| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-216a |
| Genomic Coordinates | chr2: 55988950 - 55989059 |
| Description | Homo sapiens miR-216a stem-loop |
| Comment | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences . |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-216a-5p | ||||||||||||||||||||||||
| Sequence | 19| UAAUCUCAGCUGGCAACUGUGA |40 | ||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||
| Experiments | Cloned | ||||||||||||||||||||||||
| Editing Events in miRNAs |
|
||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Biomarker Information |
| ||||||
|---|---|---|---|---|---|---|---|
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | TECPR2 | ||||||||||||||||||||
| Synonyms | KIAA0329, SPG49 | ||||||||||||||||||||
| Description | tectonin beta-propeller repeat containing 2 | ||||||||||||||||||||
| Transcript | NM_014844 | ||||||||||||||||||||
| Other Transcripts | NM_001172631 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on TECPR2 | |||||||||||||||||||||
| 3'UTR of TECPR2 (miRNA target sites are highlighted) |
>TECPR2|NM_014844|3'UTR 1 AGGAGCCCTGGCCGAGTCACGCGGAGGGGCCCGGCGTCTGTGGCGGGCACAGGGGCTTCAGAGTGACTCCCTGGTGGACG 81 CGCTGCCTCAACACTTGTCCAGACACCTCTGGCCAGGTTGGACCCGCACACTTACTTTCATCTATGTTGGTTTCTGTCTC 161 GTTCCAGAACCCACAGCCTCCACCCGTGGCTGGCGTGATTGCTGCAGCAGTGGCGCCTCCTAGCTCAGGACAGTGGCGAC 241 TGCCCGGCTGCATGCACTCCGATTACCCACGTGCTGCCGTCCTGGTCTCATCCACAGATAGCTCCAGCTTTTGTTGGTGG 321 GAGTGGTCTCCGGAGGCCTCCCAGAACCAAGGGTAGCCGGGCAGCTGGTTTGGCCCAGGGCCTCCTTCCACATTAGTAGC 401 CCCAGGGCCAGATGGAGCCAAAGGTCAGCTCTCTGCAGCGCGGGATGTGCTCGGTGATGGCTTTGTCCCATCATAGGGGG 481 GTGTCCCCCCAGAGACAAAGCTGCAGAGCACATTCCATGCCAGACGCTCTGGCCAGGAAGCTGAGGCCGGGCTTGAGAGG 561 AGAGCGCTGGCCATGCCAGGAGAGAACCCACGCACATGCACACCACAACACACAACACACCTCACCTCACACCACAGCAC 641 ACCTCACCACACCACACCGCACTGCACCATACCTCACCACATCTCACCACACCACAGCACACCTCACCACACAACACACC 721 ACACCCCACACCGCACTGCACCGCACCGCACCGCACCGTACCTCGCCACATCTCACCACACCACACCACACCACACCTCA 801 CTGCCCACACACGGCGCAGGCTGCCCGCCTCCTGGAGAGCACACTTCAGCTGAAACAGTAAAGCCTGATGGGTGCAAATG 881 GAACCTGGATGTGTGCACGTGTGTCCCAGGTAGGGACGGCACAGGAGGGTGCATGGGGCGTGGGGGAGCTGAGCAAGGGT 961 CGCTCACTTAGAAATGTCTTTGGAATGGTGTTTAACTAATGCTGCTGGCGGACATCCTAAAACCAGATGCATCCTCAGAG 1041 GACGAGTCTACTAATTATTGCCTTTGTTGTTGTATTACAAATCTGCATAAAATACCTCATTTCAAATCAAATCTTACAAA 1121 TTTAGAAGAGAGATATGTTTTCCGAAAACAGTGGAAGCCCTTTGTTCCTTCCCGGGTTTGTCCTGAGCCTGCACTGTCCT 1201 CGCCTGCAGCCTCAGAGGGGCAGGCATCCCCGCACAGACTTGACTGGCAGGGCGGTCACGGGACCTGCGGGCTGGCTCCG 1281 AGTGGCAGCCCATGCCTTCTGCGGGGTATGGGTTGACACTTGACAGGTTGAAACCAGTGCCTCTATGGACGGCTGCTGTG 1361 GCCCCTTCAGACAATGGGCAGTGCCCACCCCGCCCACTGGCATCTGCGTGTGAGGGCTAGGCCGCCCTGCCACACATCCC 1441 GCCCCCTCCCGGAGGCAGCTTCAGGACAGGACACCAGGCTGGCTGCTTTTTTTAGCCTGCCCCTGGCCCAGGCCCAGTCC 1521 TTGGTGTCAGGGAGCCCCCAGGCCGCAGGTGGAGGGTGATAAAATATGTTCTCTGACAGGACCCAGCCAGCCACATAGGT 1601 GGAGGTTTTCCATGTCCAAATGAGGTCAAGATGCCGAAATCCCAGATCTGACTTCACACTTCCCTTTTCTAGAACCTTTT 1681 GTAAAAGTTGGTGGCAGCAGAGGCAGCCCCAGGCCGGGCTGCATCTCTCTGTGTCTGTTGTGCCTTGCCCGGCGCCTCAC 1761 GGATGGCAAAGCTCTCCTCACCCATGGGACTGTAGTGCAATTAAACCCGCGTCTAGGTGATGCTTTTAAAGTTGTAGCTT 1841 CGTGCTTTGTACAGTTTTCTTTCTGGTTTTAATTTTTAGTTGTGCTTTGAGTCAGTGCAATAAACTAGACTTTTTCCAAA 1921 CCTGGCCGAGTGTGGTGCCTGAGCTGTGAGAAGTGTCCTCAGCCGACACTCACGAGGGCAGTGCAAGGGAGAACCTGCCA 2001 GCCCAGCCCCACCACAGGGAGAGTGCGTCAGCAGACCTGTCCTGGCCTGGCTGGTGTTGAAATACACACCGGTTTGCCCA 2081 AGTGGCTGTTATGGGGGAATGGCCGCTCCAGAGCTGGCTGTACCCCATGGTAGCCTCTGAGGAGGACGCTGTGGGGTGAG 2161 GTCCAGGGCTGCCTCCTCATGGAGCTGTGTGTGAGCAGGCGTTGGAGGGGTTCGAGCCCCTGGTTCTGTATCTTCAGCCA 2241 GCAAACGAAACCATATCGCAAACCAGAGCTGCTGGAAACCAGCACACGCAAAAGATGACGCCCAGCACAGCAGCAGGACA 2321 CACCATGTGCCAGGAAATGACCTCAGCAAGAAACCTCAGGCCGTGTGAAGAGCAGCAAAGCTTTCCAGAAGGCATAAAAG 2401 GAAACTTGAATAAAGGAAGATATGTTCCACATTCCTGGATGGAGGACTACACACATTATGGAAAGACCTCATTCTTTCCA 2481 AAGGAATTTATAGGTGTAGCTTGATTTCAGTTCAAATCCCCACTGGGATTGTTTTGTTGGGGCAGGCAGGGAGGAATAAT 2561 GTTAGTACCCACAAATGCCCATGACTGTGCCCAATGTGCTTCTCACCAGAGCCCTGCAAGGGGAAGTCTCATTAGCCCCT 2641 TGAGACTCAGAGAGGTTAGGTAACTTGCTCAAGGTCACACAGCACTGGGACTGGAAGCCAGCTCTGTAGAACTGCAGACC 2721 TGTGCTGTTTGATGCCTCCTCACTGTCCCGTCACTCCTGGGAAGAAGAAACGGGTGAGAACTGCTAAGTGATGACAGGTG 2801 GAGCCCCAGCAGGGGCCACTCTATTGAATGGCATGGCCCAGACCCTCGGAGGGCCAGGCAACAGGCTAGCAAGGCCCACA 2881 GGGAGGGAGCAGAATGGAGAGGGCATCTCAGATGCGCTTAAGGAGCGGCGGGGGCGGGGCATGGGGGGTGTCACAACTAA 2961 TGTGGCCACTGCTTCATTCTCTGGGCAAAATAATATTAAATGGATTAAAGAATCTAAAACCAGTGGGAAAACTGTCTGAT 3041 TTCTGGATGGCAAAGGCTTTCTAAACTCAAAAGTGATAGGACAAGCTACAGAGGAAAATAAGTACATAGATTTGATTTCT 3121 CCAAAATACAGAAATGCTGCTGGGCACAGTGATGTGCAGTTATAGTCCCAGCTACTTGGGAGGCCAAGGCAGGAGGATTA 3201 CTTGAGCCCAGGAGTTTGAGGCTGCAATGAACTATGATCACACCACTGCACTCCAGCCTCGGCGACAGAGCAAGACCTTG 3281 TTTCTCAAAAATAAATAAATAGAAGGAAATAAATGTAAAAATGCTGCAAATTAAAAACCTCAAAGAAGGGAAATAATTGC 3361 AACAAATGGGAATTGATGTTGAATATTTACCTTAAAAACCTATACAACAATAAGAGGAGTGCGCCCTTCAGCAGCATGTA 3441 TACAAAAATTGCAACGATACAGAGATTAGCATGGCCCCTGCACAAGGATGACTCGCAAATTCATAAAGCTTTCCATAAAT 3521 ATATTTATTAAAAACCAATAGGAGGAGCACTTCGAGTCGAGTGTAAGGGCCCTTCACAAAAGCAGAAGGAACACTGGCCC 3601 AAACCCCCAGCACCCCGGAAGCAGAGGTGAGATGGGAGCAGCTTGGGAGCCCCCCATTGGCGCCGCCCTACTGGGGAAGC 3681 CGGTCCGTACGTAGGCCTTGCATCTCGCCACCTCCACTTCTGTCCTCAAGAACAAGTCCTAGGTCAAGGGAAACAGCACA 3761 GCCTGTTTATAATTAGGAAACACTTAAAACAGCCTGGCATTTGGGAACAGCCATGTTAACGTGAGCAAATTCCTCTCATG 3841 AAATAGCCTGCAGCTATTAAGAAGCACGTGTGTGCAGGAAGCGGAGGCGCAGGACCTCACCGCGCCAGCGTGAAGTTCCC 3921 GGGCATGGTCATGAAAGCGTGGTTCTGTAAGAAATCAGAGGGAGAAAGGGAGAGAAGGGGGAGGGAGACAACCCAAACGT 4001 TGGAGGGTATTTGTTGTAAACTTCAAACTTTTGGCAGGTTTGAAATTTTTCATAACTCCGGGGAGGAGCAAGAGGGGTGA 4081 AAAGAAACAAGTTCTCTACTTGTGATCAGCAGCTGGTCATAGTGGTTGCCTGGAGTATATGCCTTTTTGTATCCTTTGAA 4161 TTTCCAGCCATGTAAATGTATTATTTATTCCAAAAATAAAGCAGATTTACATTTTAAAAATTCAAAAAAAAAAAAAAAAA 4241 A Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Disease | 9895.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | TZM-bl | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1395165. RNA binding protein: AGO. Condition:MCF7 AGO HITS-CLIP Replicate 3
... - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment. |
| Article |
- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al. - Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM1395165 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | MCF7 / MCF7 AGO HITS-CLIP Replicate 3 |
| Location of target site | ENST00000359520.7 | 3UTR | GAUUAGCAUGGCCCCUGCACAAGGAUGAC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24906430 / GSE57855 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM1013116 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | hMSC / hMSC-replicate-5 |
| Location of target site | ENST00000359520.7 | 3UTR | GAUUAGCAUGGCCCCUGCACAAGGAUGAC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24038734 / GSE41272 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000359520.7 | 3UTR | GAGAUUAGCAUGGCCCCUGCACAAGGAUGAC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000359520.7 | 3UTR | GAGAUUAGCAUGGCCCCUGCACAAGGAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
148 hsa-miR-216a-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT000534 | PTEN | phosphatase and tensin homolog |  |
|
|
|
4 | 3 | ||||
| MIRT005018 | SIRT1 | sirtuin 1 | |
|
|
3 | 1 | |||||
| MIRT005964 | CDC42 | cell division cycle 42 | |
|
2 | 1 | ||||||
| MIRT005969 | CD44 | CD44 molecule (Indian blood group) | |
|
2 | 1 | ||||||
| MIRT007154 | SMAD7 | SMAD family member 7 | |
1 | 1 | |||||||
| MIRT054887 | BECN1 | beclin 1 | |
|
|
|
|
5 | 3 | |||
| MIRT067588 | METAP2 | methionyl aminopeptidase 2 | |
|
2 | 6 | ||||||
| MIRT099144 | MYLIP | myosin regulatory light chain interacting protein | |
|
2 | 12 | ||||||
| MIRT162313 | TGFBR2 | transforming growth factor beta receptor 2 | |
|
2 | 2 | ||||||
| MIRT230668 | DFFA | DNA fragmentation factor subunit alpha | |
|
2 | 2 | ||||||
| MIRT256274 | PHAX | phosphorylated adaptor for RNA export | |
|
2 | 2 | ||||||
| MIRT386817 | RAD51L3-RFFL | RAD51L3-RFFL readthrough | |
|
2 | 2 | ||||||
| MIRT386825 | RFFL | ring finger and FYVE like domain containing E3 ubiquitin protein ligase | |
|
2 | 2 | ||||||
| MIRT438816 | HNF4A | hepatocyte nuclear factor 4 alpha | |
1 | 1 | |||||||
| MIRT464699 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | |
|
2 | 2 | ||||||
| MIRT465962 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | |
|
2 | 2 | ||||||
| MIRT466046 | TMEM189 | transmembrane protein 189 | |
|
2 | 2 | ||||||
| MIRT466482 | TECPR2 | tectonin beta-propeller repeat containing 2 | |
|
2 | 7 | ||||||
| MIRT472209 | NGFRAP1 | brain expressed X-linked 3 | |
|
2 | 4 | ||||||
| MIRT472562 | NACC1 | nucleus accumbens associated 1 | |
|
2 | 4 | ||||||
| MIRT478921 | CPS1 | carbamoyl-phosphate synthase 1 | |
|
2 | 2 | ||||||
| MIRT480121 | CALR | calreticulin | |
|
2 | 2 | ||||||
| MIRT497754 | OXGR1 | oxoglutarate receptor 1 | |
|
2 | 2 | ||||||
| MIRT497967 | TWISTNB | TWIST neighbor | |
|
2 | 2 | ||||||
| MIRT502882 | CDK4 | cyclin dependent kinase 4 | |
|
2 | 8 | ||||||
| MIRT510191 | MON1B | MON1 homolog B, secretory trafficking associated | |
|
2 | 4 | ||||||
| MIRT512407 | CD84 | CD84 molecule | |
|
2 | 2 | ||||||
| MIRT513739 | PSD3 | pleckstrin and Sec7 domain containing 3 | |
|
2 | 4 | ||||||
| MIRT526257 | DROSHA | drosha ribonuclease III | |
|
2 | 2 | ||||||
| MIRT528968 | FAM19A3 | family with sequence similarity 19 member A3, C-C motif chemokine like | |
|
2 | 2 | ||||||
| MIRT529599 | C6orf132 | chromosome 6 open reading frame 132 | |
|
2 | 2 | ||||||
| MIRT529776 | ZNF486 | zinc finger protein 486 | |
|
2 | 2 | ||||||
| MIRT530110 | PSAPL1 | prosaposin like 1 (gene/pseudogene) | |
|
2 | 2 | ||||||
| MIRT530504 | FADS6 | fatty acid desaturase 6 | |
|
2 | 2 | ||||||
| MIRT531437 | PAK1 | p21 (RAC1) activated kinase 1 | |
|
2 | 2 | ||||||
| MIRT534445 | SDR16C5 | short chain dehydrogenase/reductase family 16C member 5 | |
|
2 | 2 | ||||||
| MIRT537286 | GABPB1 | GA binding protein transcription factor beta subunit 1 | |
|
2 | 2 | ||||||
| MIRT538451 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | |
|
2 | 2 | ||||||
| MIRT543085 | ACTB | actin beta | |
|
2 | 2 | ||||||
| MIRT550982 | ZNF254 | zinc finger protein 254 | |
|
2 | 2 | ||||||
| MIRT556259 | MAPRE2 | microtubule associated protein RP/EB family member 2 | |
|
2 | 2 | ||||||
| MIRT556639 | LAMC1 | laminin subunit gamma 1 | |
|
2 | 2 | ||||||
| MIRT559127 | C11orf57 | chromosome 11 open reading frame 57 | |
|
2 | 2 | ||||||
| MIRT561405 | TUBB2A | tubulin beta 2A class IIa | |
|
2 | 2 | ||||||
| MIRT569677 | SEC23B | Sec23 homolog B, coat complex II component | |
|
2 | 4 | ||||||
| MIRT574660 | KLHL15 | kelch like family member 15 | |
|
2 | 2 | ||||||
| MIRT575030 | Tecpr2 | tectonin beta-propeller repeat containing 2 | |
|
2 | 5 | ||||||
| MIRT617683 | JRKL | JRK like | |
|
2 | 2 | ||||||
| MIRT618540 | SEMA5A | semaphorin 5A | |
|
2 | 2 | ||||||
| MIRT620805 | C1orf27 | chromosome 1 open reading frame 27 | |
|
2 | 2 | ||||||
| MIRT621569 | ZBTB7A | zinc finger and BTB domain containing 7A | |
|
2 | 2 | ||||||
| MIRT622133 | SP4 | Sp4 transcription factor | |
|
2 | 2 | ||||||
| MIRT624913 | CTCFL | CCCTC-binding factor like | |
|
2 | 2 | ||||||
| MIRT625010 | PAK4 | p21 (RAC1) activated kinase 4 | |
|
2 | 2 | ||||||
| MIRT626644 | ZNF551 | zinc finger protein 551 | |
|
2 | 2 | ||||||
| MIRT626646 | ATP5A1 | ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle | |
|
2 | 2 | ||||||
| MIRT626672 | NOM1 | nucleolar protein with MIF4G domain 1 | |
|
2 | 2 | ||||||
| MIRT627945 | NNT | nicotinamide nucleotide transhydrogenase | |
|
2 | 2 | ||||||
| MIRT627963 | NLK | nemo like kinase | |
|
2 | 2 | ||||||
| MIRT628767 | SRSF7 | serine and arginine rich splicing factor 7 | |
|
2 | 2 | ||||||
| MIRT629261 | KDM2B | lysine demethylase 2B | |
|
2 | 2 | ||||||
| MIRT629422 | ADM2 | adrenomedullin 2 | |
|
2 | 2 | ||||||
| MIRT630238 | SORD | sorbitol dehydrogenase | |
|
2 | 2 | ||||||
| MIRT631272 | CENPM | centromere protein M | |
|
2 | 4 | ||||||
| MIRT631793 | CLK4 | CDC like kinase 4 | |
|
2 | 2 | ||||||
| MIRT632058 | ATF7IP | activating transcription factor 7 interacting protein | |
|
2 | 2 | ||||||
| MIRT632485 | RPS15A | ribosomal protein S15a | |
|
2 | 2 | ||||||
| MIRT632611 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | |
|
2 | 2 | ||||||
| MIRT632708 | MTA3 | metastasis associated 1 family member 3 | |
|
2 | 2 | ||||||
| MIRT632815 | INO80 | INO80 complex subunit | |
|
2 | 2 | ||||||
| MIRT635956 | PLA2G12A | phospholipase A2 group XIIA | |
|
2 | 2 | ||||||
| MIRT636152 | UBXN2A | UBX domain protein 2A | |
|
2 | 2 | ||||||
| MIRT636899 | C5orf45 | MRN complex interacting protein | |
|
2 | 4 | ||||||
| MIRT636930 | AGAP9 | ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 | |
|
2 | 2 | ||||||
| MIRT637457 | ZNF324B | zinc finger protein 324B | |
|
2 | 2 | ||||||
| MIRT637900 | SLC19A3 | solute carrier family 19 member 3 | |
|
2 | 2 | ||||||
| MIRT639826 | ZNF638 | zinc finger protein 638 | |
|
2 | 2 | ||||||
| MIRT640445 | ERVMER34-1 | endogenous retrovirus group MER34 member 1, envelope | |
|
2 | 2 | ||||||
| MIRT640681 | ARSK | arylsulfatase family member K | |
|
2 | 2 | ||||||
| MIRT641611 | CAPN7 | calpain 7 | |
|
2 | 2 | ||||||
| MIRT641676 | AKR7A2 | aldo-keto reductase family 7 member A2 | |
|
2 | 2 | ||||||
| MIRT646786 | IL23R | interleukin 23 receptor | |
|
2 | 2 | ||||||
| MIRT648352 | A2ML1 | alpha-2-macroglobulin like 1 | |
|
2 | 2 | ||||||
| MIRT649144 | SPATA5 | spermatogenesis associated 5 | |
|
2 | 2 | ||||||
| MIRT649254 | TRIM65 | tripartite motif containing 65 | |
|
2 | 2 | ||||||
| MIRT652491 | TMEM178B | transmembrane protein 178B | |
|
2 | 2 | ||||||
| MIRT653308 | SMU1 | DNA replication regulator and spliceosomal factor | |
|
2 | 2 | ||||||
| MIRT653945 | SEPSECS | Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase | |
|
2 | 2 | ||||||
| MIRT654212 | RNF19B | ring finger protein 19B | |
|
2 | 2 | ||||||
| MIRT654839 | PPM1L | protein phosphatase, Mg2+/Mn2+ dependent 1L | |
|
2 | 2 | ||||||
| MIRT655159 | PHF21A | PHD finger protein 21A | |
|
2 | 2 | ||||||
| MIRT655316 | PDCD11 | programmed cell death 11 | |
|
2 | 2 | ||||||
| MIRT655375 | PAX3 | paired box 3 | |
|
2 | 2 | ||||||
| MIRT657301 | HOXB5 | homeobox B5 | |
|
2 | 2 | ||||||
| MIRT657593 | GRIN2A | glutamate ionotropic receptor NMDA type subunit 2A | |
|
2 | 2 | ||||||
| MIRT658460 | FAM117B | family with sequence similarity 117 member B | |
|
2 | 2 | ||||||
| MIRT658716 | ELOVL4 | ELOVL fatty acid elongase 4 | |
|
2 | 2 | ||||||
| MIRT661640 | UGT2B28 | UDP glucuronosyltransferase family 2 member B28 | |
|
2 | 2 | ||||||
| MIRT661712 | MTO1 | mitochondrial tRNA translation optimization 1 | |
|
2 | 4 | ||||||
| MIRT661833 | ZNF793 | zinc finger protein 793 | |
|
2 | 2 | ||||||
| MIRT663805 | BET1L | Bet1 golgi vesicular membrane trafficking protein like | |
|
2 | 2 | ||||||
| MIRT663884 | CXorf56 | chromosome X open reading frame 56 | |
|
2 | 2 | ||||||
| MIRT664672 | L2HGDH | L-2-hydroxyglutarate dehydrogenase | |
|
2 | 2 | ||||||
| MIRT665814 | TMEM168 | transmembrane protein 168 | |
|
2 | 2 | ||||||
| MIRT668159 | GDE1 | glycerophosphodiester phosphodiesterase 1 | |
|
2 | 2 | ||||||
| MIRT668430 | FAM20B | FAM20B, glycosaminoglycan xylosylkinase | |
|
2 | 2 | ||||||
| MIRT672306 | GP2 | glycoprotein 2 | |
|
2 | 2 | ||||||
| MIRT673101 | SYNPO2L | synaptopodin 2 like | |
|
2 | 2 | ||||||
| MIRT673437 | APAF1 | apoptotic peptidase activating factor 1 | |
|
2 | 2 | ||||||
| MIRT673584 | KDELC2 | KDEL motif containing 2 | |
|
2 | 2 | ||||||
| MIRT673718 | SLU7 | SLU7 homolog, splicing factor | |
|
2 | 2 | ||||||
| MIRT673777 | MRPL17 | mitochondrial ribosomal protein L17 | |
|
2 | 2 | ||||||
| MIRT674316 | IMP4 | IMP4, U3 small nucleolar ribonucleoprotein | |
|
2 | 2 | ||||||
| MIRT674820 | FAM229B | family with sequence similarity 229 member B | |
|
2 | 2 | ||||||
| MIRT675179 | BPTF | bromodomain PHD finger transcription factor | |
|
2 | 2 | ||||||
| MIRT675586 | WWC1 | WW and C2 domain containing 1 | |
|
2 | 2 | ||||||
| MIRT675812 | MED28 | mediator complex subunit 28 | |
|
2 | 2 | ||||||
| MIRT677632 | ALG1 | ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase | |
|
2 | 2 | ||||||
| MIRT683914 | PSMB9 | proteasome subunit beta 9 | |
|
2 | 2 | ||||||
| MIRT687135 | QPCTL | glutaminyl-peptide cyclotransferase like | |
|
2 | 2 | ||||||
| MIRT691973 | PLCXD1 | phosphatidylinositol specific phospholipase C X domain containing 1 | |
|
2 | 2 | ||||||
| MIRT693078 | AS3MT | arsenite methyltransferase | |
|
2 | 2 | ||||||
| MIRT694084 | RNASEH2B | ribonuclease H2 subunit B | |
|
2 | 2 | ||||||
| MIRT696292 | IER3IP1 | immediate early response 3 interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT696541 | C3 | complement C3 | |
|
2 | 2 | ||||||
| MIRT701955 | MITF | melanogenesis associated transcription factor | |
|
2 | 2 | ||||||
| MIRT703276 | GNG12 | G protein subunit gamma 12 | |
|
2 | 2 | ||||||
| MIRT706852 | DNAJB13 | DnaJ heat shock protein family (Hsp40) member B13 | |
|
2 | 2 | ||||||
| MIRT706993 | XPO5 | exportin 5 | |
|
2 | 2 | ||||||
| MIRT710716 | KRTAP6-1 | keratin associated protein 6-1 | |
|
2 | 2 | ||||||
| MIRT711305 | ACOX1 | acyl-CoA oxidase 1 | |
|
2 | 2 | ||||||
| MIRT711514 | ESCO1 | establishment of sister chromatid cohesion N-acetyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT711648 | LIPG | lipase G, endothelial type | |
|
2 | 2 | ||||||
| MIRT711772 | CCDC59 | coiled-coil domain containing 59 | |
|
2 | 2 | ||||||
| MIRT714280 | COQ7 | coenzyme Q7, hydroxylase | |
|
2 | 2 | ||||||
| MIRT715048 | PRPF38A | pre-mRNA processing factor 38A | |
|
2 | 2 | ||||||
| MIRT716934 | INCENP | inner centromere protein | |
|
2 | 2 | ||||||
| MIRT717220 | OTUD3 | OTU deubiquitinase 3 | |
|
2 | 2 | ||||||
| MIRT717865 | BICD2 | BICD cargo adaptor 2 | |
|
2 | 2 | ||||||
| MIRT718836 | SNX20 | sorting nexin 20 | |
|
2 | 2 | ||||||
| MIRT720243 | GPBP1 | GC-rich promoter binding protein 1 | |
|
2 | 2 | ||||||
| MIRT721969 | MCM8 | minichromosome maintenance 8 homologous recombination repair factor | |
|
2 | 2 | ||||||
| MIRT724000 | LMTK2 | lemur tyrosine kinase 2 | |
|
2 | 2 | ||||||
| MIRT725193 | SDAD1 | SDA1 domain containing 1 | |
|
2 | 2 | ||||||
| MIRT731669 | CBL | Cbl proto-oncogene | |
|
|
3 | 1 | |||||
| MIRT732776 | AQP4 | aquaporin 4 | |
|
|
3 | 0 | |||||
| MIRT733158 | ITGA5 | integrin subunit alpha 5 | |
1 | 0 | |||||||
| MIRT735623 | TLR4 | toll like receptor 4 | |
|
|
|
4 | 0 | ||||
| miRNA-Drug Associations | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|