>TRIM28|NM_005762|3'UTR
   1 GGCTGGAGCCCCCATGGCCAGCCCAGCCTGGCTCTGTTCTCTGTCCTGTCACCCCATCCCCACTCCCCTGGTGGCCTGAC
  81 TCCCACTCCCTGGTGGCCCCATCCCCCAGTTCCTCACGATATGGTTTTTACTTCTGTGGATTTAATAAAAACTTCACCAG
 161 TTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuGGUGGUCGGGUGAGg 5' |||:| ||||||| Target 5' ccCCATC--CCCACTCc 3'	52 - 66	151.00	-20.80
2	miRNA 3' uuggUGGUC---GGGUGAGg 5' :|| | ||||||| Target 5' ggtgGCCTGACTCCCACTCc 3'	70 - 89	141.00	-17.70
3	miRNA 3' uuGGU---GGUCGGGUgagg 5' ||| |||||||| Target 5' ccCCATGGCCAGCCCAgcct 3'	10 - 29	103.00	-19.40

Mutant ID	Mutant Position	Mutant Source
COSN18742131	3	COSMIC
COSN30467223	14	COSMIC
COSN30495653	33	COSMIC
COSN30143572	42	COSMIC
COSN30122637	45	COSMIC
COSN30165427	51	COSMIC
COSN17526248	81	COSMIC
COSN30111990	119	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1471495874	3	dbSNP
rs1471338526	5	dbSNP
rs773482707	7	dbSNP
rs1804863	8	dbSNP
rs894091688	9	dbSNP
rs760744275	10	dbSNP
rs766605488	11	dbSNP
rs1363144040	13	dbSNP
rs759644091	15	dbSNP
rs964693228	16	dbSNP
rs1355927126	18	dbSNP
rs763989593	20	dbSNP
rs751501327	28	dbSNP
rs763680611	32	dbSNP
rs757068250	34	dbSNP
rs199796039	35	dbSNP
rs374610747	36	dbSNP
rs1357309886	37	dbSNP
rs1415727749	38	dbSNP
rs751236545	38	dbSNP
rs1049540	40	dbSNP
rs201545775	42	dbSNP
rs554790393	44	dbSNP
rs757521964	44	dbSNP
rs1202777563	45	dbSNP
rs1232636038	46	dbSNP
rs1462083732	47	dbSNP
rs1382853952	48	dbSNP
rs767892349	49	dbSNP
rs750801785	52	dbSNP
rs1384456460	55	dbSNP
rs574727580	56	dbSNP
rs1157247331	57	dbSNP
rs1471101128	61	dbSNP
rs1374442656	67	dbSNP
rs1176963064	69	dbSNP
rs998236579	85	dbSNP
rs1029592186	89	dbSNP
rs933056280	90	dbSNP
rs540486548	91	dbSNP
rs1260554744	94	dbSNP
rs1206408618	99	dbSNP
rs1366695055	103	dbSNP
rs560467863	104	dbSNP
rs1052882750	107	dbSNP
rs913039397	113	dbSNP
rs1427080455	118	dbSNP
rs947219457	119	dbSNP
rs532096313	121	dbSNP
rs1339924466	122	dbSNP
rs1043324562	123	dbSNP
rs1431510294	126	dbSNP
rs905788105	132	dbSNP
rs1318677262	135	dbSNP
rs1338945397	137	dbSNP
rs1242284411	138	dbSNP
rs1264603354	139	dbSNP
rs1359947807	141	dbSNP
rs545502140	153	dbSNP
rs1283879027	155	dbSNP
rs3177787	157	dbSNP
rs1487638583	158	dbSNP
rs745342751	159	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.