pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4707 |
Genomic Coordinates | chr14: 22956950 - 22957029 |
Description | Homo sapiens miR-4707 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4707-3p | |||||||||||||||||||||||||||
Sequence | 52| AGCCCGCCCCAGCCGAGGUUCU |73 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | THRA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | AR7, CHNG6, EAR7, ERB-T-1, ERBA, ERBA1, NR1A1, THRA1, THRA2, c-ERBA-1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | thyroid hormone receptor, alpha | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_199334 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Transcripts | NM_003250 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on THRA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of THRA (miRNA target sites are highlighted) |
>THRA|NM_199334|3'UTR
1 AGCCTCAGGCGGCCAGAGGGTGTGCGGAGCTGGTGGGGAGGAGCCTGGAGAGAAGGGGCAGAGCTGGGGGCTGAGGGAGA
81 CCCCCCCACACCCCTTCTCTCCTTCCTCTCGTCCTTGGATAGATTCAGCTCCCACACACACACCCGCACTGCCCAGGTCC
161 CTCCTCAGACCTCCAGCCCTGGGACAGGGCAAACAACTGAACTTGCTATGGAAAGGACAGTGTGGGAGGCTGGGGGAGCT
241 GTGTCCTGCAGTTCCCAGGACCCCATCCTCTCAGAAGGTAGGGGAAGGGCGGGAGGATTGAGAAGGGACAAGCCACCTTG
321 ACCGTAGGGGAAGGAGGAATGTGGGCTGGGGGAAGATGCCCTCAACTCACCCCCTACACACACATGAGAGAGAGCCCCCA
401 CCCAGTTCCTTGGCCTAGGTCTCCCCTCCAGGCTGAGGGCCTCTCTACTTCCCCAGATGCCTGGGTGCAAAGAACGGCTT
481 GGCTTGGCTCCTCCTCTGGAGGTTAAAATTTATAGTCATTCTAACTGCACTTTGGAAACCAAGCAAGGGGAGAAGACAAA
561 TGAAGAAAAACTAGACAGAGAAAAAAAAAAAA
Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | TZM-bl | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000450525.2 | 3UTR | CUCCUACUCACUGCACUAACUCUGGGCGGGCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
91 hsa-miR-4707-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT442514 | SYT7 | synaptotagmin 7 | 2 | 4 | ||||||||
MIRT457799 | NQO2 | N-ribosyldihydronicotinamide:quinone reductase 2 | 2 | 2 | ||||||||
MIRT466318 | THRA | thyroid hormone receptor, alpha | 2 | 2 | ||||||||
MIRT486129 | TRAF3 | TNF receptor associated factor 3 | 2 | 2 | ||||||||
MIRT492341 | SEPT8 | septin 8 | 2 | 2 | ||||||||
MIRT495690 | KCNC3 | potassium voltage-gated channel subfamily C member 3 | 2 | 2 | ||||||||
MIRT496928 | DPYSL5 | dihydropyrimidinase like 5 | 2 | 2 | ||||||||
MIRT499518 | MAFK | MAF bZIP transcription factor K | 2 | 2 | ||||||||
MIRT501367 | REXO1 | RNA exonuclease 1 homolog | 2 | 4 | ||||||||
MIRT501636 | PIAS4 | protein inhibitor of activated STAT 4 | 2 | 4 | ||||||||
MIRT521071 | SLC25A16 | solute carrier family 25 member 16 | 2 | 2 | ||||||||
MIRT525700 | PCYT2 | phosphate cytidylyltransferase 2, ethanolamine | 2 | 2 | ||||||||
MIRT532722 | DDTL | D-dopachrome tautomerase like | 2 | 2 | ||||||||
MIRT533137 | WWC1 | WW and C2 domain containing 1 | 2 | 4 | ||||||||
MIRT537288 | G3BP1 | G3BP stress granule assembly factor 1 | 2 | 4 | ||||||||
MIRT570555 | PHF21B | PHD finger protein 21B | 2 | 2 | ||||||||
MIRT573469 | MTRNR2L9 | MT-RNR2-like 9 | 2 | 2 | ||||||||
MIRT576750 | Tmem127 | transmembrane protein 127 | 2 | 2 | ||||||||
MIRT609342 | DAAM2 | dishevelled associated activator of morphogenesis 2 | 2 | 2 | ||||||||
MIRT610638 | PIGM | phosphatidylinositol glycan anchor biosynthesis class M | 2 | 2 | ||||||||
MIRT612591 | RANGAP1 | Ran GTPase activating protein 1 | 2 | 2 | ||||||||
MIRT614237 | WDR53 | WD repeat domain 53 | 2 | 4 | ||||||||
MIRT622784 | PGK1 | phosphoglycerate kinase 1 | 2 | 2 | ||||||||
MIRT628880 | MED16 | mediator complex subunit 16 | 2 | 2 | ||||||||
MIRT629550 | SPN | sialophorin | 2 | 2 | ||||||||
MIRT634714 | DDX19B | DEAD-box helicase 19B | 2 | 2 | ||||||||
MIRT634932 | GTF2H2C | GTF2H2 family member C | 2 | 4 | ||||||||
MIRT635341 | RBL1 | RB transcriptional corepressor like 1 | 2 | 2 | ||||||||
MIRT637838 | CPT1A | carnitine palmitoyltransferase 1A | 2 | 2 | ||||||||
MIRT644311 | NFKBID | NFKB inhibitor delta | 2 | 2 | ||||||||
MIRT649206 | KIAA1715 | lunapark, ER junction formation factor | 2 | 2 | ||||||||
MIRT657262 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | 2 | 2 | ||||||||
MIRT658919 | DPY19L4 | dpy-19 like 4 | 2 | 2 | ||||||||
MIRT663608 | SEC23B | Sec23 homolog B, coat complex II component | 2 | 2 | ||||||||
MIRT667425 | MFAP2 | microfibril associated protein 2 | 2 | 2 | ||||||||
MIRT667667 | KREMEN1 | kringle containing transmembrane protein 1 | 2 | 2 | ||||||||
MIRT668144 | GDPD1 | glycerophosphodiester phosphodiesterase domain containing 1 | 2 | 2 | ||||||||
MIRT668540 | ERGIC1 | endoplasmic reticulum-golgi intermediate compartment 1 | 2 | 2 | ||||||||
MIRT670039 | NFRKB | nuclear factor related to kappaB binding protein | 2 | 2 | ||||||||
MIRT670875 | RAB10 | RAB10, member RAS oncogene family | 2 | 2 | ||||||||
MIRT672694 | ZNF677 | zinc finger protein 677 | 2 | 2 | ||||||||
MIRT673107 | MFSD2A | major facilitator superfamily domain containing 2A | 2 | 2 | ||||||||
MIRT673508 | TNFAIP8L1 | TNF alpha induced protein 8 like 1 | 2 | 4 | ||||||||
MIRT674244 | NUP62 | nucleoporin 62 | 2 | 4 | ||||||||
MIRT676541 | IRGQ | immunity related GTPase Q | 2 | 2 | ||||||||
MIRT676787 | CXorf38 | chromosome X open reading frame 38 | 2 | 4 | ||||||||
MIRT677600 | PRKX | protein kinase, X-linked | 2 | 2 | ||||||||
MIRT678607 | MRPL17 | mitochondrial ribosomal protein L17 | 2 | 2 | ||||||||
MIRT678940 | MYADM | myeloid associated differentiation marker | 2 | 2 | ||||||||
MIRT679104 | CD99 | CD99 molecule (Xg blood group) | 2 | 2 | ||||||||
MIRT679196 | WNT2B | Wnt family member 2B | 2 | 2 | ||||||||
MIRT679325 | ZMYM4 | zinc finger MYM-type containing 4 | 2 | 2 | ||||||||
MIRT679634 | BRMS1L | breast cancer metastasis-suppressor 1 like | 2 | 2 | ||||||||
MIRT679819 | TMEM106B | transmembrane protein 106B | 2 | 2 | ||||||||
MIRT679898 | FBXO48 | F-box protein 48 | 2 | 2 | ||||||||
MIRT680579 | ZNF784 | zinc finger protein 784 | 2 | 2 | ||||||||
MIRT680600 | SZT2 | SZT2, KICSTOR complex subunit | 2 | 2 | ||||||||
MIRT682991 | RNF40 | ring finger protein 40 | 2 | 4 | ||||||||
MIRT683483 | ZNF7 | zinc finger protein 7 | 2 | 2 | ||||||||
MIRT683681 | MICA | MHC class I polypeptide-related sequence A | 2 | 2 | ||||||||
MIRT684122 | CEP104 | centrosomal protein 104 | 2 | 2 | ||||||||
MIRT684774 | MYO1F | myosin IF | 2 | 2 | ||||||||
MIRT685698 | BHMT2 | betaine--homocysteine S-methyltransferase 2 | 2 | 2 | ||||||||
MIRT686471 | LINC00598 | long intergenic non-protein coding RNA 598 | 2 | 2 | ||||||||
MIRT687940 | HMGB1 | high mobility group box 1 | 2 | 2 | ||||||||
MIRT688627 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | 2 | 2 | ||||||||
MIRT689110 | ZBTB25 | zinc finger and BTB domain containing 25 | 2 | 2 | ||||||||
MIRT690063 | MBD1 | methyl-CpG binding domain protein 1 | 2 | 2 | ||||||||
MIRT691067 | NUGGC | nuclear GTPase, germinal center associated | 2 | 2 | ||||||||
MIRT691317 | KIAA1841 | KIAA1841 | 2 | 2 | ||||||||
MIRT692778 | SYNPO2L | synaptopodin 2 like | 2 | 2 | ||||||||
MIRT694087 | KIAA0930 | KIAA0930 | 2 | 2 | ||||||||
MIRT696148 | WDR59 | WD repeat domain 59 | 2 | 2 | ||||||||
MIRT696176 | GNB5 | G protein subunit beta 5 | 2 | 2 | ||||||||
MIRT696434 | SUGP1 | SURP and G-patch domain containing 1 | 2 | 2 | ||||||||
MIRT697974 | TSPAN6 | tetraspanin 6 | 2 | 2 | ||||||||
MIRT698917 | SPEM1 | spermatid maturation 1 | 2 | 2 | ||||||||
MIRT699312 | SLC35F5 | solute carrier family 35 member F5 | 2 | 4 | ||||||||
MIRT700500 | PTPN4 | protein tyrosine phosphatase, non-receptor type 4 | 2 | 2 | ||||||||
MIRT700557 | PTBP1 | polypyrimidine tract binding protein 1 | 2 | 2 | ||||||||
MIRT701817 | MRPL37 | mitochondrial ribosomal protein L37 | 2 | 2 | ||||||||
MIRT702045 | METTL21A | methyltransferase like 21A | 2 | 2 | ||||||||
MIRT702215 | LPCAT1 | lysophosphatidylcholine acyltransferase 1 | 2 | 2 | ||||||||
MIRT702337 | KLHL7 | kelch like family member 7 | 2 | 2 | ||||||||
MIRT704139 | DNAL1 | dynein axonemal light chain 1 | 2 | 2 | ||||||||
MIRT704189 | LDHD | lactate dehydrogenase D | 2 | 2 | ||||||||
MIRT705344 | ATP1B3 | ATPase Na+/K+ transporting subunit beta 3 | 2 | 2 | ||||||||
MIRT706097 | ENTPD4 | ectonucleoside triphosphate diphosphohydrolase 4 | 2 | 2 | ||||||||
MIRT709068 | FAHD1 | fumarylacetoacetate hydrolase domain containing 1 | 2 | 2 | ||||||||
MIRT717579 | VTA1 | vesicle trafficking 1 | 2 | 2 | ||||||||
MIRT722440 | ZBTB7B | zinc finger and BTB domain containing 7B | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|