>TRPV2|NM_016113|3'UTR
   1 TGGCCCAGATGCAGCAGGAGGCCAGAGGACAGAGCAGAGGATCTTTCCAACCACATCTGCTGGCTCTGGGGTCCCAGTGA
  81 ATTCTGGTGGCAAATATATATTTTCACTAACTAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ccGU-AUGUUAGAC-------UGUACAUa 5' || |: | |||| |:|| || Target 5' ccCAGTGAATTCTGGTGGCAAATATATAt 3'	73 - 101	99.00	-8.40

Mutant ID	Mutant Position	Mutant Source
COSN30539631	23	COSMIC
COSN28726597	91	COSMIC
COSN6653232	114	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1238784831	4	dbSNP
rs529500225	11	dbSNP
rs767154927	13	dbSNP
rs752453301	14	dbSNP
rs755555835	17	dbSNP
rs1483647419	18	dbSNP
rs1459992564	22	dbSNP
rs777379985	22	dbSNP
rs750854811	29	dbSNP
rs1418651615	35	dbSNP
rs1158161494	36	dbSNP
rs1412509166	38	dbSNP
rs542808221	39	dbSNP
rs909632553	40	dbSNP
rs937114354	51	dbSNP
rs1358459694	52	dbSNP
rs1240964687	64	dbSNP
rs376388597	65	dbSNP
rs1037978797	68	dbSNP
rs1205803618	71	dbSNP
rs1438769987	72	dbSNP
rs1275669660	84	dbSNP
rs1055450489	96	dbSNP
rs895373032	106	dbSNP
rs1292568306	107	dbSNP
rs1248347642	108	dbSNP
rs7214366	114	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.