| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-3911 |
| Genomic Coordinates | chr9: 127690687 - 127690795 |
| Description | Homo sapiens miR-3911 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-3911 | |||||||||||||||||||||||||||
| Sequence | 12| UGUGUGGAUCCUGGAGGAGGCA |33 | |||||||||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||||||||
| Experiments | Illumina | DRVs in miRNA |
|
|||||||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | SLC7A5 | ||||||||||||||||||||
| Synonyms | 4F2LC, CD98, D16S469E, E16, LAT1, MPE16 | ||||||||||||||||||||
| Description | solute carrier family 7 member 5 | ||||||||||||||||||||
| Transcript | NM_003486 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on SLC7A5 | |||||||||||||||||||||
| 3'UTR of SLC7A5 (miRNA target sites are highlighted) |
>SLC7A5|NM_003486|3'UTR 1 CCAGGAGGCCGAGTGGCTGCCGGAGGAGCATGCGCAGAGGCCAGTTAAAGTAGATCACCTCCTCGAACCCACTCCGGTTC 81 CCCGCAACCCACAGCTCAGCTGCCCATCCCAGTCCCTCGCCGTCCCTCCCAGGTCGGGCAGTGGAGGCTGCTGTGAAAAC 161 TCTGGTACGAATCTCATCCCTCAACTGAGGGCCAGGGACCCAGGTGTGCCTGTGCTCCTGCCCAGGAGCAGCTTTTGGTC 241 TCCTTGGGCCCTTTTTCCCTTCCCTCCTTTGTTTACTTATATATATATTTTTTTTAAACTTAAATTTTGGGTCAACTTGA 321 CACCACTAAGATGATTTTTTAAGGAGCTGGGGGAAGGCAGGAGCCTTCCTTTCTCCTGCCCCAAGGGCCCAGACCCTGGG 401 CAAACAGAGCTACTGAGACTTGGAACCTCATTGCTACCACAGACTTGCACTGAAGCCGGACAGCTGCCCAGACACATGGG 481 CTTGTGACATTCGTGAAAACCAACCCTGTGGGCTTATGTCTCTGCCTTAGGGTTTGCAGAGTGGAAACTCAGCCGTAGGG 561 TGGCACTGGGAGGGGGTGGGGGATCTGGGCAAGGTGGGTGATTCCTCCCAGGAGGTGCTTGAGGCCCCGATGGACTCCTG 641 ACCATAATCCTAGCCCCGAGACACCATCCTGAGCCAGGGAACAGCCCCAGGGTTGGGGGGTGCCGGCATCTCCCCTAGCT 721 CACCAGGCCTGGCCTCTGGGCAGTGTGGCCTCTTGGCTATTTCTGTGTCCAGTTTTGGAGGCTGAGTTCTGGTTCATGCA 801 GACAAAGCCCTGTCCTTCAGTCTTCTAGAAACAGAGACAAGAAAGGCAGACACACCGCGGCCAGGCACCCATGTGGGCGC 881 CCACCCTGGGCTCCACACAGCAGTGTCCCCTGCCCCAGAGGTCGCAGCTACCCTCAGCCTCCAATGCATTGGCCTCTGTA 961 CCGCCCGGCAGCCCCTTCTGGCCGGTGCTGGGTTCCCACTCCCGGCCTAGGCACCTCCCCGCTCTCCCTGTCACGCTCAT 1041 GTCCTGTCCTGGTCCTGATGCCCGTTGTCTAGGAGACAGAGCCAAGCACTGCTCACGTCTCTGCCGCCTGCGTTTGGAGG 1121 CCCCTGGGCTCTCACCCAGTCCCCACCCGCCTGCAGAGAGGGAACTAGGGCACCCCTTGTTTCTGTTGTTCCCGTGAATT 1201 TTTTTCGCTATGGGAGGCAGCCGAGGCCTGGCCAATGCGGCCCACTTTCCTGAGCTGTCGCTGCCTCCATGGCAGCAGCC 1281 AGGGACCCCCAGAACAAGAAGACCCCGCAGGATCCCTCCTGAGCTCGGGGGGCTCTGCCTTCTCAGGCCCCGGGCTTCCC 1361 TTCTCCCCAGCCAGAGGTGGAGCCAAGTGGTCCAGCGTCACTCCAGTGCTCAGCTGTGGCTGGAGGAGCTGGCCTGTGGC 1441 ACAGCCCTGAGTGTCCCAAGCCGGGAGCCAACGAAGCCGGACACGGCTTCACTGACCAGCGGCTGCTCAAGCCGCAAGCT 1521 CTCAGCAAGTGCCCAGTGGAGCCTGCCGCCCCCGCCTGGGCACCGGGACCCCCTCACCATCCAGTGGGCCCGGAGAAACC 1601 TGATGAACAGTTTGGGGACTCAGGACCAGATGTCCGTCTCTCTTGCTTGAGGAATGAAGACCTTTATTCACCCCTGCCCC 1681 GTTGCTTCCCGCTGCACATGGACAGACTTCACAGCGTCTGCTCATAGGACCTGCATCCTTCCTGGGGACGAATTCCACTC 1761 GTCCAAGGGACAGCCCACGGTCTGGAGGCCGAGGACCACCAGCAGGCAGGTGGACTGACTGTGTTGGGCAAGACCTCTTC 1841 CCTCTGGGCCTGTTCTCTTGGCTGCAAATAAGGACAGCAGCTGGTGCCCCACCTGCCTGGTGCATTGCTGTGTGAATCCA 1921 GGAGGCAGTGGACATCGTAGGCAGCCACGGCCCCGGGTCCAGGAGAAGTGCTCCCTGGAGGCACGCACCACTGCTTCCCA 2001 CTGGGGCCGGCGGGGCCCACGCACGACGTCAGCCTCTTACCTTCCCGCCTCGGCTAGGGGTCCTCGGGATGCCGTTCTGT 2081 TCCAACCTCCTGCTCTGGGACGTGGACATGCCTCAAGGATACAGGGAGCCGGCGGCCTCTCGACGGCACGCACTTGCCTG 2161 TTGGCTGCTGCGGCTGTGGGCGAGCATGGGGGCTGCCAGCGTCTGTTGTGGAAAGTAGCTGCTAGTGAAATGGCTGGGGC 2241 CGCTGGGGTCCGTCTTCACACTGCGCAGGTCTCTTCTGGGCGTCTGAGCTGGGGTGGGAGCTCCTCCGCAGAAGGTTGGT 2321 GGGGGGTCCAGTCTGTGATCCTTGGTGCTGTGTGCCCCACTCCAGCCTGGGGACCCCACTTCAGAAGGTAGGGGCCGTGT 2401 CCCGCGGTGCTGACTGAGGCCTGCTTCCCCCTCCCCCTCCTGCTGTGCTGGAATTCCACAGGGACCAGGGCCACCGCAGG 2481 GGACTGTCTCAGAAGACTTGATTTTTCCGTCCCTTTTTCTCCACACTCCACTGACAAACGTCCCCAGCGGTTTCCACTTG 2561 TGGGCTTCAGGTGTTTTCAAGCACAACCCACCACAACAAGCAAGTGCATTTTCAGTCGTTGTGCTTTTTTGTTTTGTGCT 2641 AACGTCTTACTAATTTAAAGATGCTGTCGGCACCATGTTTATTTATTTCCAGTGGTCATGCTCAGCCTTGCTGCTCTGCG 2721 TGGCGCAGGTGCCATGCCTGCTCCCTGTCTGTGTCCCAGCCACGCAGGGCCATCCACTGTGACGTCGGCCGACCAGGCTG 2801 GACACCCTCTGCCGAGTAATGACGTGTGTGGCTGGGACCTTCTTTATTCTGTGTTAATGGCTAACCTGTTACACTGGGCT 2881 GGGTTGGGTAGGGTGTTCTGGCTTTTTTGTGGGGTTTTTATTTTTAAAGAAACACTCAATCATCCTACCGCTGAAAAAAA 2961 AAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | hESCs (WA-09) | ||||||
| Disease | 8140.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | TZM-bl | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2
PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6
PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11
PAR-CLIP data was present in ERX177610. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_12
PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2
PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11
PAR-CLIP data was present in ERX177622. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_12
PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1
PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2
PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8
PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM4903831 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Human neurons / 124TD_shELAVL3_a |
| Location of target site | NM_003486 | 3UTR | GUCCCUUUUUCUCCA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE161238 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000565644.1 | 3UTR | AUUUUUCCGUCCCUUUUUCUCCACACUCCACUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000565644.1 | 3UTR | AUUUUUCCGUCCCUUUUUCUCCACACUCCACUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000565644.1 | 3UTR | AUUUUUCCGUCCCUUUUUCUCCACACUCCACUGAC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
70 hsa-miR-3911 Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT207399 | MAT2A | methionine adenosyltransferase 2A |  |
|
2 | 6 | ||||||
| MIRT284537 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | |
|
2 | 2 | ||||||
| MIRT291946 | TPM4 | tropomyosin 4 | |
|
2 | 2 | ||||||
| MIRT293609 | PVR | poliovirus receptor | |
|
2 | 2 | ||||||
| MIRT357688 | PAIP2 | poly(A) binding protein interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT451607 | MEIS3P1 | Meis homeobox 3 pseudogene 1 | |
|
2 | 2 | ||||||
| MIRT452110 | IFITM1 | interferon induced transmembrane protein 1 | |
|
2 | 2 | ||||||
| MIRT457804 | KLHL25 | kelch like family member 25 | |
|
2 | 2 | ||||||
| MIRT462730 | EFNB1 | ephrin B1 | |
|
2 | 2 | ||||||
| MIRT463219 | ZNF131 | zinc finger protein 131 | |
|
2 | 2 | ||||||
| MIRT464141 | VPS28 | VPS28, ESCRT-I subunit | |
|
2 | 2 | ||||||
| MIRT467582 | SLC7A5 | solute carrier family 7 member 5 | |
|
2 | 6 | ||||||
| MIRT470824 | PLXND1 | plexin D1 | |
|
2 | 2 | ||||||
| MIRT474230 | LCLAT1 | lysocardiolipin acyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT478989 | COLGALT1 | collagen beta(1-O)galactosyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT479462 | CDK6 | cyclin dependent kinase 6 | |
|
2 | 2 | ||||||
| MIRT483558 | SYT2 | synaptotagmin 2 | |
|
2 | 2 | ||||||
| MIRT484483 | SLC9A1 | solute carrier family 9 member A1 | |
|
2 | 2 | ||||||
| MIRT485224 | PRICKLE1 | prickle planar cell polarity protein 1 | |
|
2 | 2 | ||||||
| MIRT490356 | DPYSL5 | dihydropyrimidinase like 5 | |
|
2 | 4 | ||||||
| MIRT493177 | MKNK2 | MAP kinase interacting serine/threonine kinase 2 | |
|
2 | 2 | ||||||
| MIRT509802 | CHAF1B | chromatin assembly factor 1 subunit B | |
|
2 | 4 | ||||||
| MIRT511815 | HDGF | heparin binding growth factor | |
|
2 | 2 | ||||||
| MIRT512254 | ARPP19 | cAMP regulated phosphoprotein 19 | |
|
2 | 6 | ||||||
| MIRT513025 | GPT2 | glutamic--pyruvic transaminase 2 | |
|
2 | 2 | ||||||
| MIRT519640 | ZNF772 | zinc finger protein 772 | |
|
2 | 4 | ||||||
| MIRT531178 | SIGLEC12 | sialic acid binding Ig like lectin 12 (gene/pseudogene) | |
|
2 | 2 | ||||||
| MIRT537870 | EDA2R | ectodysplasin A2 receptor | |
|
2 | 2 | ||||||
| MIRT551914 | IGLON5 | IgLON family member 5 | |
|
2 | 2 | ||||||
| MIRT558359 | DMTF1 | cyclin D binding myb like transcription factor 1 | |
|
2 | 2 | ||||||
| MIRT559771 | URGCP-MRPS24 | URGCP-MRPS24 readthrough | |
|
2 | 4 | ||||||
| MIRT559813 | ZNF83 | zinc finger protein 83 | |
|
2 | 2 | ||||||
| MIRT561999 | LPP | LIM domain containing preferred translocation partner in lipoma | |
|
2 | 2 | ||||||
| MIRT565754 | SERTAD2 | SERTA domain containing 2 | |
|
2 | 2 | ||||||
| MIRT569423 | DCAF8 | DDB1 and CUL4 associated factor 8 | |
|
2 | 2 | ||||||
| MIRT569845 | RGS5 | regulator of G protein signaling 5 | |
|
2 | 2 | ||||||
| MIRT606928 | CDK15 | cyclin dependent kinase 15 | |
|
2 | 2 | ||||||
| MIRT607616 | TMEM130 | transmembrane protein 130 | |
|
2 | 4 | ||||||
| MIRT607629 | TRIOBP | TRIO and F-actin binding protein | |
|
2 | 2 | ||||||
| MIRT607885 | SATB1 | SATB homeobox 1 | |
|
2 | 2 | ||||||
| MIRT607942 | SSX2 | SSX family member 2 | |
|
2 | 4 | ||||||
| MIRT608017 | CARNS1 | carnosine synthase 1 | |
|
2 | 4 | ||||||
| MIRT608036 | UBLCP1 | ubiquitin like domain containing CTD phosphatase 1 | |
|
2 | 2 | ||||||
| MIRT608063 | SSX2B | SSX family member 2B | |
|
2 | 4 | ||||||
| MIRT608558 | SBK1 | SH3 domain binding kinase 1 | |
|
2 | 6 | ||||||
| MIRT608915 | NCDN | neurochondrin | |
|
2 | 6 | ||||||
| MIRT615876 | HIF1AN | hypoxia inducible factor 1 alpha subunit inhibitor | |
|
2 | 4 | ||||||
| MIRT618023 | ELFN1 | extracellular leucine rich repeat and fibronectin type III domain containing 1 | |
|
2 | 2 | ||||||
| MIRT620505 | SNRPD1 | small nuclear ribonucleoprotein D1 polypeptide | |
|
2 | 2 | ||||||
| MIRT628101 | IL1RAPL1 | interleukin 1 receptor accessory protein like 1 | |
|
2 | 2 | ||||||
| MIRT628700 | ZNF548 | zinc finger protein 548 | |
|
2 | 2 | ||||||
| MIRT630658 | POU2F1 | POU class 2 homeobox 1 | |
|
2 | 2 | ||||||
| MIRT643508 | ZNF28 | zinc finger protein 28 | |
|
2 | 2 | ||||||
| MIRT646379 | SLC22A6 | solute carrier family 22 member 6 | |
|
2 | 2 | ||||||
| MIRT660041 | C15orf61 | chromosome 15 open reading frame 61 | |
|
2 | 2 | ||||||
| MIRT687700 | KRR1 | KRR1, small subunit processome component homolog | |
|
2 | 2 | ||||||
| MIRT688858 | CAMKK2 | calcium/calmodulin dependent protein kinase kinase 2 | |
|
2 | 2 | ||||||
| MIRT690443 | REPIN1 | replication initiator 1 | |
|
2 | 2 | ||||||
| MIRT690456 | ZNF33A | zinc finger protein 33A | |
|
2 | 2 | ||||||
| MIRT693796 | RHOG | ras homolog family member G | |
|
2 | 2 | ||||||
| MIRT694274 | ZNF529 | zinc finger protein 529 | |
|
2 | 4 | ||||||
| MIRT697697 | WAC | WW domain containing adaptor with coiled-coil | |
|
2 | 2 | ||||||
| MIRT700242 | RCC2 | regulator of chromosome condensation 2 | |
|
2 | 2 | ||||||
| MIRT701836 | MRPL37 | mitochondrial ribosomal protein L37 | |
|
2 | 2 | ||||||
| MIRT704255 | DHCR24 | 24-dehydrocholesterol reductase | |
|
2 | 2 | ||||||
| MIRT707203 | SDK2 | sidekick cell adhesion molecule 2 | |
|
2 | 2 | ||||||
| MIRT710365 | CREB5 | cAMP responsive element binding protein 5 | |
|
2 | 2 | ||||||
| MIRT711943 | WDFY1 | WD repeat and FYVE domain containing 1 | |
|
2 | 2 | ||||||
| MIRT715496 | MAZ | MYC associated zinc finger protein | |
|
2 | 2 | ||||||
| MIRT719250 | MS4A1 | membrane spanning 4-domains A1 | |
|
2 | 2 | ||||||
| miRNA-Drug Associations | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|