pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-499a |
Genomic Coordinates | chr20: 34990376 - 34990497 |
Description | Homo sapiens miR-499a stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-499a-3p | ||||||||||||||||||||||||||||||
Sequence | 70| AACAUCACAGCAAGUCUGUGCU |91 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Cloned | DRVs in miRNA |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TSC22D3 | ||||||||||||||||||||
Synonyms | DIP, DSIPI, GILZ, TSC-22R | ||||||||||||||||||||
Description | TSC22 domain family member 3 | ||||||||||||||||||||
Transcript | NM_198057 | ||||||||||||||||||||
Other Transcripts | NM_004089 , NM_001015881 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on TSC22D3 | |||||||||||||||||||||
3'UTR of TSC22D3 (miRNA target sites are highlighted) |
>TSC22D3|NM_198057|3'UTR 1 GTGGCTCTGTCCTCAGGGTGGGCAGAGCCACTAAACTTGTTTTACCTAGTTCTTTCCAGTTTGTTTTTGGCTCCCCAAGC 81 ATCATCTCACGAGGAGAACTTTACACCTAGCACAGCTGGTGCCAAGAGATGTCCTAAGGACATGGCCACCTGGGTCCACT 161 CCAGCGACAGACCCCTGACAAGAGCAGGTCTCTGGAGGCTGAGTTGCATGGGGCCTAGTAACACCAAGCCAGTGAGCCTC 241 TAATGCTACTGCGCCCTGGGGGCTCCCAGGGCCTGGGCAACTTAGCTGCAACTGGCAAAGGAGAAGGGTAGTTTGAGGTG 321 TGACACCAGTTTGCTCCAGAAAGTTTAAGGGGTCTGTTTCTCATCTCCATGGACATCTTCAACAGCTTCACCTGACAACG 401 ACTGTTCCTATGAAGAAGCCACTTGTGTTTTAAGCAGAGGCAACCTCTCTCTTCTCCTCTGTTTCGTGAAGGCAGGGGAC 481 ACAGATGGGAGAGATTGAGCCAAGTCAGCCTTCTGTTGGTTAATATGGTATAATGCATGGCTTTGTGCACAGCCCAGTGT 561 GGGATTACAGCTTTGGGATGACCGCTTACAAAGTTCTGTTTGGTTAGTATTGGCATAGTTTTTCTATATAGCCATAAATG 641 CGTATATATACCCATAGGGCTAGATCTGTATCTTAGTGTAGCGATGTATACATATACACATCCACCTACATGTTGAAGGG 721 CCTAACCAGCCTTGGGAGTATTGACTGGTCCCTTACCTCTTATGGCTAAGTCTTTGACTGTGTTCATTTACCAAGTTGAC 801 CCAGTTTGTCTTTTAGGTTAAGTAAGACTCGAGAGTAAAGGCAAGGAGGGGGGCCAGCCTCTGAATGCGGCCACGGATGC 881 CTTGCTGCTGCAACCCTTTCCCCAGCTGTCCACTGAAACGTGAAGTCCTGTTTTGAATGCCAAACCCACCATTCACTGGT 961 GCTGACTACATAGAATGGGGTTGAGAGAAGATCAGTTTGGGCTTCACAGTGTCATTTGAAAACGTTTTTTGTTTTGTTTT 1041 GTAATTATTGTGGAAAACTTTCAAGTGAACAGAAGGATGGTGTCCTACTGTGGATGAGGGATGAACAAGGGGATGGCTTT 1121 GATCCAATGGAGCCTGGGAGGTGTGCCCAGAAAGCTTGTCTGTAGCGGGTTTTGTGAGAGTGAACACTTTCCACTTTTTG 1201 ACACCTTATCCTGATGTATGGTTCCAGGATTTGGATTTTGATTTTCCAAATGTAGCTTGAAATTTCAATAAACTTTGCTC 1281 TGTTTTTCTAAAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 1831.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | TZM-bl | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000372390.4 | 3UTR | AACACUUUCCACUUUUUGACACCUUAUCCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000372390.4 | 3UTR | AACACUUUCCACUUUUUGACACCUUAUCCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
59 hsa-miR-499a-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT130131 | TXNIP | thioredoxin interacting protein | 2 | 2 | ||||||||
MIRT133678 | ETNK1 | ethanolamine kinase 1 | 2 | 2 | ||||||||
MIRT252103 | NAPG | NSF attachment protein gamma | 2 | 2 | ||||||||
MIRT260160 | IGFBP4 | insulin like growth factor binding protein 4 | 2 | 2 | ||||||||
MIRT388009 | DR1 | down-regulator of transcription 1 | 2 | 2 | ||||||||
MIRT441692 | ABLIM1 | actin binding LIM protein 1 | 2 | 6 | ||||||||
MIRT447799 | EPC2 | enhancer of polycomb homolog 2 | 2 | 2 | ||||||||
MIRT450657 | STYX | serine/threonine/tyrosine interacting protein | 2 | 4 | ||||||||
MIRT456843 | ZNF460 | zinc finger protein 460 | 2 | 2 | ||||||||
MIRT464134 | VPS35 | VPS35, retromer complex component | 2 | 2 | ||||||||
MIRT465101 | TSC22D3 | TSC22 domain family member 3 | 2 | 4 | ||||||||
MIRT470051 | PTGFRN | prostaglandin F2 receptor inhibitor | 2 | 2 | ||||||||
MIRT474146 | LIMA1 | LIM domain and actin binding 1 | 2 | 6 | ||||||||
MIRT474153 | LIFR | LIF receptor alpha | 2 | 2 | ||||||||
MIRT485327 | MYO1D | myosin ID | 2 | 2 | ||||||||
MIRT496403 | ZSCAN16 | zinc finger and SCAN domain containing 16 | 2 | 2 | ||||||||
MIRT497280 | MAF | MAF bZIP transcription factor | 2 | 2 | ||||||||
MIRT500970 | SPTSSA | serine palmitoyltransferase small subunit A | 2 | 2 | ||||||||
MIRT501536 | POM121C | POM121 transmembrane nucleoporin C | 2 | 6 | ||||||||
MIRT505174 | WDR76 | WD repeat domain 76 | 2 | 4 | ||||||||
MIRT505203 | UQCRB | ubiquinol-cytochrome c reductase binding protein | 2 | 4 | ||||||||
MIRT506745 | LIN54 | lin-54 DREAM MuvB core complex component | 2 | 4 | ||||||||
MIRT506799 | KLHL15 | kelch like family member 15 | 2 | 6 | ||||||||
MIRT525718 | DCAF12L2 | DDB1 and CUL4 associated factor 12 like 2 | 2 | 2 | ||||||||
MIRT530014 | SRRM1 | serine and arginine repetitive matrix 1 | 2 | 2 | ||||||||
MIRT531457 | PROSER2 | proline and serine rich 2 | 2 | 2 | ||||||||
MIRT532272 | CD93 | CD93 molecule | 2 | 2 | ||||||||
MIRT538715 | CAPRIN2 | caprin family member 2 | 2 | 4 | ||||||||
MIRT547356 | NAT8L | N-acetyltransferase 8 like | 2 | 2 | ||||||||
MIRT551468 | TRIM59 | tripartite motif containing 59 | 2 | 2 | ||||||||
MIRT555444 | NT5C3A | 5'-nucleotidase, cytosolic IIIA | 2 | 2 | ||||||||
MIRT555674 | PGAM4 | phosphoglycerate mutase family member 4 | 2 | 4 | ||||||||
MIRT557816 | FOXO1 | forkhead box O1 | 2 | 2 | ||||||||
MIRT557853 | FIGN | fidgetin, microtubule severing factor | 2 | 2 | ||||||||
MIRT557880 | FEM1B | fem-1 homolog B | 2 | 4 | ||||||||
MIRT562299 | GLO1 | glyoxalase I | 2 | 2 | ||||||||
MIRT563245 | QRFPR | pyroglutamylated RFamide peptide receptor | 2 | 2 | ||||||||
MIRT565571 | SLC7A2 | solute carrier family 7 member 2 | 2 | 2 | ||||||||
MIRT566214 | PTMA | prothymosin, alpha | 2 | 2 | ||||||||
MIRT575544 | Map4 | microtubule-associated protein 4 | 2 | 2 | ||||||||
MIRT609316 | FXYD6 | FXYD domain containing ion transport regulator 6 | 2 | 2 | ||||||||
MIRT609362 | ACOT2 | acyl-CoA thioesterase 2 | 2 | 2 | ||||||||
MIRT611163 | BTLA | B and T lymphocyte associated | 2 | 4 | ||||||||
MIRT611749 | CACNA1B | calcium voltage-gated channel subunit alpha1 B | 2 | 2 | ||||||||
MIRT615019 | ELK4 | ELK4, ETS transcription factor | 2 | 2 | ||||||||
MIRT623317 | MAPK1 | mitogen-activated protein kinase 1 | 2 | 2 | ||||||||
MIRT624550 | BMPR1A | bone morphogenetic protein receptor type 1A | 2 | 2 | ||||||||
MIRT633934 | DNAH9 | dynein axonemal heavy chain 9 | 2 | 2 | ||||||||
MIRT635691 | BMP10 | bone morphogenetic protein 10 | 2 | 2 | ||||||||
MIRT646438 | DNAH8 | dynein axonemal heavy chain 8 | 2 | 2 | ||||||||
MIRT651940 | UBN1 | ubinuclein 1 | 2 | 2 | ||||||||
MIRT663605 | TBC1D22A | TBC1 domain family member 22A | 2 | 2 | ||||||||
MIRT689759 | PRR13 | proline rich 13 | 2 | 2 | ||||||||
MIRT691916 | SRXN1 | sulfiredoxin 1 | 2 | 2 | ||||||||
MIRT698678 | TEF | TEF, PAR bZIP transcription factor | 2 | 2 | ||||||||
MIRT700924 | PDS5A | PDS5 cohesin associated factor A | 2 | 2 | ||||||||
MIRT707970 | PDE12 | phosphodiesterase 12 | 2 | 2 | ||||||||
MIRT715290 | CSTF1 | cleavage stimulation factor subunit 1 | 2 | 2 | ||||||||
MIRT722414 | RARS2 | arginyl-tRNA synthetase 2, mitochondrial | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|