>TAF1D|NM_024116|3'UTR
   1 CAGGATCATGAATGTCAAAGGTGAAGCATATAGAAAAAACGACTTCATAGAAATGAATAAAGATAAATGTGGATATATGT
  81 ACCAGTCTGGTGGTGAAGAAATTCTGAAACCCAGAACTTTATAACAAGAAAAAAAATTTTTAACCCTGTGAAGAAGTTTG
 161 TGAAAGAAACTTGTGAAGTAGTAATAATTAGAAAAAAAACCATTAAAACACCAGAGAAAATACATAGAAAAAAAAAAAAA
 241 AAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ucgACAAG----GACGACUu 5' ||| | ||| ||: Target 5' ataTGTACCAGTCTGGTGGt 3'	75 - 94	95.00	-7.00
2	miRNA 3' ucGACAA---GGACGACUu 5' :| || |||| ||| Target 5' aaTTTTTAACCCTG-TGAa 3'	135 - 152	94.00	-7.20
3	miRNA 3' ucgacaaGGACGACUu 5' |:|| ||| Target 5' aaagaaaCTTG-TGAa 3'	163 - 177	77.00	-5.20

Mutant ID	Mutant Position	Mutant Source
COSN30120347	15	COSMIC
COSN28186728	39	COSMIC
COSN31559267	60	COSMIC
COSN30487395	83	COSMIC
COSN26414229	96	COSMIC
COSN26414577	97	COSMIC
COSN30246231	100	COSMIC
COSN30180982	128	COSMIC
COSN8585043	129	COSMIC
COSN31513775	130	COSMIC
COSN31600353	134	COSMIC
COSN31537915	135	COSMIC
COSN13358298	137	COSMIC
COSN30111850	166	COSMIC
COSN30126432	222	COSMIC
COSN32134021	298	COSMIC
COSN5312372	335	COSMIC
COSN32064486	403	COSMIC
COSN29580179	486	COSMIC
COSN8879182	533	COSMIC
COSN10094700	559	COSMIC
COSN20243864	589	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1366631421	1	dbSNP
rs1162784798	9	dbSNP
rs1032849115	10	dbSNP
rs1371535847	12	dbSNP
rs1236038702	14	dbSNP
rs373782857	17	dbSNP
rs1283496648	18	dbSNP
rs777761872	21	dbSNP
rs772106590	22	dbSNP
rs1463692382	26	dbSNP
rs748163425	27	dbSNP
rs779038029	29	dbSNP
rs1470267853	31	dbSNP
rs755030154	32	dbSNP
rs1243442396	33	dbSNP
rs897917918	34	dbSNP
rs550189701	35	dbSNP
rs377763823	40	dbSNP
rs753615994	40	dbSNP
rs150792429	41	dbSNP
rs750751674	46	dbSNP
rs187258869	47	dbSNP
rs767934267	50	dbSNP
rs758421732	63	dbSNP
rs1174732988	68	dbSNP
rs1195712011	68	dbSNP
rs900157968	72	dbSNP
rs1433133503	73	dbSNP
rs1469656484	74	dbSNP
rs1159224185	81	dbSNP
rs909257726	82	dbSNP
rs1265807980	85	dbSNP
rs1179347920	87	dbSNP
rs775209946	96	dbSNP
rs1048293498	99	dbSNP
rs937940457	102	dbSNP
rs926441403	103	dbSNP
rs982365155	105	dbSNP
rs929128272	107	dbSNP
rs138069553	110	dbSNP
rs369538505	110	dbSNP
rs1039233990	112	dbSNP
rs1353727178	114	dbSNP
rs185591721	117	dbSNP
rs1469149150	118	dbSNP
rs890655559	120	dbSNP
rs543075610	121	dbSNP
rs1325919557	126	dbSNP
rs1263893226	127	dbSNP
rs545151141	131	dbSNP
rs779406488	134	dbSNP
rs929420798	135	dbSNP
rs920855309	136	dbSNP
rs1164066252	137	dbSNP
rs1418524378	137	dbSNP
rs1462755294	137	dbSNP
rs1329058738	142	dbSNP
rs193250273	145	dbSNP
rs1391606028	154	dbSNP
rs1330519934	157	dbSNP
rs1375931221	158	dbSNP
rs1232175755	159	dbSNP
rs1293171506	163	dbSNP
rs1037949561	168	dbSNP
rs898018116	170	dbSNP
rs1454303540	179	dbSNP
rs1406283548	180	dbSNP
rs574035419	181	dbSNP
rs560189678	188	dbSNP
rs1339217488	189	dbSNP
rs1196576681	191	dbSNP
rs750517975	192	dbSNP
rs982635289	194	dbSNP
rs970800487	199	dbSNP
rs1006297493	200	dbSNP
rs1440729659	200	dbSNP
rs1464067573	200	dbSNP
rs913963674	211	dbSNP
rs988604765	212	dbSNP
rs1476138634	213	dbSNP
rs955836444	216	dbSNP
rs1032922601	219	dbSNP
rs1380144169	222	dbSNP
rs1177144245	226	dbSNP
rs1462349556	229	dbSNP
rs1169237529	242	dbSNP
rs187738453	251	dbSNP
rs1413560398	257	dbSNP
rs1243905047	260	dbSNP
rs1199965973	267	dbSNP
rs1356883837	270	dbSNP
rs964756044	271	dbSNP
rs1017257106	283	dbSNP
rs529926059	288	dbSNP
rs937909371	290	dbSNP
rs1346007648	300	dbSNP
rs1210505241	303	dbSNP
rs1281122300	311	dbSNP
rs905092631	312	dbSNP
rs949238179	319	dbSNP
rs1352886409	330	dbSNP
rs779062788	332	dbSNP
rs537613424	336	dbSNP
rs1247818156	337	dbSNP
rs1433703245	341	dbSNP
rs1173954425	342	dbSNP
rs1376712800	348	dbSNP
rs1417380717	349	dbSNP
rs890213281	350	dbSNP
rs1047479910	352	dbSNP
rs1383070031	352	dbSNP
rs1369327269	353	dbSNP
rs35590570	358	dbSNP
rs1233799526	360	dbSNP
rs1383117599	369	dbSNP
rs34235357	370	dbSNP
rs1350081016	371	dbSNP
rs987851131	374	dbSNP
rs1486162294	400	dbSNP
rs936413870	406	dbSNP
rs993700807	409	dbSNP
rs1386547019	414	dbSNP
rs1193859499	415	dbSNP
rs899329631	426	dbSNP
rs1396533418	427	dbSNP
rs141888800	428	dbSNP
rs1157745929	432	dbSNP
rs1437202866	432	dbSNP
rs1345327155	433	dbSNP
rs138768639	437	dbSNP
rs938265808	440	dbSNP
rs1392708263	442	dbSNP
rs1440657769	461	dbSNP
rs77042580	476	dbSNP
rs953096173	479	dbSNP
rs182766439	480	dbSNP
rs546091486	482	dbSNP
rs1306370159	483	dbSNP
rs913992945	485	dbSNP
rs1241063892	486	dbSNP
rs1271251968	489	dbSNP
rs1467831873	490	dbSNP
rs572555444	492	dbSNP
rs976394452	494	dbSNP
rs1491028438	499	dbSNP
rs372742675	500	dbSNP
rs1187155267	501	dbSNP
rs536943766	502	dbSNP
rs988175226	502	dbSNP
rs955912049	505	dbSNP
rs925790139	506	dbSNP
rs1161940353	512	dbSNP
rs1416374318	515	dbSNP
rs1461191543	520	dbSNP
rs1327011697	526	dbSNP
rs1487925850	527	dbSNP
rs887873551	531	dbSNP
rs979114310	536	dbSNP
rs964671780	537	dbSNP
rs1001479163	539	dbSNP
rs1393242709	553	dbSNP
rs753738283	557	dbSNP
rs1359944416	562	dbSNP
rs59651246	568	dbSNP
rs1274806579	569	dbSNP
rs954353052	570	dbSNP
rs1203346964	574	dbSNP
rs1026108640	578	dbSNP
rs536195414	579	dbSNP
rs949335550	580	dbSNP
rs1295687711	582	dbSNP
rs892261308	589	dbSNP
rs1340483072	590	dbSNP
rs554270256	595	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.