>PRICKLE4|NM_013397|3'UTR
   1 TGGCGCAGCTCAGAGAGGGGATGTGAGTGGGAGGAAAGGGGTCTGTAAAGCGGGAGAACAAGGCTAGCCTCCCCCTAACA
  81 ATCCTAGACTGAGACGCAGTCAGGCGCACGCCCGCAAGAGGCGGCGAGGTGACAAGTTTGGAGTGCGCCCCCTTCAGTAC
 161 TGCGCGTTCTAAGACTTTTGGCGGAGACTTTCTTGGCAAAACCCATTCCCCAAAGCTACGCTTCCCCTGCTGAGATAGCC
 241 CCT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cgUGAGUUU--GACA-CCCCCGUGaa 5' ||| |:| | || || |||| Target 5' agACTGAGACGCAGTCAGGCGCACgc 3'	86 - 111	107.00	-12.60
2	miRNA 3' cguGAGUUUG-ACACC-CCCGUGAa 5' || |:|| | ||| || ||| Target 5' gttCTAAGACTTTTGGCGGAGACTt 3'	166 - 190	100.00	-11.40
3	miRNA 3' cgugaGUUUGACACC-CCCGUGaa 5' |||::| ||| | ||:| Target 5' ggtgaCAAGTT-TGGAGTGCGCcc 3'	128 - 150	93.00	-10.90

Mutant ID	Mutant Position	Mutant Source
COSN20075727	46	COSMIC
COSN30541655	68	COSMIC
COSN28389902	102	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs140206688	1	dbSNP
rs1202181908	5	dbSNP
rs1352279262	9	dbSNP
rs1033954946	10	dbSNP
rs1424931107	11	dbSNP
rs776303758	12	dbSNP
rs780098395	12	dbSNP
rs749180792	14	dbSNP
rs768219471	15	dbSNP
rs925093123	16	dbSNP
rs937953529	17	dbSNP
rs1170864682	19	dbSNP
rs1402041908	20	dbSNP
rs1461683180	23	dbSNP
rs773680723	30	dbSNP
rs761583315	32	dbSNP
rs771887907	35	dbSNP
rs772972498	38	dbSNP
rs760033397	39	dbSNP
rs765511480	40	dbSNP
rs369900495	41	dbSNP
rs764256600	42	dbSNP
rs751552309	43	dbSNP
rs1320294428	45	dbSNP
rs1405190631	45	dbSNP
rs757297714	52	dbSNP
rs1245023951	55	dbSNP
rs1464638684	58	dbSNP
rs1460403960	60	dbSNP
rs1210686740	62	dbSNP
rs114149714	70	dbSNP
rs1284861737	71	dbSNP
rs542473697	74	dbSNP
rs911725618	75	dbSNP
rs148246944	76	dbSNP
rs1471363061	77	dbSNP
rs1157150888	86	dbSNP
rs1276436734	88	dbSNP
rs943230290	90	dbSNP
rs1364029700	91	dbSNP
rs576307756	96	dbSNP
rs1317880992	98	dbSNP
rs1410796837	106	dbSNP
rs774037887	110	dbSNP
rs1175950793	116	dbSNP
rs1413309450	125	dbSNP
rs996451929	125	dbSNP
rs1449029477	126	dbSNP
rs974620238	127	dbSNP
rs544970992	128	dbSNP
rs925876800	139	dbSNP
rs1486225064	152	dbSNP
rs1237024060	153	dbSNP
rs867883264	158	dbSNP
rs564766125	161	dbSNP
rs988849037	162	dbSNP
rs1280405941	164	dbSNP
rs1329468289	167	dbSNP
rs1341283680	172	dbSNP
rs1294930269	176	dbSNP
rs1436892581	179	dbSNP
rs1362003394	181	dbSNP
rs891511207	190	dbSNP
rs1301789531	192	dbSNP
rs949775208	193	dbSNP
rs1446399225	209	dbSNP
rs1337392691	211	dbSNP
rs527344681	212	dbSNP
rs1045544526	214	dbSNP
rs1174580948	225	dbSNP
rs1236658098	227	dbSNP
rs1429507088	228	dbSNP
rs1388763640	237	dbSNP
rs1170690442	244	dbSNP
rs1287436639	245	dbSNP
rs950048668	245	dbSNP
rs868212923	250	dbSNP
rs981354339	251	dbSNP
rs1429378196	252	dbSNP
rs1413111610	255	dbSNP
rs1002401169	259	dbSNP
rs1482198572	265	dbSNP
rs968857858	266	dbSNP
rs1224324419	269	dbSNP
rs1482593266	271	dbSNP
rs61204852	273	dbSNP
rs1460028003	274	dbSNP
rs899428665	279	dbSNP
rs937817665	287	dbSNP
rs186466462	300	dbSNP
rs369681988	306	dbSNP
rs994807522	315	dbSNP
rs1251905686	317	dbSNP
rs990704059	322	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.