hsa-miR-379-5p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-379-5p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-379-5p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-379-5p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 sensitive
hsa-miR-379-5p 4-methoxy-1,5-benzothiazepine-1,1-dioxide 358940 NSC619102 resistant
hsa-miR-379-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-379-5p 4-pyridin-3-yl-2-(2,3,5-trichlorophenyl)-1,3-thiazole 24814783 NSC742842 resistant
hsa-miR-379-5p 4,10-bis(3-ethynylphenyl)-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-ene-3,5,9,11-tetrone 365547 NSC633253 sensitive
hsa-miR-379-5p 4,16-difluoro-8,11,20-trimethyl-8-aza-20-azoniapentacyclo[11.7.1.02,7.09,21.014,19]henicosa-1(20),2(7),3,5,9,11,13(21),14(19),15,17-decaene;methyl sulfate 9804187 NSC714187 sensitive
hsa-miR-379-5p 5-(3,5-dimethoxybenzyl)-2-hydroxy-5,11-dihydro-6h-benzo[b]carbazol-6-one 403878 NSC719411 resistant
hsa-miR-379-5p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 resistant
hsa-miR-379-5p 5-hydroxy-3,7-dimethoxy-3',4'-methylenedioxyflavone 5466137 NSC678102 sensitive
hsa-miR-379-5p 5-methoxy-17-nitroso-8,9,10,12-tetrazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(17),2(7),3,5,8,11(16),12,14-octaene 54613484 NSC749292 resistant
hsa-miR-379-5p 5-methyl-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 53329052 NSC748147 sensitive
hsa-miR-379-5p 5-methyl-2-thiophenecarbaldehyde (7-methoxy-4-methyl-2-quinolinyl)hydrazone 9556289 NSC683922 resistant
hsa-miR-379-5p 5,10-dihydroxy-1-(4-piperidin-1-ylbutyl)naphtho[2,3-f]indole-4,11-dione 406505 NSC724632 resistant
hsa-miR-379-5p 5,10-dihydroxy-3-[[4-(2-hydroxyethyl)piperazin-1-yl]methyl]-1H-naphtho[2,3-f]indole-4,11-dione;hydrochloride 135585401 NSC726442 resistant
hsa-miR-379-5p 5,11-dimethyl-2-[(pentanoyloxy)methyl]-6h-pyrido[4,3-b]carbazol-2-ium iodide 367409 NSC637130 sensitive
hsa-miR-379-5p 5,7-dichloro-3-[(2-nitrophenyl)diazenyl]-1H-indol-2-ol 3724036 NSC117187 sensitive
hsa-miR-379-5p 5.alpha.,25d-spirostan-3.beta.-ol glycoside NSC106557 sensitive
hsa-miR-379-5p 6-(2-(3-chlorophenyl)hydrazino)-2,4-pyrimidinediol 385879 NSC677279 resistant
hsa-miR-379-5p 6-(4-acetylanilino)-9-methoxyindeno[1,2-c]quinolin-11-one 24205210 NSC734628 sensitive
hsa-miR-379-5p 6-[2-(dimethylamino)ethyl]-13-(2-isothiocyanatoethyl)-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone 57327694 NSC757982 resistant
hsa-miR-379-5p 6-amino-1,3-dichloro-5,6-dihydrocyclopenta[c]thiophen-4-one 378800 NSC662120 resistant
hsa-miR-379-5p 6-amino-5-[(4-fluorophenyl)methyl]-7-(1-methylbenzimidazol-2-yl)pyrrolo[2,3-b]pyrazine-2,3-dicarbonitrile 1179229 NSC730035 resistant
hsa-miR-379-5p 6-aminotoyocamycin 300567 NSC175630 resistant
hsa-miR-379-5p 6-benzyl-3,8,9-trimethoxy-11-methyl-6,11-dihydro-5h-indeno[1,2-c]isoquinolin-5-one 373164 NSC649107 sensitive
hsa-miR-379-5p 6-bromosangivamycin 270853 NSC113943 resistant
hsa-miR-379-5p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-379-5p 6-ethoxy-2-(hydroxymethyl)-2h-pyran-3(6h)-one 398342 NSC708062 resistant
hsa-miR-379-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-379-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-379-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-379-5p 8-aminoadenosine 259812 NSC90394 resistant
hsa-miR-379-5p 8-azainosine 135443893 NSC130279 resistant
hsa-miR-379-5p 8-chloro-7-methyl-5,5-dioxo-n-phenyl-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400657 NSC713019 sensitive
hsa-miR-379-5p 8-chloro-7-methyl-n-(4-methylphenyl)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400656 NSC713018 sensitive
hsa-miR-379-5p 8-trichloromethyldihydroberberine 320713 NSC269192 sensitive
hsa-miR-379-5p 9-((2-chloroethyl)thio)acridine 395387 NSC699923 resistant
hsa-miR-379-5p 9-(benzylsulfinyl)-2,7-dimethoxyacridine 395397 NSC699933 resistant
hsa-miR-379-5p 9-chloro-12,13-dimethoxy-6-phenyl-2,10-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4(16),5,7,9,11(15),12-heptaen-3-one 5470922 NSC706236 resistant
hsa-miR-379-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium acetate 373614 NSC650263 sensitive
hsa-miR-379-5p 9-hydroxy-2-(.beta.-diethylaminoethyl)ellipticinium acetate 72034 NSC311152 sensitive
hsa-miR-379-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 sensitive
hsa-miR-379-5p Ak136303 388306 NSC682996 resistant
hsa-miR-379-5p Allopurinol 2094 NSC1390 approved resistant
hsa-miR-379-5p Antibiotic x-14766a 434840 NSC359239 sensitive
hsa-miR-379-5p Ao-267/15176074 393944 NSC696916 resistant
hsa-miR-379-5p Bafilomycin antibiotic NSC381867 resistant
hsa-miR-379-5p Berberine iodide 72350 NSC150446 sensitive
hsa-miR-379-5p Bis(2-nitrophenyl)sulfilimine 371591 NSC645984 resistant
hsa-miR-379-5p Carboplatin 38904 NSC241240 approved sensitive
hsa-miR-379-5p Cgp 57380 11644425 NSC741567 resistant
hsa-miR-379-5p Chloroplatinum(1+);2-(4-methylpiperidin-1-yl)ethanethiolate;dihydrate 431390 NSC292596 resistant
hsa-miR-379-5p Chrysarobin 221502 NSC6152 sensitive
hsa-miR-379-5p Crotonosid 223996 NSC12161 resistant
hsa-miR-379-5p Destruxin b NSC236580 resistant
hsa-miR-379-5p Dezaguanine 55710 NSC261726 resistant
hsa-miR-379-5p Diaporthein b 54612739 NSC751295 resistant
hsa-miR-379-5p Diethyl (Z)-2-(2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469884 NSC693983 resistant
hsa-miR-379-5p Diethyl 2-[[4-[[6-(trifluoromethyl)quinoxalin-2-yl]amino]benzoyl]amino]pentanedioate 384948 NSC675772 sensitive
hsa-miR-379-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-379-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-379-5p Elliptinium acetate 42722 NSC264137 sensitive
hsa-miR-379-5p Ethyl 16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaene-4-carboxylate 391836 NSC691424 sensitive
hsa-miR-379-5p Ethyl 2-[4-(16-methyl-8-oxo-5-phenyl-2,3,4,7,16-pentazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10,12,14-hexaen-7-yl)butanoylamino]acetate 24205302 NSC734977 sensitive
hsa-miR-379-5p Ethyl 3,5-dinitro-2-(7H-purin-6-ylsulfanyl)benzoate 4331266 NSC244714 resistant
hsa-miR-379-5p Ethyl 7-(3,4-dihydro-2h-1,5-benzodioxepin-7-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399951 NSC711103 sensitive
hsa-miR-379-5p Eupachlorin 5458217 NSC114567 resistant
hsa-miR-379-5p Euphorbia substance spr5 5459191 NSC640929 sensitive
hsa-miR-379-5p Granatomycin a 135476747 NSC355063 resistant
hsa-miR-379-5p Gw701427a 10276395 NSC756323 sensitive
hsa-miR-379-5p Haloprogin 3561 NSC100071 resistant
hsa-miR-379-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-379-5p Hsdb 8106 16129719 NSC676825 resistant
hsa-miR-379-5p Inosine, 6-thio-, 2',3',5'-tripentanoate 4208664 NSC77495 resistant
hsa-miR-379-5p Isobaccharin 5358646 NSC269760 sensitive
hsa-miR-379-5p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-379-5p J3.522.543i 6163542 NSC113053 resistant
hsa-miR-379-5p Justicidin b 122805 NSC254665 resistant
hsa-miR-379-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-379-5p Laurusin 135476719 NSC106486 resistant
hsa-miR-379-5p Litomycin 135460332 NSC77038 resistant
hsa-miR-379-5p Ls-94160 135408599 NSC52426 resistant
hsa-miR-379-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-379-5p Mefloquine hydrochloride 456309 NSC157387 resistant
hsa-miR-379-5p Methyl (3r)-3-[[(3r)-3-[[(3r)-3-[(2-methylpropan-2-yl)oxycarbonylamino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoate 403118 NSC717705 sensitive
hsa-miR-379-5p Methyl (Z)-4-[(5-bromothiophen-2-yl)methylideneamino]-4,4-dicyanobut-2-enoate 5470186 NSC698282 resistant
hsa-miR-379-5p Methyl (Z)-4,4-dicyano-4-[(3-methoxyphenyl)methylideneamino]but-2-enoate 5470182 NSC698278 resistant
hsa-miR-379-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-379-5p Methyl 6-[bis-(4-methylphenyl)sulfonylamino]-7-methoxy-12-oxo-3,13,23-triazahexacyclo[11.10.1.02,11.04,9.014,19.020,24]tetracosa-1(24),2(11),3,5,7,9,14,16,18,20,22-undecaene-22-carboxylate 45028276 NSC742036 sensitive
hsa-miR-379-5p Methyl ester prodigiosene 136040158 NSC753661 resistant
hsa-miR-379-5p Musennin 267361 NSC106554 sensitive
hsa-miR-379-5p N'-(cyano(4-hydroxyphenyl)methyl)-2-hydroxybenzohydrazide 375017 NSC653843 sensitive
hsa-miR-379-5p N'-chloro-4-[2-[2-[4-[(Z)-N'-chlorocarbamimidoyl]phenoxy]ethyl-(4-methylphenyl)sulfonylamino]ethoxy]benzenecarboximidamide 45028721 NSC743909 sensitive
hsa-miR-379-5p N-(1,3-benzothiazol-2-yl)-2-phenyl-7-(3,4,5-trimethoxyphenyl)pyrazolo[1,5-a]pyrimidine-5-carboxamide 71624130 NSC763635 sensitive
hsa-miR-379-5p N-(4-methylphenyl)-3-[3-(4-methylphenyl)imino-2-phenylinden-1-yl]sulfanyl-2-phenylinden-1-imine 389841 NSC686473 sensitive
hsa-miR-379-5p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-379-5p N-[(e)-[(4-methoxyphenyl)-pyridin-2-ylmethylidene]amino]pyridin-2-amine 9630043 NSC693622 resistant
hsa-miR-379-5p N-[(e)-1-isoquinolin-3-ylethylideneamino]-1-methylbenzimidazol-2-amine 9572093 NSC703108 resistant
hsa-miR-379-5p N-[(e)-1-pyridin-2-ylethylideneamino]-[1,3]thiazolo[5,4-b]pyridin-2-amine 9572047 NSC693635 resistant
hsa-miR-379-5p N-[(e)-1-pyridin-2-ylethylideneamino]-5-(trifluoromethyl)-1,3-benzothiazol-2-amine 9572095 NSC703110 resistant
hsa-miR-379-5p N-[(e)-1-pyrimidin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572048 NSC693636 resistant
hsa-miR-379-5p N-[(z)-[phenyl(pyridin-2-yl)methylidene]amino]quinoxalin-2-amine 5869744 NSC693626 resistant
hsa-miR-379-5p N-[[4-[10-[4-[[acetyl(2-phenylethyl)amino]-cyanomethyl]phenoxy]decoxy]phenyl]-cyanomethyl]-n-(2-phenylethyl)acetamide 387721 NSC681750 sensitive
hsa-miR-379-5p N-[2-(dimethylamino)ethyl]-4-(furo[3,2-c]quinolin-4-ylamino)benzamide 24204686 NSC732490 resistant
hsa-miR-379-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 sensitive
hsa-miR-379-5p N-[3-[(z)-n-methoxy-c-methylcarbonimidoyl]phenyl]-11h-indolo[3,2-c]quinolin-6-amine 9572585 NSC721041 resistant
hsa-miR-379-5p N-[dimethoxyphosphoryl(furan-2-yl)methyl]-4-[[4-[[dimethoxyphosphoryl(furan-2-yl)methyl]amino]phenyl]methyl]aniline 399251 NSC709928 sensitive
hsa-miR-379-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-379-5p N,n-dimethyl-4-[(e)-2-(1-methyl-2,5-diphenylpyrazol-1-ium-3-yl)ethenyl]aniline;trifluoromethanesulfonate 5469868 NSC693576 sensitive
hsa-miR-379-5p Naphtho[1,2-b]quinolizinium, 9-methyl-, bromide 21144314 NSC77810 sensitive
hsa-miR-379-5p Naphtho[2,1-b]quinolizinium, 7-methyl- chloride 5351151 NSC28002 sensitive
hsa-miR-379-5p Nigericin 34230 NSC292567 sensitive
hsa-miR-379-5p NSC372474 NSC372474 resistant
hsa-miR-379-5p NSC631451 NSC631451 resistant
hsa-miR-379-5p NSC751830 NSC751830 resistant
hsa-miR-379-5p NSC755523 NSC755523 resistant
hsa-miR-379-5p Pan (van) 6825 NSC5332 resistant
hsa-miR-379-5p Paucin 282787 NSC136722 resistant
hsa-miR-379-5p Pectenotoxin ii 5468320 NSC668555 sensitive
hsa-miR-379-5p Phenoxathiin-2-ylmethyl carbamimidothioate;hydrochloride 392088 NSC691900 resistant
hsa-miR-379-5p Phosphinic acid, bis(1-aziridinyl)-, 2-naphthyl ester NSC55720 sensitive
hsa-miR-379-5p Phosphonium, triphenylpropenyl-, bromide, (e)- (8ci) 10714966 NSC289922 sensitive
hsa-miR-379-5p Pinnatin b 5470399 NSC700892 resistant
hsa-miR-379-5p Platinum(2+);2,5,11-trimethyl-6H-pyrido[4,3-b]carbazol-2-ium-9-ol;tetrachloride 6477738 NSC620256 sensitive
hsa-miR-379-5p Propan-2-ylsulfanyl-(2,3,5,6-tetrachloropyridin-4-yl)sulfanylmethanethione 399833 NSC710969 resistant
hsa-miR-379-5p Protein: pahiv4 NSC678525 sensitive
hsa-miR-379-5p Pyrazoloadenine 75420 NSC1393 resistant
hsa-miR-379-5p S-[2-(2,6-dichlorophenyl)-3-oxoinden-1-yl] N,N-dimethylcarbamothioate 333069 NSC332837 resistant
hsa-miR-379-5p Salicyl n-salicylidenehydrazide 135445765 NSC87864 resistant
hsa-miR-379-5p Sarcoviolin 24202820 NSC726045 sensitive
hsa-miR-379-5p Silver methylsulfonate 6712944 NSC83223 resistant
hsa-miR-379-5p Stereoisomer of nsc 674067-p 384359 NSC674066 resistant
hsa-miR-379-5p Stk134301 135400303 NSC715186 resistant
hsa-miR-379-5p Stl298328 387753 NSC681782 resistant
hsa-miR-379-5p Stl323102 375895 NSC656208 resistant
hsa-miR-379-5p Stl361983 256661 NSC83715 resistant
hsa-miR-379-5p Stl434863 394348 NSC697730 resistant
hsa-miR-379-5p Suavedol 65631 NSC141545 resistant
hsa-miR-379-5p Tetramethyl (1r,5r,6s,9s)-3,5-dihydroxy-7-[4-[(e)-3-phenylprop-2-enoyl]oxyphenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681586 NSC717065 resistant
hsa-miR-379-5p Tetramethyl (1r,5r,6s,9s)-7-[4-[(e)-2,3-bis(4-chlorophenyl)prop-2-enoyl]oxyphenyl]-3,5-dihydroxybicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681588 NSC717067 resistant
hsa-miR-379-5p Thiosangivamycin 3006170 NSC105827 resistant
hsa-miR-379-5p Timtec1_002753 404248 NSC720426 sensitive
hsa-miR-379-5p Tridecyl 5-[(Z)-[3-methoxy-5-(1H-pyrrol-2-yl)pyrrol-2-ylidene]methyl]-2,4-dimethyl-1H-pyrrole-3-carboxylate 136226144 NSC763730 resistant
hsa-miR-379-5p Trimethyl-[[2-oxo-3-[(trimethylazaniumyl)methyl]cyclohexyl]methyl]azanium;iodide 360569 NSC622700 resistant
hsa-miR-379-5p Varacin trifluoroacetate salt 54611558 NSC722218 resistant
hsa-miR-379-5p Vorinostat 5311 NSC701852 approved resistant
hsa-miR-379-5p Xestin a 5352066 NSC647638 resistant
hsa-miR-379-5p Xk-469 148183 NSC656889 sensitive
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved resistant High Small Cell Lung Cancer cell line (NCI-H69)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-379-5p Vorinostat 5311 NSC701852 approved sensitive Low Malignant Pleural Mesothelioma cell line (MESO1)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-379-5p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Fluorouracil 3385 NSC19893 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-379-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-379-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-379-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-379-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-379-5p Bromocriptine 31101 NSC169774 approved resistant High Prolactinoma tissue
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-379-5p Ruxolitinib 25126798 NSC763371 approved resistant Low Myelofibrosis tissue
hsa-miR-379-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562, KU812)
hsa-miR-379-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-379-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-379-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-379-5p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-379-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (HCT116)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-379-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-379-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-379-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-379-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (K562)
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR20)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-379-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-379-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission