| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4760 |
| Genomic Coordinates | chr21: 40212352 - 40212431 |
| Description | Homo sapiens miR-4760 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4760-5p | |||||||||
| Sequence | 10| UUUAGAUUGAACAUGAAGUUAG |31 | |||||||||
| Evidence | Experimental | |||||||||
| Experiments | Illumina | |||||||||
| SNPs in miRNA |
|
|||||||||
| Putative Targets | ||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | STK38 | ||||||||||||||||||||
| Synonyms | NDR, NDR1 | ||||||||||||||||||||
| Description | serine/threonine kinase 38 | ||||||||||||||||||||
| Transcript | NM_007271 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on STK38 | |||||||||||||||||||||
| 3'UTR of STK38 (miRNA target sites are highlighted) |
>STK38|NM_007271|3'UTR 1 TACTCTTGCCACGGAATCCTATGTGGAGCAGAGTTCTTTGTATAACATCATGCTTTTCCTCTCACACTCTTGAAGAGCTT 81 CCAAGAAGTTGATGGAACCCACCAATATGTCATAGTAAAGTCTCCTGAAATGTGGTAGTAAGAGGATTTTCTTCCATAAT 161 GCATCTGAAAAACTGTAAACAAAGACAACCATTTCTACTACGTCGGCCATAAACAGCTATCCTGCTTTGGAAGAGAAGCA 241 TCATGAGCCAATTTGATAGGTGTTTTAAAAATAACTTGAGTTTTCCTAAGTTCATCAGAATGAAGGGGAAAAACAGCCAT 321 CATCCAACATTATTGAGATTGTCGTGTATAGTCATCGAATATCAGCCAGTTCCTGTAATTTTGTGACACGCTCTCTGCCA 401 AGCCCACCAAGTATTTCCTTTATAGCTAAAAGTTCCATAGTACTAAGGAAATAAAGCAATAAAGACAGTCTCAGCAGCCA 481 GGATTCTGGCTGAAGGAAATGATCCGCCACCCTGAGGGTGGTGATGGTAGTTTCTACCCATACCTCAGCCTCAGGCGAGT 561 GGCTTATAGCCTCCATTCATGGTGCACTTTATTTATGGTACTAAGATAAAGACTGTCAATCCATTGATTTATCTCCTCCT 641 GTCCCCCATCTAAAATACCCATGCTGCTTTTCTGAGTGTTGATGGGGGTTACCAGCTTGATCCACTGTTGCTCTTAGAAG 721 GCCCAGAAAGTCTTTGGGCATTGCCAAGAAATCCCGGATTATGTGGAAAACCCTCACTTTCTCTTCACGGCTGTACCAGA 801 AAATCCCTAAGACAGATCTTGCCGTGGACTAGCAATACCTGCAAGTGCTGCCAATGGGAACTCAATTTATTCCTGGGAAC 881 CTAACGAGGAGAGCCCAGGCCTAGGCAGGAGGCCTGGAACCCTCTTGGCTAAGGTGCTGTTCCTGTTCCTGCAAGGTCTC 961 CAGAACCCCTTTGGAAATGGTGAAGGAACCAGCCCAATAGAAGTACAGAGCCAGCTGACAAGTCCTTGTAAAGCTCACTC 1041 CTCAGTCCTTGGCACAGCCATGTTTTGTCTTCTCTCTTGGTATTTCTTCTCTCCCAACTTTAGCCATTTTGCCTTGGAAT 1121 CATGATTACAATTTTTTCCTTTGCAGATGCCTTCCTGGGGGATACTCCTCCCCACCCTAAAGGGTCGCCTGCAACTTAGG 1201 CGGATTGGGTCTCTCTGCTGTGGCGTTCTCTCTTGAGAGACCCTCTGAATTTTAGCACAAAGTGCCTTCTGTTTCACAGC 1281 TGCCACCACCTTTAGAGGAATTTCGTCAGAAAAATGTGGAGGCTCCATATTAATGCATTATTTTTTAAAAAGTTTTGATA 1361 ACTCTTAAAGCATCATTTGCACCTATGTGGGAACTTTGCCTGTTGCAAAGTATTGTGGCCGAGCTGCAGCTGGGAGCCTG 1441 CTTTCTGCCAGTCTTGAGGTTCTGAAGATCAGCTTTGAAAGGAAAGTATGTCCTAGCTTAGCCATTCAGAAGAGAAAAAT 1521 GGAATATCAGAGTTACAGTTGTCAGTGAAACTACTTTGGATTTTAACCTCTTAGAGGAAGAAAAAAGGTTAGGGAAGTGT 1601 CAACTCTGGATGAAGGTGATGTGTTTGCCTCTCAGTCTTTCATTCATAGCCTGCTAGTGAAAAGGAAGTAAATGAGATTC 1681 TTTTGTGTGACTTTGTAGTCTCTTTGTATTACCAAATAGTTGGGGTGTTGACTCCTGTGTGTTTTGCAAGAATGTGTGGT 1761 AAGCCTGGGTAAAGAGAAGGAACTGCGGTGTTGGGAGAGTCTTTGTGTTGGGGAGTGGCAGGGGATGATTTGTTTCAGGG 1841 GAAAATGCCCACATTTTAACTTTTAAACTTCTGAATAAACTGTGTAAAAACAGTAGTGGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 11329.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 11329.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000229812.7 | 3UTR | UCCCCCAUCUAAAAUACCCAUGCUGCUUUUCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000229812.7 | 3UTR | UCCCCCAUCUAAAAUACCCAUGCUGCUUUUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000229812.7 | 3UTR | UCCCCCAUCUAAAAUACCCAUGCUGCUUUUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000229812.7 | 3UTR | UCCCCCAUCUAAAAUACCCAUGCUGCUUUUCU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000229812.7 | 3UTR | UCCCCCAUCUAAAAUACCCAUGCUGCUUUUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM1462573 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl BaL |
| Location of target site | ENST00000229812.7 | 3UTR | UCCCCCAUCUAAAAUACCCAUGCUGCUUUUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000229812.7 | 3UTR | UCCCCCAUCUAAAAUACCCAUGCUGCUUUUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
56 hsa-miR-4760-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT076215 | ALKBH5 | alkB homolog 5, RNA demethylase |  |
|
2 | 2 | ||||||
| MIRT087763 | H1F0 | H1 histone family member 0 | |
|
2 | 2 | ||||||
| MIRT093991 | SLAIN2 | SLAIN motif family member 2 | |
|
2 | 2 | ||||||
| MIRT109199 | VMA21 | VMA21, vacuolar ATPase assembly factor | |
|
2 | 4 | ||||||
| MIRT243167 | SOX11 | SRY-box 11 | |
|
2 | 2 | ||||||
| MIRT290697 | POLI | DNA polymerase iota | |
|
2 | 2 | ||||||
| MIRT352597 | PTMA | prothymosin, alpha | |
|
2 | 4 | ||||||
| MIRT443107 | DENND5B | DENN domain containing 5B | |
|
2 | 2 | ||||||
| MIRT445651 | ATP6V1G1 | ATPase H+ transporting V1 subunit G1 | |
|
2 | 6 | ||||||
| MIRT449111 | PHEX | phosphate regulating endopeptidase homolog X-linked | |
|
2 | 2 | ||||||
| MIRT449798 | ZNF74 | zinc finger protein 74 | |
|
2 | 2 | ||||||
| MIRT456143 | RWDD2A | RWD domain containing 2A | |
|
2 | 18 | ||||||
| MIRT463303 | ZFP36L1 | ZFP36 ring finger protein like 1 | |
|
2 | 6 | ||||||
| MIRT466904 | STK38 | serine/threonine kinase 38 | |
|
2 | 10 | ||||||
| MIRT492452 | RBPJ | recombination signal binding protein for immunoglobulin kappa J region | |
|
2 | 8 | ||||||
| MIRT511574 | HIST2H3D | histone cluster 2 H3 family member d | |
|
2 | 4 | ||||||
| MIRT519374 | FKBP14 | FK506 binding protein 14 | |
|
2 | 2 | ||||||
| MIRT520935 | SRSF4 | serine and arginine rich splicing factor 4 | |
|
2 | 4 | ||||||
| MIRT524345 | CREB1 | cAMP responsive element binding protein 1 | |
|
2 | 2 | ||||||
| MIRT530230 | WSB2 | WD repeat and SOCS box containing 2 | |
|
2 | 2 | ||||||
| MIRT531864 | POF1B | premature ovarian failure, 1B | |
|
2 | 2 | ||||||
| MIRT534916 | PTPN4 | protein tyrosine phosphatase, non-receptor type 4 | |
|
2 | 2 | ||||||
| MIRT536707 | IKZF2 | IKAROS family zinc finger 2 | |
|
2 | 2 | ||||||
| MIRT543555 | RPF2 | ribosome production factor 2 homolog | |
|
2 | 4 | ||||||
| MIRT545247 | GTF2E1 | general transcription factor IIE subunit 1 | |
|
2 | 2 | ||||||
| MIRT545376 | PM20D2 | peptidase M20 domain containing 2 | |
|
2 | 2 | ||||||
| MIRT548107 | GDAP2 | ganglioside induced differentiation associated protein 2 | |
|
2 | 2 | ||||||
| MIRT548301 | EPHA7 | EPH receptor A7 | |
|
2 | 2 | ||||||
| MIRT551453 | CARKD | NAD(P)HX dehydratase | |
|
2 | 2 | ||||||
| MIRT553195 | UBE2A | ubiquitin conjugating enzyme E2 A | |
|
2 | 2 | ||||||
| MIRT559416 | ASH1L | ASH1 like histone lysine methyltransferase | |
|
2 | 2 | ||||||
| MIRT561360 | YOD1 | YOD1 deubiquitinase | |
|
2 | 2 | ||||||
| MIRT561380 | TWF1 | twinfilin actin binding protein 1 | |
|
2 | 2 | ||||||
| MIRT562062 | KLHL15 | kelch like family member 15 | |
|
2 | 2 | ||||||
| MIRT563482 | ZWINT | ZW10 interacting kinetochore protein | |
|
2 | 2 | ||||||
| MIRT563510 | APOOL | apolipoprotein O like | |
|
2 | 2 | ||||||
| MIRT571391 | MRPL19 | mitochondrial ribosomal protein L19 | |
|
2 | 2 | ||||||
| MIRT573764 | PRKAG1 | protein kinase AMP-activated non-catalytic subunit gamma 1 | |
|
2 | 2 | ||||||
| MIRT576963 | Anxa4 | annexin A4 | |
|
2 | 3 | ||||||
| MIRT611048 | DAB2 | DAB2, clathrin adaptor protein | |
|
2 | 2 | ||||||
| MIRT614297 | ARL6IP6 | ADP ribosylation factor like GTPase 6 interacting protein 6 | |
|
2 | 2 | ||||||
| MIRT619715 | FCF1 | FCF1, rRNA-processing protein | |
|
2 | 2 | ||||||
| MIRT622278 | SH3TC2 | SH3 domain and tetratricopeptide repeats 2 | |
|
2 | 2 | ||||||
| MIRT622624 | PPM1K | protein phosphatase, Mg2+/Mn2+ dependent 1K | |
|
2 | 2 | ||||||
| MIRT624730 | ANXA4 | annexin A4 | |
|
2 | 3 | ||||||
| MIRT626553 | ZYG11B | zyg-11 family member B, cell cycle regulator | |
|
2 | 2 | ||||||
| MIRT649762 | USP22 | ubiquitin specific peptidase 22 | |
|
2 | 2 | ||||||
| MIRT652063 | TTC39B | tetratricopeptide repeat domain 39B | |
|
2 | 2 | ||||||
| MIRT653045 | STON2 | stonin 2 | |
|
2 | 2 | ||||||
| MIRT660573 | AQR | aquarius intron-binding spliceosomal factor | |
|
2 | 2 | ||||||
| MIRT686243 | ZFR | zinc finger RNA binding protein | |
|
2 | 2 | ||||||
| MIRT703405 | FZD6 | frizzled class receptor 6 | |
|
2 | 2 | ||||||
| MIRT709480 | LOXL2 | lysyl oxidase like 2 | |
|
2 | 2 | ||||||
| MIRT711268 | SDR9C7 | short chain dehydrogenase/reductase family 9C member 7 | |
|
2 | 2 | ||||||
| MIRT711426 | PROSER2 | proline and serine rich 2 | |
|
2 | 2 | ||||||
| MIRT720030 | CDK13 | cyclin dependent kinase 13 | |
|
2 | 2 | ||||||