miRTarBase - #MIRT466798


—
pre-miRNA Information
pre-miRNA hsa-mir-3135b   
Genomic Coordinates chr6: 32749912 - 32749979
Description Homo sapiens miR-3135b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3135b
Sequence 7| GGCUGGAGCGAGUGCAGUGGUG |28
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1437307191 2 dbSNP
rs1202765326 3 dbSNP
rs905889141 5 dbSNP
rs922757991 8 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SUPT16H   
Synonyms CDC68, FACTP140, SPT16, SPT16/CDC68
Description SPT16 homolog, facilitates chromatin remodeling subunit
Transcript NM_007192   
Expression
Putative miRNA Targets on SUPT16H
3'UTR of SUPT16H
(miRNA target sites are highlighted)		 
>SUPT16H|NM_007192|3'UTR
   1 CTTCTGAACTTTGGCCCTGAGCTCCATTCTTCCTCCAGCCAACCCCTGAAAATTTTACATGACATAGAAACTGTATTTTT
  81 CCTTTCGTTTTCATTTGAAGTTTTGCCATTTGTGTTTATGGGTTTAGGGGGCCATTTGTGTGGACCAATCTACTCGGGGA
 161 ATTCCAGGCCCACCAGGACACGTGCCAATGGCCCCATTCAGATGGCAAGGGAGGAGGTGTTCTTGAAGACAGGAGGAGGC
 241 TCCCGCTGTTAATAAATATTGTTTCATTCTTCTCTCTTCCTGTCACCTTCTGCCAAGACATTGATGGCTTCTGACATCTT
 321 ATTTGGTGTCTCAAAGCTGTATTTCCAAGACAGTGGTACAAGGTGACCCTTAATTACCCGTATCATGGTTCTTGACCAGC
 401 ACATTCAATCCTCCAACCTACCCTACTGCCATGACCTTCCGCACATCTCTAAGTTTTATCTTTGCAATACTCAAGGTTCT
 481 CGGAAATTTGCTAATGGTTGTGATAAACCATACAGCTTGAGCCAGTGAGGCAGATTGGGCTGGTGCCTTCGTCTGAGTTT
 561 TCCTGCTTTCCTGCCTCGTGCAGATTCTGAGGTATATCTGCTGCCTTGGAAGACATAAGAAGCAGTGATACTCCCTGGCT
 641 CGGTTATTTTCTCCATACAATGCACACATGGTACAATGATAGAAGGCAAAATTGCCACTGTCTTCTTTTTTTTCTCATAT
 721 ATCTAAGGAAGATATATCAGGTTGTGCCTCATGTACCGCTTCTAGTGAAATGTAGAGGAAGGCTCAAAGGAGTCAACATT
 801 TATATCTGGAAGGGACAAGTCATGCCTTGGGCCTAGAATACCCTGATGAGAAAAGAGAAGAGGAAGGGAGGCCATATCTA
 881 CAACACAGCCTCTCGGCACTGCTGCTCCTTATTTTAACTTTGTCTTGCATTGTCCTGTATTTATCACAGTTTCTGTTGAA
 961 CAGCTTTTCAAGTATTTGGGGAGTTTATCTTGCCATCCTCCCCTTCTGGTTCTCTGCACCCACCTGTCCCACTGCAGTTC
1041 CTTCCGTGCTCTGTGACTTTAAGAGAAGAAGGGGGGAGGGGTCCCGGATTTTATGTTTGTTTGTTTTTTCTCCTTAGCAG
1121 TAGGACTTGATATTTTCAATTTTGGAAGAACTAAAAGATGAATAAACTGGGTTTTTTTTGTTGTTTGTTTTTGTAAATTC
1201 A
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guGGUGACGUGAGCGAGGUCGg 5'
            |||:|   ||: ||||||| 
Target 5' ctCCATT---CTTCCTCCAGCc 3'
 22 - 40 157.00 -21.50
2 
miRNA  3' guGGUGACGUGAGC-----GAGGUCgg 5'
            ||| | :|||||     :|||||  
Target 5' gaCCAATCTACTCGGGGAATTCCAGgc 3'
 143 - 169 128.00 -20.90
3 
miRNA  3' gugGUG-ACGUGAGCGAGGUCGg 5'
             ||| | || || ||||| | 
Target 5' cagCACATTCAATC-CTCCAACc 3'
 397 - 418 126.00 -15.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26650121 44 COSMIC
COSN30523765 48 COSMIC
COSN13576325 59 COSMIC
COSN26997482 62 COSMIC
COSN30533586 64 COSMIC
COSN30447176 81 COSMIC
COSN31521094 86 COSMIC
COSN30478270 121 COSMIC
COSN30456371 156 COSMIC
COSN30482974 156 COSMIC
COSN30456353 157 COSMIC
COSN31526242 216 COSMIC
COSN31585349 274 COSMIC
COSN26481917 292 COSMIC
COSN31603619 366 COSMIC
COSN31514730 380 COSMIC
COSN28201007 408 COSMIC
COSN28703509 577 COSMIC
COSN17254982 660 COSMIC
COSN25369814 731 COSMIC
COSN30539192 760 COSMIC
COSN6242573 812 COSMIC
COSN30541969 818 COSMIC
COSN31536131 993 COSMIC
COSN8588414 1037 COSMIC
COSN31529369 1065 COSMIC
COSN28815608 1128 COSMIC
COSN31594979 1171 COSMIC
COSN27482371 1172 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1355831677 1 dbSNP
rs1260491607 4 dbSNP
rs763643586 5 dbSNP
rs1417479324 8 dbSNP
rs370029425 12 dbSNP
rs1414946975 13 dbSNP
rs774328654 14 dbSNP
rs1405084072 15 dbSNP
rs1158803668 17 dbSNP
rs1162093165 21 dbSNP
rs1362928525 26 dbSNP
rs368045675 33 dbSNP
rs1297642693 39 dbSNP
rs377307917 45 dbSNP
rs1450426875 48 dbSNP
rs1284953410 53 dbSNP
rs1378760724 55 dbSNP
rs145169068 59 dbSNP
rs1311203675 63 dbSNP
rs890399443 64 dbSNP
rs1051677631 66 dbSNP
rs540841109 71 dbSNP
rs1210231166 74 dbSNP
rs1452566325 75 dbSNP
rs574811309 76 dbSNP
rs1471606540 77 dbSNP
rs1381140315 86 dbSNP
rs1382613335 87 dbSNP
rs555105970 95 dbSNP
rs1158614668 109 dbSNP
rs1304991882 118 dbSNP
rs1416206925 123 dbSNP
rs544575178 130 dbSNP
rs1344286234 140 dbSNP
rs771097284 148 dbSNP
rs1421061552 153 dbSNP
rs188426409 155 dbSNP
rs1239313346 156 dbSNP
rs141381871 161 dbSNP
rs11554578 163 dbSNP
rs1219233894 171 dbSNP
rs970198560 172 dbSNP
rs8022480 181 dbSNP
rs1182285794 182 dbSNP
rs1200213223 185 dbSNP
rs1240379852 188 dbSNP
rs1458530061 216 dbSNP
rs1178447154 217 dbSNP
rs1362500432 222 dbSNP
rs1479298300 231 dbSNP
rs993049208 233 dbSNP
rs1241813204 237 dbSNP
rs1213896818 244 dbSNP
rs184388020 245 dbSNP
rs1031691248 250 dbSNP
rs1401334095 254 dbSNP
rs73579626 256 dbSNP
rs1357951700 259 dbSNP
rs968861510 260 dbSNP
rs1017686350 264 dbSNP
rs1315405998 274 dbSNP
rs1229286538 275 dbSNP
rs1273728999 286 dbSNP
rs1007435468 301 dbSNP
rs566976204 313 dbSNP
rs1286815769 316 dbSNP
rs1258247456 319 dbSNP
rs1316929425 321 dbSNP
rs1198345331 322 dbSNP
rs1401476440 325 dbSNP
rs1248932453 330 dbSNP
rs1360692515 333 dbSNP
rs1200251390 338 dbSNP
rs550302957 355 dbSNP
rs1246183162 362 dbSNP
rs1479470949 364 dbSNP
rs1172943888 375 dbSNP
rs150983279 377 dbSNP
rs10872898 378 dbSNP
rs1370163883 379 dbSNP
rs769163039 380 dbSNP
rs570939210 397 dbSNP
rs1343587846 400 dbSNP
rs897712386 403 dbSNP
rs1037385277 406 dbSNP
rs1187981162 408 dbSNP
rs1478944856 412 dbSNP
rs1224872338 415 dbSNP
rs1249948963 428 dbSNP
rs941679810 437 dbSNP
rs1210837853 440 dbSNP
rs954764134 440 dbSNP
rs926398899 441 dbSNP
rs1221902074 447 dbSNP
rs1264063191 448 dbSNP
rs1044783784 450 dbSNP
rs1489870219 451 dbSNP
rs1369955465 453 dbSNP
rs1458176654 454 dbSNP
rs1267820078 455 dbSNP
rs140543535 460 dbSNP
rs532662887 467 dbSNP
rs917417277 470 dbSNP
rs868351818 472 dbSNP
rs993381183 474 dbSNP
rs560865407 476 dbSNP
rs1307367082 478 dbSNP
rs369127550 478 dbSNP
rs754764795 481 dbSNP
rs1340733617 482 dbSNP
rs1245896467 510 dbSNP
rs540426927 516 dbSNP
rs1314810025 517 dbSNP
rs1293886358 522 dbSNP
rs564116741 534 dbSNP
rs978806852 535 dbSNP
rs1286787835 536 dbSNP
rs1340801064 545 dbSNP
rs969123433 550 dbSNP
rs1017738831 551 dbSNP
rs986224833 553 dbSNP
rs753609876 555 dbSNP
rs763458902 566 dbSNP
rs150965279 568 dbSNP
rs561356560 571 dbSNP
rs775994569 577 dbSNP
rs993709234 578 dbSNP
rs544762119 596 dbSNP
rs545762466 598 dbSNP
rs201353365 600 dbSNP
rs78708413 600 dbSNP
rs866344239 602 dbSNP
rs1395149657 606 dbSNP
rs1172588202 616 dbSNP
rs1381091393 618 dbSNP
rs1242923082 620 dbSNP
rs1478012053 628 dbSNP
rs1310568089 631 dbSNP
rs35140265 636 dbSNP
rs1316873440 637 dbSNP
rs142544756 639 dbSNP
rs565312337 641 dbSNP
rs545400870 642 dbSNP
rs1272836385 645 dbSNP
rs1212022192 648 dbSNP
rs1431565981 649 dbSNP
rs1284675952 652 dbSNP
rs72684736 654 dbSNP
rs553234990 655 dbSNP
rs1417250994 658 dbSNP
rs111529031 659 dbSNP
rs1480609261 660 dbSNP
rs1250072618 663 dbSNP
rs1173873298 667 dbSNP
rs1402049528 668 dbSNP
rs573547590 669 dbSNP
rs1332463124 671 dbSNP
rs1373232595 672 dbSNP
rs1057327617 673 dbSNP
rs547378800 680 dbSNP
rs1303460356 683 dbSNP
rs934804000 703 dbSNP
rs1223012752 704 dbSNP
rs1261460072 706 dbSNP
rs924925723 708 dbSNP
rs1221318518 709 dbSNP
rs8003160 713 dbSNP
rs1192887997 714 dbSNP
rs1479613726 714 dbSNP
rs376182759 717 dbSNP
rs1267406335 718 dbSNP
rs532149067 719 dbSNP
rs1196690194 720 dbSNP
rs1425241196 722 dbSNP
rs910560647 725 dbSNP
rs1171828582 730 dbSNP
rs1390266331 731 dbSNP
rs1354360957 735 dbSNP
rs1460898717 746 dbSNP
rs61977521 751 dbSNP
rs1371159873 752 dbSNP
rs61977520 753 dbSNP
rs954790522 755 dbSNP
rs1342595028 757 dbSNP
rs1466004890 758 dbSNP
rs1271980011 774 dbSNP
rs1305596605 787 dbSNP
rs1405060392 798 dbSNP
rs2295865 803 dbSNP
rs185653163 806 dbSNP
rs962183892 807 dbSNP
rs1016065058 808 dbSNP
rs1264790344 810 dbSNP
rs61611519 816 dbSNP
rs1185623215 830 dbSNP
rs905094785 832 dbSNP
rs1418549570 835 dbSNP
rs1167361719 837 dbSNP
rs778873611 841 dbSNP
rs1424653573 843 dbSNP
rs1181037849 845 dbSNP
rs1023269481 857 dbSNP
rs1400807493 857 dbSNP
rs1013190691 859 dbSNP
rs1229752813 860 dbSNP
rs1242930282 861 dbSNP
rs1202128642 863 dbSNP
rs879756392 868 dbSNP
rs896261124 871 dbSNP
rs1287514591 874 dbSNP
rs1488304604 884 dbSNP
rs1491382370 887 dbSNP
rs1491207210 888 dbSNP
rs1256203486 890 dbSNP
rs144198624 892 dbSNP
rs1386317402 894 dbSNP
rs1444526574 895 dbSNP
rs570732888 897 dbSNP
rs934881731 899 dbSNP
rs903360655 904 dbSNP
rs1043192714 905 dbSNP
rs1314606010 907 dbSNP
rs1311441464 908 dbSNP
rs1447436382 912 dbSNP
rs947638280 915 dbSNP
rs910780024 929 dbSNP
rs1311317854 937 dbSNP
rs1050446926 939 dbSNP
rs1222651277 945 dbSNP
rs1334479908 948 dbSNP
rs1281602075 949 dbSNP
rs530311771 953 dbSNP
rs753696677 956 dbSNP
rs765626030 974 dbSNP
rs1244101213 977 dbSNP
rs1461109170 979 dbSNP
rs2295864 982 dbSNP
rs779808094 989 dbSNP
rs972566328 992 dbSNP
rs962113531 995 dbSNP
rs1405967316 1001 dbSNP
rs1453222146 1003 dbSNP
rs11149 1012 dbSNP
rs909056543 1014 dbSNP
rs1405669957 1019 dbSNP
rs1450107695 1020 dbSNP
rs984559796 1025 dbSNP
rs187879350 1034 dbSNP
rs1441476559 1038 dbSNP
rs1277230816 1041 dbSNP
rs551076703 1044 dbSNP
rs1013242980 1045 dbSNP
rs757768245 1046 dbSNP
rs1320977250 1054 dbSNP
rs960351471 1060 dbSNP
rs1260457913 1061 dbSNP
rs14900 1063 dbSNP
rs1444460695 1071 dbSNP
rs1181779722 1072 dbSNP
rs368343010 1072 dbSNP
rs1428791709 1073 dbSNP
rs903580782 1082 dbSNP
rs756300437 1085 dbSNP
rs552518469 1086 dbSNP
rs1050663856 1087 dbSNP
rs1332789501 1090 dbSNP
rs1287546311 1093 dbSNP
rs1404956382 1106 dbSNP
rs1240191329 1107 dbSNP
rs1343239618 1107 dbSNP
rs1358668321 1108 dbSNP
rs1347378093 1110 dbSNP
rs1260360257 1116 dbSNP
rs1340436901 1119 dbSNP
rs1195620073 1126 dbSNP
rs767524750 1130 dbSNP
rs1453850014 1132 dbSNP
rs1223308627 1133 dbSNP
rs1268358759 1140 dbSNP
rs1246806562 1141 dbSNP
rs140648531 1148 dbSNP
rs1474935552 1158 dbSNP
rs1317302744 1168 dbSNP
rs573199185 1168 dbSNP
rs1392718830 1171 dbSNP
rs923267995 1172 dbSNP
rs1036341433 1179 dbSNP
rs1363211367 1180 dbSNP
rs1401332164 1180 dbSNP
rs940783877 1180 dbSNP
rs1325496769 1191 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guGGUGACGUGAGCGAGGUCGg 5'
            |||:|   ||: ||||||| 
Target 5' cuCCAUU---CUUCCUCCAGCc 3'
 		1 - 19
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000216297.2 | 3UTR | CUCCAUUCUUCCUCCAGCCAACCCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
305 hsa-miR-3135b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT079084 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT118055 SLC1A5 solute carrier family 1 member 5 2 2
MIRT195529 SNTB2 syntrophin beta 2 2 2
MIRT312491 SLC26A2 solute carrier family 26 member 2 2 2
MIRT366306 GDI1 GDP dissociation inhibitor 1 2 4
MIRT448908 CLCN6 chloride voltage-gated channel 6 2 4
MIRT451874 SOD2 superoxide dismutase 2 2 8
MIRT454235 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454512 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT457728 SMOX spermine oxidase 2 2
MIRT459797 POTED POTE ankyrin domain family member D 2 10
MIRT459905 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT462667 HMOX1 heme oxygenase 1 2 2
MIRT466798 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 2 2
MIRT468954 RPS14 ribosomal protein S14 2 2
MIRT469458 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT470214 PRRC2B proline rich coiled-coil 2B 2 2
MIRT470503 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT476142 GPR137C G protein-coupled receptor 137C 2 8
MIRT476864 FHL2 four and a half LIM domains 2 2 4
MIRT478052 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 10
MIRT480647 BSCL2 BSCL2, seipin lipid droplet biogenesis associated 2 2
MIRT488513 CD3E CD3e molecule 2 2
MIRT497664 PRMT3 protein arginine methyltransferase 3 2 2
MIRT498656 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 6
MIRT499315 ZNF485 zinc finger protein 485 2 10
MIRT499761 CIRH1A UTP4, small subunit processome component 2 8
MIRT501131 SLC2A1 solute carrier family 2 member 1 2 2
MIRT502292 GNG12 G protein subunit gamma 12 2 6
MIRT503452 PNMA2 paraneoplastic Ma antigen 2 2 6
MIRT507072 H2AFX H2A histone family member X 2 4
MIRT509947 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT514508 SHISA9 shisa family member 9 2 4
MIRT515507 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT515912 MFAP2 microfibril associated protein 2 2 2
MIRT516412 COPA coatomer protein complex subunit alpha 2 2
MIRT516477 RAB32 RAB32, member RAS oncogene family 2 2
MIRT517863 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT518785 MED16 mediator complex subunit 16 2 4
MIRT518952 GRK7 G protein-coupled receptor kinase 7 2 2
MIRT519227 PYCARD PYD and CARD domain containing 2 2
MIRT522561 MCAM melanoma cell adhesion molecule 2 4
MIRT523767 FBXO27 F-box protein 27 2 4
MIRT528364 ZMYM1 zinc finger MYM-type containing 1 2 4
MIRT529369 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT529978 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT530454 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT531643 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531751 TXK TXK tyrosine kinase 2 2
MIRT531915 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532024 FHDC1 FH2 domain containing 1 2 2
MIRT533117 YIPF4 Yip1 domain family member 4 2 4
MIRT534713 RFX7 regulatory factor X7 2 2
MIRT535473 PARVB parvin beta 2 6
MIRT535769 MYCN MYCN proto-oncogene, bHLH transcription factor 2 2
MIRT536744 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537943 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT539525 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540255 FAM89A family with sequence similarity 89 member A 2 2
MIRT540440 RBM43 RNA binding motif protein 43 2 2
MIRT542984 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT543426 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 2 2
MIRT544676 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT544727 NDRG1 N-myc downstream regulated 1 2 2
MIRT545196 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT553254 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT553277 TVP23B trans-golgi network vesicle protein 23 homolog B 2 2
MIRT565018 VIM vimentin 2 2
MIRT565931 SAMD4B sterile alpha motif domain containing 4B 2 2
MIRT569796 CSF1 colony stimulating factor 1 2 2
MIRT570259 PRSS16 protease, serine 16 2 2
MIRT570785 ORC6 origin recognition complex subunit 6 2 2
MIRT571144 HM13 histocompatibility minor 13 2 2
MIRT572818 MYO1C myosin IC 2 2
MIRT575204 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 3
MIRT575284 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575304 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575325 Fbxo6 F-box protein 6 2 2
MIRT575381 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575675 Map1b microtubule-associated protein 1B 2 2
MIRT576902 Poteg POTE ankyrin domain family, member G 2 2
MIRT607049 IDS iduronate 2-sulfatase 2 2
MIRT607067 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607492 HEBP2 heme binding protein 2 2 2
MIRT607524 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607657 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607797 RHBDL2 rhomboid like 2 2 2
MIRT607844 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607931 ANG angiogenin 2 3
MIRT607968 SNX22 sorting nexin 22 2 2
MIRT608076 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608100 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT608143 SYAP1 synapse associated protein 1 2 2
MIRT608905 ZNF790 zinc finger protein 790 2 2
MIRT612930 GPRIN3 GPRIN family member 3 2 2
MIRT616768 LONP2 lon peptidase 2, peroxisomal 2 2
MIRT617446 CCS copper chaperone for superoxide dismutase 2 2
MIRT617554 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618774 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618928 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619248 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620572 WBSCR27 methyltransferase like 27 2 4
MIRT622655 POU2F3 POU class 2 homeobox 3 2 4
MIRT623175 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624167 DGKE diacylglycerol kinase epsilon 2 2
MIRT625270 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625398 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625696 OPTN optineurin 2 2
MIRT626095 MKLN1 muskelin 1 2 2
MIRT626433 CHDH choline dehydrogenase 2 2
MIRT627015 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627079 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627142 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627349 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627422 THAP2 THAP domain containing 2 2 2
MIRT627443 TAS2R5 taste 2 receptor member 5 2 2
MIRT627882 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT628080 KAT7 lysine acetyltransferase 7 2 4
MIRT628278 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629096 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629238 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629288 UNC13A unc-13 homolog A 2 2
MIRT629409 ADM2 adrenomedullin 2 2 2
MIRT629586 RFC2 replication factor C subunit 2 2 2
MIRT629637 WDR31 WD repeat domain 31 2 2
MIRT629876 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629986 NARS asparaginyl-tRNA synthetase 2 2
MIRT630045 TERF2 telomeric repeat binding factor 2 2 2
MIRT630063 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630129 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630157 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630254 SMTNL2 smoothelin like 2 2 2
MIRT630280 PSMB5 proteasome subunit beta 5 2 2
MIRT630349 NKAP NFKB activating protein 2 2
MIRT630499 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT630554 ROBO1 roundabout guidance receptor 1 2 4
MIRT631266 CENPM centromere protein M 2 2
MIRT631405 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632472 RPS15A ribosomal protein S15a 2 2
MIRT632513 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT632598 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632996 DUSP18 dual specificity phosphatase 18 2 2
MIRT633084 CXorf21 chromosome X open reading frame 21 2 2
MIRT633241 ZNF573 zinc finger protein 573 2 2
MIRT633538 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634340 SGOL1 shugoshin 1 2 2
MIRT634602 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635052 MYH11 myosin heavy chain 11 2 2
MIRT635106 MAVS mitochondrial antiviral signaling protein 2 2
MIRT635238 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635324 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636270 RNF157 ring finger protein 157 2 2
MIRT636452 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636518 FMN1 formin 1 2 2
MIRT636655 CDK4 cyclin dependent kinase 4 2 2
MIRT636757 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637136 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637190 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637290 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637535 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637695 CEP89 centrosomal protein 89 2 2
MIRT637790 OLA1 Obg like ATPase 1 2 2
MIRT637927 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638451 PLXDC2 plexin domain containing 2 2 2
MIRT640674 ARSK arylsulfatase family member K 2 2
MIRT642645 PTGR2 prostaglandin reductase 2 2 2
MIRT643084 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT644238 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644667 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645094 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645995 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646510 FAM217B family with sequence similarity 217 member B 2 2
MIRT647015 ADCY2 adenylate cyclase 2 3 2
MIRT647097 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647716 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648042 FADS6 fatty acid desaturase 6 2 2
MIRT648512 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648867 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649184 DNPEP aspartyl aminopeptidase 2 2
MIRT649662 TEP1 telomerase associated protein 1 2 2
MIRT651425 YME1L1 YME1 like 1 ATPase 2 2
MIRT651467 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652400 TMEM40 transmembrane protein 40 2 2
MIRT652598 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT653225 SOX17 SRY-box 17 2 2
MIRT653693 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654124 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT656472 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658907 DPY19L4 dpy-19 like 4 2 2
MIRT661103 SPIB Spi-B transcription factor 2 2
MIRT661240 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661293 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662237 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662546 MTAP methylthioadenosine phosphorylase 2 2
MIRT662622 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT662738 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662846 OMD osteomodulin 2 2
MIRT662909 MED18 mediator complex subunit 18 2 2
MIRT662958 JPH2 junctophilin 2 2 2
MIRT663342 ZNF74 zinc finger protein 74 2 2
MIRT663498 IYD iodotyrosine deiodinase 2 2
MIRT663525 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663544 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663905 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663974 ZNF786 zinc finger protein 786 2 2
MIRT664352 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664419 TIGD6 tigger transposable element derived 6 2 2
MIRT664470 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664959 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664973 TDRD1 tudor domain containing 1 2 2
MIRT665023 ELK1 ELK1, ETS transcription factor 2 2
MIRT665201 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665361 XKR4 XK related 4 2 2
MIRT665456 WDR17 WD repeat domain 17 2 2
MIRT666080 SSTR2 somatostatin receptor 2 2 2
MIRT666319 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666488 SBNO1 strawberry notch homolog 1 2 2
MIRT666520 RNF170 ring finger protein 170 2 2
MIRT666698 RBM23 RNA binding motif protein 23 2 2
MIRT666764 RAB10 RAB10, member RAS oncogene family 2 2
MIRT667228 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667361 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667476 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667560 LRAT lecithin retinol acyltransferase 2 2
MIRT667750 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668090 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668121 GK5 glycerol kinase 5 (putative) 2 2
MIRT668168 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668348 STXBP2 syntaxin binding protein 2 2 2
MIRT668511 ESYT2 extended synaptotagmin 2 2 2
MIRT669293 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669549 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669780 CNDP1 carnosine dipeptidase 1 2 2
MIRT669860 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670019 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670179 CCDC142 coiled-coil domain containing 142 2 2
MIRT671109 ZNF841 zinc finger protein 841 2 2
MIRT671353 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671478 FLYWCH2 FLYWCH family member 2 2 2
MIRT671494 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671555 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671670 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT671927 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672198 F2 coagulation factor II, thrombin 2 2
MIRT672219 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672254 SIK2 salt inducible kinase 2 2 2
MIRT672292 GP2 glycoprotein 2 2 2
MIRT672432 POLR2D RNA polymerase II subunit D 2 2
MIRT672599 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672903 KRBA2 KRAB-A domain containing 2 2 2
MIRT672960 ZNF655 zinc finger protein 655 2 2
MIRT673098 SYNPO2L synaptopodin 2 like 2 2
MIRT673174 TMEM56 transmembrane protein 56 2 2
MIRT673253 INO80 INO80 complex subunit 2 2
MIRT673298 RNF19B ring finger protein 19B 2 2
MIRT673577 KDELC2 KDEL motif containing 2 2 2
MIRT673739 TCF23 transcription factor 23 2 2
MIRT674029 ANKRD9 ankyrin repeat domain 9 2 2
MIRT674284 NAGK N-acetylglucosamine kinase 2 2
MIRT674340 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674395 MYCBP MYC binding protein 2 2
MIRT674521 PRR23A proline rich 23A 2 2
MIRT675146 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT676027 C9orf69 transmembrane protein 250 2 2
MIRT676432 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676598 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678757 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680346 ZNF281 zinc finger protein 281 2 2
MIRT680469 C3 complement C3 2 2
MIRT682828 FLG2 filaggrin family member 2 2 2
MIRT682883 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684406 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685277 KIAA1143 KIAA1143 2 2
MIRT686063 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT693892 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699344 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699911 RUNDC1 RUN domain containing 1 2 2
MIRT700809 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT701809 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702176 LYRM4 LYR motif containing 4 2 2
MIRT702297 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT704064 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT706209 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706631 PNPT1 polyribonucleotide nucleotidyltransferase 1 2 2
MIRT706662 RNF216 ring finger protein 216 2 2
MIRT706684 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706707 GPR155 G protein-coupled receptor 155 2 2
MIRT706779 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706846 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706865 MAFF MAF bZIP transcription factor F 2 2
MIRT706898 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706919 THAP6 THAP domain containing 6 2 2
MIRT706964 FANCC Fanconi anemia complementation group C 2 2
MIRT706982 XPO5 exportin 5 2 2
MIRT707017 RRP36 ribosomal RNA processing 36 2 2
MIRT707034 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707074 MED29 mediator complex subunit 29 2 2
MIRT709370 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT709584 ITPA inosine triphosphatase 2 2
MIRT709692 CUBN cubilin 2 2
MIRT711485 GDF7 growth differentiation factor 7 2 2
MIRT713577 SLC2A8 solute carrier family 2 member 8 2 2
MIRT722798 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 3
MIRT724200 MED7 mediator complex subunit 7 2 2
MIRT736146 GRB2 growth factor receptor bound protein 2 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-31 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-31 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-31 Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-31 5-Fluorouracil approved 3385 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-31 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miR-31 Doxorubicin approved 31703 Microarray heart 22859947 2012 up-regulated
miR-31 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Quantitative real-time PCR thymus 23024791 2012 down-regulated
miR-31 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-31 Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-31 Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-31 Leptin NULL NULL Quantitative real-time PCR muscles 20800581 2010 up-regulated
miR-31 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 down-regulated
miR-31 Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-31 Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-31 Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-31 Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-31 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-31 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-31 Calcium sulfate (CaS) NULL 24497 Microarray MG63E osteoblast-like cells 17618507 2008 down-regulated
miR-31 Valproate approved 3121 Quantitative real-time PCR CD4+, CD25- T cells 20427269 2010 down-regulated
miR-31 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-31 Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7, T47D)
hsa-mir-31 Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, SK-HEP-1)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-mir-31 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-31 Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-mir-31 Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-mir-31 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-31 Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-31 Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-mir-31 Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-31 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved resistant cell line (KYSE)
hsa-mir-31 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-3135b Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3135b Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-3135b Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-3135b Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3135b Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-3135b Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-3135b Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3135b Paclitaxel 36314 NSC125973 approved resistant High Endometrial Serous Carcinoma cell line (USPC1)
hsa-mir-3135b Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-3135b Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-3135b Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-3135b Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-3135b Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-3135b Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-mir-3135b Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-3135b Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-3135b Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-3135b Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-3135b Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-3135b Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-3135b Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-3135b Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-3135b Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-3135b Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission