miRTarBase - #MIRT465802


—
pre-miRNA Information
pre-miRNA hsa-mir-378g   
Genomic Coordinates chr1: 94745860 - 94745900
Description Homo sapiens miR-378g stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-378g
Sequence 2| ACUGGGCUUGGAGUCAGAAG |21
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TMEM91   
Synonyms DSPC3, IFITMD6
Description transmembrane protein 91
Transcript NM_001042595   
Other Transcripts NM_001098821 , NM_001098822 , NM_001098823 , NM_001098824 , NM_001098825   
Expression
Putative miRNA Targets on TMEM91
3'UTR of TMEM91
(miRNA target sites are highlighted)		 
>TMEM91|NM_001042595|3'UTR
   1 ATGAATGAATGGGTATGTTGGGTGGGGGAGGGACCAGGGGAAGGGTCTGGGACTGAGGGGATGCCTGGGTCACTGCTGCC
  81 CACTGCCTCTACAGACCAACAAGGCTTGGGCCAAGGGGGACATCCAGGGGGCAGGGGCCGCCTCCCGCCGTGCCTTCCTG
 161 CTGGGGGTCCTCGCCGTCGGGCTGGGCGTGTGCACGTATGCGGCTGCCCTGGTGACCCTGGCTGCCTACCTTGCCTCCCG
 241 AGACCCGCCCTAGTTGCCCCTACAGCCCTCACTGTGAACCCTGAGGCCGGCAGCCCAGCAAATCTGTGGGCAGAGAGTGG
 321 AGAATCTTGGTGGATGAGGCTGCGGCGGCGGCAGGAGCATCTAGAAACGGGAGCGAGCTGGACTGGAACCCTTCCCCTTC
 401 CTGGCCACCGCTCTTCGGGCGGCAGCAACCTGAGATTAAACACCAGACACCCTTGCAGCCAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaaGACUGAGGU--UCGGGUCa 5'
             ||||  ||:  ||||||| 
Target 5' accCTGAGGCCGGCAGCCCAGc 3'
 278 - 299 155.00 -20.40
2 
miRNA  3' gaaGACUGAGGU-UCGGGuca 5'
             :|| | |:| |||||   
Target 5' tagTTGCCCCTACAGCCCtca 3'
 251 - 271 113.00 -9.82
3 
miRNA  3' gaaGACUGAGGU-UCGGGUca 5'
             ||| |||:| || |||  
Target 5' ccaCTGCCTCTACAGACCAac 3'
 80 - 100 113.00 -11.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM3378754 1 COSMIC
COSN30167701 8 COSMIC
COSN26999159 29 COSMIC
COSN30158859 44 COSMIC
COSN22530858 45 COSMIC
COSN30520718 50 COSMIC
COSN30520640 51 COSMIC
COSN31579561 76 COSMIC
COSM8967142 87 COSMIC
COSM4078527 99 COSMIC
COSM1724675 127 COSMIC
COSM8220616 130 COSMIC
COSM1525195 134 COSMIC
COSM4665369 137 COSMIC
COSM1241835 138 COSMIC
COSM6804418 140 COSMIC
COSM9270710 179 COSMIC
COSM3227042 188 COSMIC
COSM4639456 196 COSMIC
COSM6804416 201 COSMIC
COSM1229765 202 COSMIC
COSM439591 219 COSMIC
COSM4769908 224 COSMIC
COSM3227043 225 COSMIC
COSM8338192 238 COSMIC
COSM8111155 240 COSMIC
COSM7636341 247 COSMIC
COSM7480900 262 COSMIC
COSM8183045 269 COSMIC
COSM8968210 272 COSMIC
COSM6371848 280 COSMIC
COSM7711699 284 COSMIC
COSN30507633 300 COSMIC
COSN30766899 301 COSMIC
COSN31590288 305 COSMIC
COSN30147180 314 COSMIC
COSN30148963 316 COSMIC
COSN30116237 439 COSMIC
rs12602 224 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1038393300 1 dbSNP
rs756259847 14 dbSNP
rs778126120 19 dbSNP
rs369444619 25 dbSNP
rs1222653968 26 dbSNP
rs1308372885 29 dbSNP
rs771146212 31 dbSNP
rs1262471253 34 dbSNP
rs201153238 35 dbSNP
rs1262898521 38 dbSNP
rs746407613 44 dbSNP
rs1453163808 46 dbSNP
rs915624269 48 dbSNP
rs376346709 58 dbSNP
rs1231340348 68 dbSNP
rs775691395 77 dbSNP
rs1209428360 81 dbSNP
rs761138502 83 dbSNP
rs1412673426 85 dbSNP
rs754822203 97 dbSNP
rs769323826 98 dbSNP
rs371034770 99 dbSNP
rs772973298 102 dbSNP
rs765907516 104 dbSNP
rs558264508 109 dbSNP
rs1387660665 111 dbSNP
rs374756920 114 dbSNP
rs759451808 116 dbSNP
rs1455485690 117 dbSNP
rs767484066 121 dbSNP
rs1222219646 124 dbSNP
rs1056590556 126 dbSNP
rs765438270 126 dbSNP
rs1022545006 127 dbSNP
rs752432063 128 dbSNP
rs376963407 129 dbSNP
rs561075750 133 dbSNP
rs757371463 134 dbSNP
rs779155194 136 dbSNP
rs745989540 140 dbSNP
rs370308690 141 dbSNP
rs752852293 141 dbSNP
rs978053175 144 dbSNP
rs1489860566 147 dbSNP
rs200464270 148 dbSNP
rs780674696 150 dbSNP
rs1478249511 151 dbSNP
rs1174075578 153 dbSNP
rs747318833 154 dbSNP
rs1417007139 155 dbSNP
rs769071940 160 dbSNP
rs1463643031 163 dbSNP
rs1422804121 164 dbSNP
rs1177013452 166 dbSNP
rs549829309 173 dbSNP
rs748965543 174 dbSNP
rs1352795534 175 dbSNP
rs758663714 175 dbSNP
rs770623333 175 dbSNP
rs374646225 176 dbSNP
rs759114491 177 dbSNP
rs368069337 179 dbSNP
rs775513043 180 dbSNP
rs1268768016 181 dbSNP
rs1022841364 182 dbSNP
rs763979713 185 dbSNP
rs868374108 187 dbSNP
rs565098119 188 dbSNP
rs370880269 189 dbSNP
rs375697615 190 dbSNP
rs368417249 196 dbSNP
rs1357398278 197 dbSNP
rs765595742 200 dbSNP
rs199845315 202 dbSNP
rs758607955 203 dbSNP
rs867206969 204 dbSNP
rs780365487 207 dbSNP
rs12602 224 dbSNP
rs1474923258 225 dbSNP
rs375951906 228 dbSNP
rs1391583498 240 dbSNP
rs781598296 241 dbSNP
rs748552617 245 dbSNP
rs770570170 246 dbSNP
rs1032654429 247 dbSNP
rs777669052 247 dbSNP
rs774051197 248 dbSNP
rs1316772241 249 dbSNP
rs1326221691 251 dbSNP
rs1436210223 254 dbSNP
rs747148407 256 dbSNP
rs1470410418 257 dbSNP
rs757674912 257 dbSNP
rs745326396 260 dbSNP
rs1266092513 264 dbSNP
rs1243752301 265 dbSNP
rs781777119 265 dbSNP
rs771613620 266 dbSNP
rs1281996719 267 dbSNP
rs746223414 271 dbSNP
rs955737617 271 dbSNP
rs1212352588 273 dbSNP
rs775247572 280 dbSNP
rs768520651 284 dbSNP
rs1249550657 288 dbSNP
rs776535742 289 dbSNP
rs761766971 290 dbSNP
rs536286607 296 dbSNP
rs1182779762 297 dbSNP
rs1473459544 298 dbSNP
rs372837215 300 dbSNP
rs554964802 300 dbSNP
rs750685614 301 dbSNP
rs762903276 306 dbSNP
rs1458131808 309 dbSNP
rs776008895 312 dbSNP
rs373909170 318 dbSNP
rs1404254739 321 dbSNP
rs1452181436 332 dbSNP
rs1011548891 335 dbSNP
rs1333479419 342 dbSNP
rs548185306 344 dbSNP
rs569638986 345 dbSNP
rs1260220332 347 dbSNP
rs911450418 348 dbSNP
rs1478880796 350 dbSNP
rs1471874181 351 dbSNP
rs1237000959 356 dbSNP
rs1194469955 361 dbSNP
rs1194462113 369 dbSNP
rs903458499 370 dbSNP
rs999105615 372 dbSNP
rs187440063 374 dbSNP
rs190642680 375 dbSNP
rs918577417 376 dbSNP
rs578158609 378 dbSNP
rs1376279797 386 dbSNP
rs929994846 391 dbSNP
rs1036306612 392 dbSNP
rs1293280368 397 dbSNP
rs1296101325 405 dbSNP
rs538850951 410 dbSNP
rs1013054034 411 dbSNP
rs1452753292 417 dbSNP
rs1287116150 418 dbSNP
rs1363977511 421 dbSNP
rs1413081289 422 dbSNP
rs1400097880 429 dbSNP
rs1022731251 443 dbSNP
rs117814242 443 dbSNP
rs1261744057 452 dbSNP
rs56755408 453 dbSNP
rs756842607 461 dbSNP
rs905753819 463 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaAGAC-UGAGGUUCGGGUCa 5'
            | || || |::|| ||:| 
Target 5' acUGUGAACCCUGAGGCCGGc 3'
 		13 - 33
2 
miRNA  3' gaagacuGAGGUUCGGGuca 5'
                 || | |||||   
Target 5' ------cCUAC-AGCCCuca 3'
 		1 - 13
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000539627.1 | 3UTR | ccuacagcccucacugugaacccugaGGCCGGCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
68 hsa-miR-378g Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT444739 SMYD1 SET and MYND domain containing 1 2 2
MIRT456104 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT458683 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT465802 TMEM91 transmembrane protein 91 2 2
MIRT470843 PLXND1 plexin D1 2 2
MIRT497263 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT497674 SYNGR1 synaptogyrin 1 2 2
MIRT498218 TLN2 talin 2 2 2
MIRT498309 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT504046 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT518196 CLEC4E C-type lectin domain family 4 member E 2 2
MIRT533143 WNT10A Wnt family member 10A 2 2
MIRT533540 TPR translocated promoter region, nuclear basket protein 2 2
MIRT533679 TMEM86A transmembrane protein 86A 2 2
MIRT540892 SRSF9 serine and arginine rich splicing factor 9 2 2
MIRT541329 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT541850 PLIN5 perilipin 5 2 2
MIRT551431 F2 coagulation factor II, thrombin 2 2
MIRT552105 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 2
MIRT564912 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT568605 ACVR2A activin A receptor type 2A 2 2
MIRT572604 PAPLN papilin, proteoglycan like sulfated glycoprotein 2 2
MIRT574234 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT575688 Map1b microtubule-associated protein 1B 2 2
MIRT576643 Mill2 MHC I like leukocyte 2 1 1
MIRT609877 RAD54L2 RAD54 like 2 2 4
MIRT610057 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610791 KLK2 kallikrein related peptidase 2 2 2
MIRT617175 GOSR2 golgi SNAP receptor complex member 2 2 2
MIRT617707 RUSC2 RUN and SH3 domain containing 2 2 2
MIRT620577 WBSCR27 methyltransferase like 27 2 4
MIRT622657 POU2F3 POU class 2 homeobox 3 2 4
MIRT624561 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT634255 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT634677 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT635254 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT637081 SELPLG selectin P ligand 2 2
MIRT639021 AAK1 AP2 associated kinase 1 2 2
MIRT640396 ZNF785 zinc finger protein 785 2 2
MIRT642441 CLUAP1 clusterin associated protein 1 2 2
MIRT645666 ADK adenosine kinase 2 2
MIRT646083 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT650513 UFM1 ubiquitin fold modifier 1 2 2
MIRT652474 TMEM181 transmembrane protein 181 2 2
MIRT652584 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654763 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 2
MIRT655200 PHAX phosphorylated adaptor for RNA export 2 2
MIRT658353 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT661820 PRPSAP1 phosphoribosyl pyrophosphate synthetase associated protein 1 2 2
MIRT662190 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT664375 CYB5A cytochrome b5 type A 2 2
MIRT665025 ELK1 ELK1, ETS transcription factor 2 2
MIRT666492 SBNO1 strawberry notch homolog 1 2 2
MIRT668480 EXOSC2 exosome component 2 2 2
MIRT682768 TMEM120B transmembrane protein 120B 2 2
MIRT689628 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT691846 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT696490 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT712480 FSTL3 follistatin like 3 2 2
MIRT712780 ZNF154 zinc finger protein 154 2 2
MIRT716607 MPPED1 metallophosphoesterase domain containing 1 2 2
MIRT719357 ITPKB inositol-trisphosphate 3-kinase B 2 2
MIRT719739 SLC39A11 solute carrier family 39 member 11 2 2
MIRT722569 C1orf95 stum, mechanosensory transduction mediator homolog 2 2
MIRT722838 C17orf102 chromosome 17 open reading frame 102 2 2
MIRT733138 LINC00963 long intergenic non-protein coding RNA 963 3 0
MIRT733139 CHI3L1 chitinase 3 like 1 3 0
MIRT736944 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-378g Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-378g Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-378g Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line
hsa-miR-378g Dabrafenib + Trametinib sensitive High Melanoma cell line
hsa-miR-378g Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line
hsa-mir-378g Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-378g Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-378g Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-378g Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-378g Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-378g Tripterygium wilfordii Hook F resistant tissue
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-378g Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-378g Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-378g Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission