pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4282 |
Genomic Coordinates | chr6: 72967687 - 72967753 |
Description | Homo sapiens miR-4282 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4282 | ||||||||||||
Sequence | 40| UAAAAUUUGCAUCCAGGA |57 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | SOLiD | DRVs in miRNA |
|
||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SON | ||||||||||||||||||||
Synonyms | BASS1, C21orf50, DBP-5, NREBP, SON3, TOKIMS | ||||||||||||||||||||
Description | SON DNA binding protein | ||||||||||||||||||||
Transcript | NM_138927 | ||||||||||||||||||||
Other Transcripts | NM_032195 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SON | |||||||||||||||||||||
3'UTR of SON (miRNA target sites are highlighted) |
>SON|NM_138927|3'UTR 1 TAAATGGAAGCGCTTACCAGCCCAGCTTTGCCAGCCCTAATAAGAAGCATGCTAAAGCCACAGCAGCTACTGTGGTTCTT 81 CAAGCAATGGGCCTTGTACCAAAGGACCTCATGGCTAATGCCACTTGCTTCAGGAGTGCCTCACGTAGATAGATTGAGGT 161 TTTATAATAATCATTTCAGAATTTTACTCTGCATCACAATGTATTTCCTCTTTAATGTTGTAAATATTTGGCAATTTAAG 241 ACATTGTGTAAAAAGCAATCTGTAAAAACATCTCCAGGCTTTGATTTTTGTACCATGGAAATTGTATTTAACCATACAGG 321 GTTTTGGTATGTTTATATTGTTTACCTTAGTGATGTATTTGTTTAAGTGGCTAACATCCAAACGACTGTTTGAAGGCATC 401 AGAGTAATCTTCAGTGTGGAATGTTAAATAACGCTTTTATACTGTATTTTGTACTATGATGTAACTCCCCTTCCTTATGG 481 CTAGGCTACTGTAACACTTGCCTGTAATCAGTGAAGGGCTGTGCACCTTGTACTATTTCACAATGGGTTCTGCTGGACAG 561 ATAATGGGCCAGTGTTATTGAGGTGATCAAGATCTGTTCCACAGGGCTAATGCCACCATCTCCCCTCAAAATTTTGTAGA 641 GGTTCTAAAAAGAAAGTGGTATGTTGTGTGATGATCAGCACTAAGTCCTGCATTCCTGTTAAAGCCACTTGGGTCATAAG 721 AAGGGAGTAAAAAATGAAGTCTGACTAGAATTCTATTGCAGAGGCCAAGTACATTTAGTATGGCATTGAGTTGTGATATA 801 GTTTTACTTTGATGTGCATTTTGAATTTCAGCTACACCTAGATAGACGTAAAATGATAATTAAAATGCTGTAACCAACTT 881 ATCTAATAAAATTGGCAACCAGCCACTATTTTGTTGACTATGAGAAAGTTAAAAGTTTATGTTAATTTTTAGGGTCTGAT 961 AGAATATTTCATGTGTATTACAGTGGTATTCATATGCTATGTCTCTAAACTTTATTTTCAAAAGCTTAAGGCCCAAATAC 1041 AAACTTCTCTGGAATAAACGTGGTGTTTTATTTTCTGGGTTATAAAGTGAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | TZM-bl |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000290239.6 | 3UTR | UAAUCAUUUCAGAAUUUUACUCUGCAUCACAAUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000290239.6 | 3UTR | UUUUAUAAUAAUCAUUUCAGAAUUUUACUCUGCAUCACAAUGUAUUUCCUCUUUAAUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000290239.6 | 3UTR | AAUUUUACUCUGCAUCACAAUGUAUUUCCUCUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000290239.6 | 3UTR | AAUUUUACUCUGCAUCACAAUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
280 hsa-miR-4282 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT057628 | LCOR | ligand dependent nuclear receptor corepressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT060732 | RPS3 | ribosomal protein S3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT063371 | ETNK1 | ethanolamine kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT066257 | LRIG3 | leucine rich repeats and immunoglobulin like domains 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT070774 | HIF1A | hypoxia inducible factor 1 alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT070871 | EIF2S1 | eukaryotic translation initiation factor 2 subunit alpha | ![]() |
![]() |
2 | 4 | ||||||
MIRT078056 | PCTP | phosphatidylcholine transfer protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT078408 | DCAF7 | DDB1 and CUL4 associated factor 7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT084059 | PPP1R3D | protein phosphatase 1 regulatory subunit 3D | ![]() |
![]() |
2 | 2 | ||||||
MIRT093537 | GALNT7 | polypeptide N-acetylgalactosaminyltransferase 7 | ![]() |
![]() |
2 | 6 | ||||||
MIRT096072 | SFXN1 | sideroflexin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT098316 | REV3L | REV3 like, DNA directed polymerase zeta catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT100493 | UHRF1BP1 | UHRF1 binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT102254 | HBP1 | HMG-box transcription factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT105318 | VPS37A | VPS37A, ESCRT-I subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT114143 | MZT1 | mitotic spindle organizing protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT114873 | DICER1 | dicer 1, ribonuclease III | ![]() |
![]() |
2 | 2 | ||||||
MIRT134683 | PNRC2 | proline rich nuclear receptor coactivator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT137640 | RCOR1 | REST corepressor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT155449 | CCNT2 | cyclin T2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT165656 | DCTN4 | dynactin subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT177570 | CSTF2T | cleavage stimulation factor subunit 2 tau variant | ![]() |
![]() |
2 | 4 | ||||||
MIRT188514 | E2F7 | E2F transcription factor 7 | ![]() |
![]() |
2 | 10 | ||||||
MIRT193019 | TMOD3 | tropomodulin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT195823 | GADD45A | growth arrest and DNA damage inducible alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT195885 | DEPDC1 | DEP domain containing 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT206029 | NUP50 | nucleoporin 50 | ![]() |
![]() |
2 | 6 | ||||||
MIRT212148 | CLCN3 | chloride voltage-gated channel 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT213999 | DCP2 | decapping mRNA 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT214650 | HNRNPA0 | heterogeneous nuclear ribonucleoprotein A0 | ![]() |
![]() |
2 | 2 | ||||||
MIRT221568 | CBX3 | chromobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT224544 | ZNF623 | zinc finger protein 623 | ![]() |
![]() |
2 | 2 | ||||||
MIRT227654 | SET | SET nuclear proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT229992 | CHIC1 | cysteine rich hydrophobic domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT238968 | QKI | QKI, KH domain containing RNA binding | ![]() |
![]() |
2 | 2 | ||||||
MIRT239825 | ACTB | actin beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT241084 | ZXDA | zinc finger, X-linked, duplicated A | ![]() |
![]() |
2 | 4 | ||||||
MIRT244852 | ZBTB5 | zinc finger and BTB domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT264534 | TARDBP | TAR DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT271438 | SKI | SKI proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT271597 | ENAH | ENAH, actin regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT294332 | ZNF264 | zinc finger protein 264 | ![]() |
![]() |
2 | 2 | ||||||
MIRT296341 | PARD6B | par-6 family cell polarity regulator beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT301715 | TEF | TEF, PAR bZIP transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT308549 | ZNF654 | zinc finger protein 654 | ![]() |
![]() |
2 | 2 | ||||||
MIRT313866 | DEPDC1B | DEP domain containing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT315529 | MARCKS | myristoylated alanine rich protein kinase C substrate | ![]() |
![]() |
2 | 2 | ||||||
MIRT321066 | RABGEF1 | RAB guanine nucleotide exchange factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT343777 | NUTF2 | nuclear transport factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT359109 | MAP1B | microtubule associated protein 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT397393 | GOLGA3 | golgin A3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT400822 | CPEB2 | cytoplasmic polyadenylation element binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442171 | DSEL | dermatan sulfate epimerase-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT442777 | JAG1 | jagged 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442862 | SCARF1 | scavenger receptor class F member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT442919 | PCBD2 | pterin-4 alpha-carbinolamine dehydratase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444567 | TRA2B | transformer 2 beta homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT444718 | CMSS1 | cms1 ribosomal small subunit homolog (yeast) | ![]() |
![]() |
2 | 2 | ||||||
MIRT445018 | RBMS3 | RNA binding motif single stranded interacting protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445853 | LRRC1 | leucine rich repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446242 | HELZ | helicase with zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT446542 | GOLGA8B | golgin A8 family member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT446643 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446948 | ZMAT3 | zinc finger matrin-type 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT447061 | KCNAB1 | potassium voltage-gated channel subfamily A member regulatory beta subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447327 | ZSCAN21 | zinc finger and SCAN domain containing 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447995 | CDX1 | caudal type homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448543 | RHEBP1 | RHEB pseudogene 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT448752 | HINT1 | histidine triad nucleotide binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448772 | GOLGA8A | golgin A8 family member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT449342 | WDR26 | WD repeat domain 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450011 | SLC16A6 | solute carrier family 16 member 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT450229 | PCNX | pecanex homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450340 | MRPL17 | mitochondrial ribosomal protein L17 | ![]() |
![]() |
2 | 4 | ||||||
MIRT450381 | MSI2 | musashi RNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450759 | PGGT1B | protein geranylgeranyltransferase type I subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT450809 | NRCAM | neuronal cell adhesion molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT450947 | ATAD2 | ATPase family, AAA domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459095 | CCPG1 | cell cycle progression 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462428 | TWISTNB | TWIST neighbor | ![]() |
![]() |
2 | 2 | ||||||
MIRT465200 | TROVE2 | TROVE domain family member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT467382 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT468546 | SERP1 | stress associated endoplasmic reticulum protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471506 | PDE4D | phosphodiesterase 4D | ![]() |
![]() |
2 | 2 | ||||||
MIRT471981 | NR3C1 | nuclear receptor subfamily 3 group C member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474478 | KLHL11 | kelch like family member 11 | ![]() |
![]() |
2 | 8 | ||||||
MIRT475011 | KANSL1 | KAT8 regulatory NSL complex subunit 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT480341 | C5orf51 | chromosome 5 open reading frame 51 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482696 | TEX9 | testis expressed 9 | ![]() |
![]() |
2 | 6 | ||||||
MIRT483462 | YTHDF1 | YTH N6-methyladenosine RNA binding protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT485623 | FAM217B | family with sequence similarity 217 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT485714 | CASP16 | caspase 16, pseudogene | ![]() |
![]() |
2 | 8 | ||||||
MIRT486279 | SEC23A | Sec23 homolog A, coat complex II component | ![]() |
![]() |
2 | 2 | ||||||
MIRT491000 | PEBP1 | phosphatidylethanolamine binding protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT492594 | PPIL4 | peptidylprolyl isomerase like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493365 | KIF5B | kinesin family member 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT494316 | CDKN1B | cyclin dependent kinase inhibitor 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT495208 | EDN3 | endothelin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497011 | TCF15 | transcription factor 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498512 | FRK | fyn related Src family tyrosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT498778 | PARP15 | poly(ADP-ribose) polymerase family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT501045 | SMG1 | SMG1, nonsense mediated mRNA decay associated PI3K related kinase | ![]() |
![]() |
2 | 6 | ||||||
MIRT502939 | CDC37L1 | cell division cycle 37 like 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT504806 | VHL | von Hippel-Lindau tumor suppressor | ![]() |
![]() |
2 | 6 | ||||||
MIRT505656 | SHMT1 | serine hydroxymethyltransferase 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505964 | RAB5C | RAB5C, member RAS oncogene family | ![]() |
![]() |
2 | 6 | ||||||
MIRT506322 | OTUD4 | OTU deubiquitinase 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506803 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 6 | ||||||
MIRT506917 | KBTBD8 | kelch repeat and BTB domain containing 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT507400 | EMC7 | ER membrane protein complex subunit 7 | ![]() |
![]() |
2 | 8 | ||||||
MIRT507471 | EDEM3 | ER degradation enhancing alpha-mannosidase like protein 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508058 | ATP13A3 | ATPase 13A3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT508135 | AMD1 | adenosylmethionine decarboxylase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509895 | RPS23 | ribosomal protein S23 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510881 | RAN | RAN, member RAS oncogene family | ![]() |
![]() |
2 | 8 | ||||||
MIRT513766 | PEX5L | peroxisomal biogenesis factor 5 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT516898 | COPS8 | COP9 signalosome subunit 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518703 | TIMD4 | T-cell immunoglobulin and mucin domain containing 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT520429 | TTPAL | alpha tocopherol transfer protein like | ![]() |
![]() |
2 | 6 | ||||||
MIRT521843 | PNISR | PNN interacting serine and arginine rich protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT522116 | NUDT3 | nudix hydrolase 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT525467 | TMPRSS12 | transmembrane protease, serine 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT525583 | MTRNR2L7 | MT-RNR2-like 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT525906 | BUB1 | BUB1 mitotic checkpoint serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT526072 | C11orf54 | chromosome 11 open reading frame 54 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526232 | MTRNR2L5 | MT-RNR2-like 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT526455 | FAM71F2 | family with sequence similarity 71 member F2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT526515 | POU5F1B | POU class 5 homeobox 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT528032 | FEZ2 | fasciculation and elongation protein zeta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528422 | MRPS16 | mitochondrial ribosomal protein S16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528995 | ISLR2 | immunoglobulin superfamily containing leucine rich repeat 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT529311 | ATRNL1 | attractin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529376 | SKP1 | S-phase kinase associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT530015 | SRRM1 | serine and arginine repetitive matrix 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530089 | FMN2 | formin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530942 | ENPP6 | ectonucleotide pyrophosphatase/phosphodiesterase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531229 | HIST1H2BD | histone cluster 1 H2B family member d | ![]() |
![]() |
2 | 2 | ||||||
MIRT533088 | YTHDF3 | YTH N6-methyladenosine RNA binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533299 | USP46 | ubiquitin specific peptidase 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533318 | UNKL | unkempt family like zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT533721 | TMEM30A | transmembrane protein 30A | ![]() |
![]() |
2 | 2 | ||||||
MIRT534096 | AZF1 | azoospermia factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534188 | SLC7A11 | solute carrier family 7 member 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534493 | SAR1B | secretion associated Ras related GTPase 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT536077 | MBOAT2 | membrane bound O-acyltransferase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536242 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537524 | FAM104A | family with sequence similarity 104 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT538088 | DGKH | diacylglycerol kinase eta | ![]() |
![]() |
2 | 2 | ||||||
MIRT538475 | CNBP | CCHC-type zinc finger nucleic acid binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT538853 | BTG1 | BTG anti-proliferation factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT539075 | GDNF | glial cell derived neurotrophic factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT539480 | ACVR2B | activin A receptor type 2B | ![]() |
![]() |
2 | 4 | ||||||
MIRT540210 | ARHGAP18 | Rho GTPase activating protein 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541940 | TSPAN2 | tetraspanin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543812 | COCH | cochlin | ![]() |
![]() |
2 | 2 | ||||||
MIRT545120 | PDZRN4 | PDZ domain containing ring finger 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545571 | GIMAP4 | GTPase, IMAP family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545989 | XKR4 | XK related 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547213 | PANK3 | pantothenate kinase 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547740 | KIAA1468 | KIAA1468 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548022 | GRB2 | growth factor receptor bound protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548032 | GOLIM4 | golgi integral membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548102 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548217 | FKBP1A | FK506 binding protein 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT548588 | DDX3X | DEAD-box helicase 3, X-linked | ![]() |
![]() |
2 | 4 | ||||||
MIRT548953 | CDC27 | cell division cycle 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549072 | CACUL1 | CDK2 associated cullin domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT550368 | INCENP | inner centromere protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT550546 | MYZAP | myocardial zonula adherens protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT551491 | TMEM192 | transmembrane protein 192 | ![]() |
![]() |
2 | 4 | ||||||
MIRT553078 | UEVLD | UEV and lactate/malate dehyrogenase domains | ![]() |
![]() |
2 | 2 | ||||||
MIRT554104 | SMU1 | DNA replication regulator and spliceosomal factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT555127 | PTPRG | protein tyrosine phosphatase, receptor type G | ![]() |
![]() |
2 | 2 | ||||||
MIRT555477 | POC1B-GALNT4 | POC1B-GALNT4 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT555978 | NPTN | neuroplastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT557011 | HPRT1 | hypoxanthine phosphoribosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557706 | GALNT4 | polypeptide N-acetylgalactosaminyltransferase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558333 | DNAJC28 | DnaJ heat shock protein family (Hsp40) member C28 | ![]() |
![]() |
2 | 4 | ||||||
MIRT558488 | DBN1 | drebrin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559942 | ZNF567 | zinc finger protein 567 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561127 | ATP2B1 | ATPase plasma membrane Ca2+ transporting 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561791 | PAWR | pro-apoptotic WT1 regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT562438 | EEF2 | eukaryotic translation elongation factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563102 | PABPC4L | poly(A) binding protein cytoplasmic 4 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT563212 | ZNF813 | zinc finger protein 813 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563426 | KIF3A | kinesin family member 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT563473 | SPIN4 | spindlin family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564015 | HSPA4 | heat shock protein family A (Hsp70) member 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT564117 | ZYG11B | zyg-11 family member B, cell cycle regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT564223 | SDE2 | SDE2 telomere maintenance homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT564503 | CACNG1 | calcium voltage-gated channel auxiliary subunit gamma 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564515 | DUSP3 | dual specificity phosphatase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564811 | ZBTB21 | zinc finger and BTB domain containing 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565265 | TPD52 | tumor protein D52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566012 | RHOB | ras homolog family member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT566216 | PTMA | prothymosin, alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT566638 | NFYA | nuclear transcription factor Y subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT566821 | MAPK8 | mitogen-activated protein kinase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566948 | LEPROT | leptin receptor overlapping transcript | ![]() |
![]() |
2 | 2 | ||||||
MIRT567290 | HNRNPAB | heterogeneous nuclear ribonucleoprotein A/B | ![]() |
![]() |
2 | 2 | ||||||
MIRT567895 | CSTF2 | cleavage stimulation factor subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568731 | MTRNR2L3 | MT-RNR2-like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571263 | ZNF239 | zinc finger protein 239 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572593 | EIF2AK4 | eukaryotic translation initiation factor 2 alpha kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573827 | TGOLN2 | trans-golgi network protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT576391 | Fhl2 | four and a half LIM domains 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609901 | SMS | spermine synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT613710 | ELMSAN1 | ELM2 and Myb/SANT domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT614406 | ADAT1 | adenosine deaminase, tRNA specific 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615042 | DCX | doublecortin | ![]() |
![]() |
2 | 2 | ||||||
MIRT617514 | C5orf45 | MRN complex interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT619476 | PRDM10 | PR/SET domain 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620349 | TLN1 | talin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620910 | PLA2G7 | phospholipase A2 group VII | ![]() |
![]() |
2 | 2 | ||||||
MIRT622131 | SP4 | Sp4 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT622955 | OTUD7B | OTU deubiquitinase 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT623351 | MAGI3 | membrane associated guanylate kinase, WW and PDZ domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623619 | INTU | inturned planar cell polarity protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT624409 | CCDC171 | coiled-coil domain containing 171 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625171 | CCS | copper chaperone for superoxide dismutase | ![]() |
![]() |
2 | 2 | ||||||
MIRT625685 | RPP40 | ribonuclease P/MRP subunit p40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625875 | ALDH18A1 | aldehyde dehydrogenase 18 family member A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626002 | FAM107A | family with sequence similarity 107 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT626872 | HRH4 | histamine receptor H4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT628220 | FKBP9 | FK506 binding protein 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628265 | DIO2 | iodothyronine deiodinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628402 | C8orf37 | chromosome 8 open reading frame 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630564 | C3orf36 | chromosome 3 open reading frame 36 | ![]() |
![]() |
2 | 4 | ||||||
MIRT631577 | RASSF9 | Ras association domain family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635730 | CCDC58 | coiled-coil domain containing 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636224 | SLC8A1 | solute carrier family 8 member A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636613 | CLIC5 | chloride intracellular channel 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638899 | CDK9 | cyclin dependent kinase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640167 | ATXN7L1 | ataxin 7 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642070 | GTDC1 | glycosyltransferase like domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643034 | CHCHD7 | coiled-coil-helix-coiled-coil-helix domain containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644572 | SPOP | speckle type BTB/POZ protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT644954 | IFNB1 | interferon beta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645948 | TTF2 | transcription termination factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT646440 | XRCC2 | X-ray repair cross complementing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647896 | EPN2 | epsin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648276 | ZNF582 | zinc finger protein 582 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649381 | NEDD1 | neural precursor cell expressed, developmentally down-regulated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650254 | CD68 | CD68 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT650333 | ATP5S | ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) | ![]() |
![]() |
2 | 2 | ||||||
MIRT651707 | VMP1 | vacuole membrane protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651774 | VASP | vasodilator stimulated phosphoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT653144 | SRPK2 | SRSF protein kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654112 | RPS6KA5 | ribosomal protein S6 kinase A5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654161 | RORB | RAR related orphan receptor B | ![]() |
![]() |
2 | 2 | ||||||
MIRT655716 | MLF2 | myeloid leukemia factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657476 | HDAC4 | histone deacetylase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658095 | FOXO1 | forkhead box O1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658860 | DTX3L | deltex E3 ubiquitin ligase 3L | ![]() |
![]() |
2 | 2 | ||||||
MIRT658988 | DNAJA1 | DnaJ heat shock protein family (Hsp40) member A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660767 | ALDH6A1 | aldehyde dehydrogenase 6 family member A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661622 | C2orf15 | chromosome 2 open reading frame 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661694 | TFDP2 | transcription factor Dp-2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662208 | PLA2G4E | phospholipase A2 group IVE | ![]() |
![]() |
2 | 2 | ||||||
MIRT662443 | RALGAPA1 | Ral GTPase activating protein catalytic alpha subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664422 | ADH5 | alcohol dehydrogenase 5 (class III), chi polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT687505 | NECAB1 | N-terminal EF-hand calcium binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689910 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690781 | PLA2G2C | phospholipase A2 group IIC | ![]() |
![]() |
2 | 2 | ||||||
MIRT698488 | TIAL1 | TIA1 cytotoxic granule associated RNA binding protein like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699685 | SFMBT2 | Scm like with four mbt domains 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700926 | PDS5A | PDS5 cohesin associated factor A | ![]() |
![]() |
2 | 2 | ||||||
MIRT702258 | LMNB1 | lamin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703166 | GPR137C | G protein-coupled receptor 137C | ![]() |
![]() |
2 | 2 | ||||||
MIRT703242 | GNS | glucosamine (N-acetyl)-6-sulfatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT704737 | CENPQ | centromere protein Q | ![]() |
![]() |
2 | 2 | ||||||
MIRT707310 | GLRX2 | glutaredoxin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710021 | KCNQ5 | potassium voltage-gated channel subfamily Q member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712212 | SCOC | short coiled-coil protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT714742 | SETBP1 | SET binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718268 | ZNF749 | zinc finger protein 749 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720553 | DYRK4 | dual specificity tyrosine phosphorylation regulated kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722248 | RBM41 | RNA binding motif protein 41 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723767 | MPLKIP | M-phase specific PLK1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT723977 | KIAA0146 | scaffolding protein involved in DNA repair | ![]() |
1 | 1 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|