miRTarBase - #MIRT468824


—
pre-miRNA Information
pre-miRNA hsa-mir-4421   
Genomic Coordinates chr1: 51059837 - 51059905
Description Homo sapiens miR-4421 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4421
Sequence 43| ACCUGUCUGUGGAAAGGAGCUA |64
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1222858590 1 dbSNP
rs1334405255 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RSRC2   
Synonyms -
Description arginine and serine rich coiled-coil 2
Transcript NM_023012   
Expression
Putative miRNA Targets on RSRC2
3'UTR of RSRC2
(miRNA target sites are highlighted)		 
>RSRC2|NM_023012|3'UTR
   1 AAATGATCACACTTGTAAAGTTTGGGACTTATAGACTTCTTGTTCTGATGTCACGTCCTTGTTCACCAAACAGCTAGCAC
  81 TCTAGCTTGCATGGGTGTTGCATTGACTTTAATTTATTGAAAAATACAAATTTTTGTAAATATCAGATCAGTGATACTGG
 161 TGTTAGTGTTGTAATCAGGTTAAACCCACTTCCATTAAACTTGACAGGACTATAGAAGGATAATATTTTTTAGTTCATGA
 241 ATTCTACTTTTCAAATATATAAAAGCTGCAGGTGGGGATAAAATCTCATACATGGATTTTTTCGTGTCCGCTGTCTTGTG
 321 TACTTTTGTACTTAACCTTGTACAGTTATTTTCATCTCTTGAAACATGAAAGAAATGTTATGTAGATGTTCTTTAGAAGA
 401 TCTGGCCATTTGGTACATAATCCAGCACAGATAAGCTGGGTGGTAATGATAATAAAAATGGTTTTCTCAAAACTGGTGTT
 481 AATTTAAGTTACCTGGGATGTTTCTTTGAATTTGTTTTATAGTTTCTGTAGCATTTGGCAATTGCTGTTAGAAAACACTA
 561 GCTAGAAATCCCCTCCCCACCACCCTTTTTAAGGCCAGTTAACTATACTACAGTCAATACCGTGGTGAGCAAAAATGTAA
 641 AAGGTGGAAGGAGAAAACTTACTAAAATAGTATGTTTTCCTATTATAAGGGACAGACTTGGTATTCAGTATTTGTCAAAT
 721 ATTACATGTGTTATTCAGGAGATAGATTAATGCATTAAAGGGATGTAAGCACTTTTATTTTAATAAAGTGCCTTATAACA
 801 AGTTCTTTGCATGCTTTTTGCTCATTATCCCTTTGAAGTCTTCTCCAGCATAGACTATAAAATATTAAAATATTAGAAAT
 881 TTTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aucGAGGAAAGGUG-UCUGUCCa 5'
             :||| ||  ||  |||||| 
Target 5' cacTTCCATTAAACTTGACAGGa 3'
 187 - 209 127.00 -14.20
2 
miRNA  3' aucGAGGA-AA-GGUGUCUGUCca 5'
             :|||| || : | :|||||  
Target 5' gttTTCCTATTATAAGGGACAGac 3'
 674 - 697 119.00 -11.10
3 
miRNA  3' aucgAGGAA-AGGU-GUCUGUCca 5'
              ||||| |:|| || ||||  
Target 5' cacgTCCTTGTTCACCAAACAGct 3'
 52 - 75 118.00 -11.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN13375597 5 COSMIC
COSN8585505 5 COSMIC
COSN26993501 12 COSMIC
COSN1560442 24 COSMIC
COSN30193722 29 COSMIC
COSN30189211 35 COSMIC
COSN30130534 38 COSMIC
COSN30737548 101 COSMIC
COSN31549272 114 COSMIC
COSN28735540 146 COSMIC
COSN31525292 148 COSMIC
COSN1560440 212 COSMIC
COSN31486457 287 COSMIC
COSN5713346 352 COSMIC
COSN31484152 385 COSMIC
COSN17731134 636 COSMIC
COSN28735724 644 COSMIC
COSN28794452 662 COSMIC
COSN8585504 762 COSMIC
COSN28796952 839 COSMIC
COSN19373171 986 COSMIC
COSN5933049 1306 COSMIC
COSN22631148 2031 COSMIC
rs12818552 1231 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs754121347 1 dbSNP
rs1430082972 2 dbSNP
rs780370347 3 dbSNP
rs1314879694 4 dbSNP
rs542262304 5 dbSNP
rs1366166063 7 dbSNP
rs1228009284 12 dbSNP
rs1350053406 16 dbSNP
rs762206849 16 dbSNP
rs1171505089 20 dbSNP
rs750595710 21 dbSNP
rs1278519147 23 dbSNP
rs1420103757 30 dbSNP
rs1115154 32 dbSNP
rs1243101213 33 dbSNP
rs375470822 35 dbSNP
rs1187496822 37 dbSNP
rs1161110290 39 dbSNP
rs763303982 42 dbSNP
rs776423338 42 dbSNP
rs763831459 45 dbSNP
rs1428546294 46 dbSNP
rs555480464 49 dbSNP
rs762849688 49 dbSNP
rs1327693397 54 dbSNP
rs900292884 55 dbSNP
rs773607957 64 dbSNP
rs1053458365 65 dbSNP
rs1038744255 67 dbSNP
rs1373537281 69 dbSNP
rs1437274932 71 dbSNP
rs745957489 79 dbSNP
rs1343460916 81 dbSNP
rs942893969 102 dbSNP
rs1386167320 103 dbSNP
rs146283745 105 dbSNP
rs902174654 110 dbSNP
rs544754927 113 dbSNP
rs780296834 118 dbSNP
rs986957832 119 dbSNP
rs1178840855 120 dbSNP
rs1412636073 127 dbSNP
rs530691474 129 dbSNP
rs946298346 130 dbSNP
rs943958818 135 dbSNP
rs912400118 136 dbSNP
rs1168731128 142 dbSNP
rs913444483 142 dbSNP
rs990594092 143 dbSNP
rs1049528730 145 dbSNP
rs1323161255 146 dbSNP
rs571488556 149 dbSNP
rs141829241 151 dbSNP
rs537269086 156 dbSNP
rs1198722313 158 dbSNP
rs879391149 162 dbSNP
rs1226942685 173 dbSNP
rs558763629 173 dbSNP
rs940052738 187 dbSNP
rs1358002437 188 dbSNP
rs908519837 190 dbSNP
rs1210013721 194 dbSNP
rs982129605 201 dbSNP
rs1255255278 206 dbSNP
rs1197222468 211 dbSNP
rs1449310515 212 dbSNP
rs748605669 214 dbSNP
rs551302444 222 dbSNP
rs1252443051 223 dbSNP
rs1023156506 225 dbSNP
rs190177498 226 dbSNP
rs1034462574 227 dbSNP
rs957519306 237 dbSNP
rs1032134481 245 dbSNP
rs1473021048 252 dbSNP
rs1000599295 254 dbSNP
rs1388867014 258 dbSNP
rs14519 263 dbSNP
rs1411719231 271 dbSNP
rs1214798794 272 dbSNP
rs1308784824 275 dbSNP
rs1340806005 275 dbSNP
rs1370452183 278 dbSNP
rs902206238 281 dbSNP
rs1024160123 288 dbSNP
rs1020592007 289 dbSNP
rs111226568 292 dbSNP
rs891007370 302 dbSNP
rs1353899780 303 dbSNP
rs781737893 303 dbSNP
rs932518821 304 dbSNP
rs1482455234 309 dbSNP
rs1027572122 310 dbSNP
rs994938594 313 dbSNP
rs11548718 315 dbSNP
rs1442727396 322 dbSNP
rs554238720 323 dbSNP
rs1038650701 332 dbSNP
rs1444236584 334 dbSNP
rs1451604749 339 dbSNP
rs1169277220 340 dbSNP
rs1399281534 344 dbSNP
rs898329470 352 dbSNP
rs1329745594 356 dbSNP
rs1427943881 361 dbSNP
rs1411889961 367 dbSNP
rs1315279644 372 dbSNP
rs1038438422 381 dbSNP
rs940104788 386 dbSNP
rs1172109703 387 dbSNP
rs1332650832 388 dbSNP
rs1008612168 391 dbSNP
rs1455084811 394 dbSNP
rs908549547 395 dbSNP
rs868147931 397 dbSNP
rs1340758531 399 dbSNP
rs981442267 400 dbSNP
rs1177324531 402 dbSNP
rs1457541645 405 dbSNP
rs1345717129 406 dbSNP
rs950350751 408 dbSNP
rs1199635004 417 dbSNP
rs916200297 419 dbSNP
rs991739055 420 dbSNP
rs57347146 425 dbSNP
rs1466108183 426 dbSNP
rs1189414813 433 dbSNP
rs1247651213 437 dbSNP
rs1447675795 438 dbSNP
rs3741448 440 dbSNP
rs1033165665 441 dbSNP
rs1466019033 445 dbSNP
rs1275856050 449 dbSNP
rs1171354988 453 dbSNP
rs1391240362 454 dbSNP
rs1218199698 458 dbSNP
rs979605885 468 dbSNP
rs1348486964 476 dbSNP
rs28701727 483 dbSNP
rs1021044623 487 dbSNP
rs980071740 488 dbSNP
rs1232379875 491 dbSNP
rs1007862164 494 dbSNP
rs550251854 500 dbSNP
rs1330870230 509 dbSNP
rs1209140515 518 dbSNP
rs1279976637 519 dbSNP
rs890782683 520 dbSNP
rs1192967645 521 dbSNP
rs971481218 522 dbSNP
rs538390285 541 dbSNP
rs1028234852 542 dbSNP
rs1458081050 555 dbSNP
rs1158981808 556 dbSNP
rs1316694210 558 dbSNP
rs1357714622 559 dbSNP
rs1333581474 561 dbSNP
rs1294948811 565 dbSNP
rs996697965 571 dbSNP
rs570907041 572 dbSNP
rs1299034751 575 dbSNP
rs950563668 578 dbSNP
rs1287539740 580 dbSNP
rs1326839467 580 dbSNP
rs1377354374 586 dbSNP
rs1266267526 589 dbSNP
rs1157338366 594 dbSNP
rs552745240 601 dbSNP
rs527941859 603 dbSNP
rs1028005286 605 dbSNP
rs1439642806 606 dbSNP
rs1254585996 608 dbSNP
rs1409145923 609 dbSNP
rs1473229229 610 dbSNP
rs1416514969 614 dbSNP
rs1179359621 617 dbSNP
rs746046095 618 dbSNP
rs1235438652 619 dbSNP
rs778414079 621 dbSNP
rs185268566 622 dbSNP
rs1350126040 630 dbSNP
rs548929406 631 dbSNP
rs887159040 635 dbSNP
rs1046153729 636 dbSNP
rs950119458 639 dbSNP
rs1300820601 649 dbSNP
rs1008477700 650 dbSNP
rs10998 662 dbSNP
rs1056087950 667 dbSNP
rs528248833 671 dbSNP
rs1370820129 674 dbSNP
rs1010851152 682 dbSNP
rs1321419025 684 dbSNP
rs1284690756 686 dbSNP
rs868765017 690 dbSNP
rs1483436233 691 dbSNP
rs562912213 694 dbSNP
rs182225742 702 dbSNP
rs1250259134 706 dbSNP
rs1484411203 707 dbSNP
rs926130156 716 dbSNP
rs1414066620 718 dbSNP
rs1422926889 722 dbSNP
rs977579768 725 dbSNP
rs966871512 733 dbSNP
rs1391432998 742 dbSNP
rs1283747637 748 dbSNP
rs1307275159 751 dbSNP
rs1415655248 761 dbSNP
rs1352750836 763 dbSNP
rs1357389152 765 dbSNP
rs757298847 783 dbSNP
rs1303252029 792 dbSNP
rs1419592789 793 dbSNP
rs1450660832 795 dbSNP
rs1346376459 801 dbSNP
rs913687913 805 dbSNP
rs1300137166 811 dbSNP
rs1161717186 812 dbSNP
rs986950998 816 dbSNP
rs1227786639 817 dbSNP
rs1271492864 818 dbSNP
rs1314536906 823 dbSNP
rs1211227689 829 dbSNP
rs955063795 837 dbSNP
rs4758660 839 dbSNP
rs996730484 842 dbSNP
rs1249515768 850 dbSNP
rs777755888 854 dbSNP
rs1017181587 857 dbSNP
rs1417259579 873 dbSNP
rs1004015174 876 dbSNP
rs1416153436 877 dbSNP
rs950835845 878 dbSNP
rs886933983 879 dbSNP
rs1426617527 881 dbSNP
rs1322745252 888 dbSNP
rs1366276599 888 dbSNP
rs920451684 888 dbSNP
rs973175151 888 dbSNP
rs1045839389 891 dbSNP
rs1369843954 893 dbSNP
rs757619621 896 dbSNP
rs964600684 900 dbSNP
rs1321774921 907 dbSNP
rs1217864774 908 dbSNP
rs1014741998 912 dbSNP
rs145997829 913 dbSNP
rs1234103338 914 dbSNP
rs1187362857 915 dbSNP
rs1239814118 923 dbSNP
rs1478743888 927 dbSNP
rs1337274291 928 dbSNP
rs1424391992 931 dbSNP
rs1276378050 936 dbSNP
rs1468029344 937 dbSNP
rs547594751 942 dbSNP
rs1021146359 943 dbSNP
rs767505909 945 dbSNP
rs936243462 949 dbSNP
rs755001584 950 dbSNP
rs1009338378 951 dbSNP
rs1437293379 954 dbSNP
rs751730120 956 dbSNP
rs893519680 957 dbSNP
rs946273177 961 dbSNP
rs1033190667 962 dbSNP
rs1000327871 966 dbSNP
rs1328933009 968 dbSNP
rs766480987 971 dbSNP
rs906155928 975 dbSNP
rs1281703335 977 dbSNP
rs1452777794 977 dbSNP
rs912027086 988 dbSNP
rs1268095841 993 dbSNP
rs1479439933 998 dbSNP
rs540444061 1001 dbSNP
rs1412381519 1003 dbSNP
rs1472143636 1008 dbSNP
rs763211350 1013 dbSNP
rs1393214921 1018 dbSNP
rs1406021723 1022 dbSNP
rs371902028 1028 dbSNP
rs895832780 1029 dbSNP
rs920947607 1030 dbSNP
rs1048162182 1034 dbSNP
rs1487491524 1035 dbSNP
rs929413313 1036 dbSNP
rs527363263 1037 dbSNP
rs973249325 1040 dbSNP
rs1290467051 1041 dbSNP
rs1256332806 1044 dbSNP
rs1207125402 1047 dbSNP
rs1226971876 1048 dbSNP
rs1308103179 1056 dbSNP
rs962609449 1057 dbSNP
rs572979860 1063 dbSNP
rs1297878807 1069 dbSNP
rs1252466569 1070 dbSNP
rs1217948127 1075 dbSNP
rs1370999812 1078 dbSNP
rs1179475181 1079 dbSNP
rs1370384541 1082 dbSNP
rs765545173 1082 dbSNP
rs762168805 1083 dbSNP
rs910497632 1084 dbSNP
rs1443496507 1089 dbSNP
rs1004519178 1096 dbSNP
rs1431711556 1099 dbSNP
rs1169721655 1102 dbSNP
rs1398568871 1107 dbSNP
rs1328816398 1110 dbSNP
rs1321277868 1112 dbSNP
rs987331597 1113 dbSNP
rs776943815 1115 dbSNP
rs1341874799 1118 dbSNP
rs1448243778 1120 dbSNP
rs1373127510 1121 dbSNP
rs1356564287 1130 dbSNP
rs1230046460 1131 dbSNP
rs954764597 1134 dbSNP
rs1193835125 1138 dbSNP
rs112937401 1146 dbSNP
rs1260094210 1148 dbSNP
rs1014367124 1149 dbSNP
rs561805076 1150 dbSNP
rs574888547 1151 dbSNP
rs1194199364 1153 dbSNP
rs988179352 1155 dbSNP
rs957816546 1157 dbSNP
rs1372980058 1159 dbSNP
rs894526017 1160 dbSNP
rs1469594773 1161 dbSNP
rs1403311692 1162 dbSNP
rs1414268834 1162 dbSNP
rs745363367 1166 dbSNP
rs1380204699 1170 dbSNP
rs1436602621 1172 dbSNP
rs1032093519 1175 dbSNP
rs1195422470 1191 dbSNP
rs1257692921 1199 dbSNP
rs115378036 1200 dbSNP
rs906020097 1204 dbSNP
rs1000234036 1209 dbSNP
rs904522577 1213 dbSNP
rs1023113788 1215 dbSNP
rs1208183053 1216 dbSNP
rs369820359 1222 dbSNP
rs946275500 1223 dbSNP
rs1261074233 1228 dbSNP
rs773948823 1229 dbSNP
rs1201567750 1230 dbSNP
rs1174772231 1231 dbSNP
rs12818552 1231 dbSNP
rs1458441526 1232 dbSNP
rs933743948 1233 dbSNP
rs899280911 1234 dbSNP
rs920977376 1236 dbSNP
rs1037736616 1237 dbSNP
rs148009304 1239 dbSNP
rs200051704 1239 dbSNP
rs539011209 1239 dbSNP
rs1390427612 1240 dbSNP
rs941069347 1242 dbSNP
rs1396848637 1248 dbSNP
rs1268627554 1249 dbSNP
rs1299370603 1251 dbSNP
rs1490343012 1260 dbSNP
rs1464054077 1262 dbSNP
rs534382893 1267 dbSNP
rs1473125972 1268 dbSNP
rs4237789 1274 dbSNP
rs777576072 1276 dbSNP
rs913771013 1278 dbSNP
rs1362923480 1279 dbSNP
rs1499681 1295 dbSNP
rs1455571004 1299 dbSNP
rs1024146047 1303 dbSNP
rs1378218224 1310 dbSNP
rs114982149 1311 dbSNP
rs958522930 1313 dbSNP
rs1301254854 1315 dbSNP
rs1352031786 1319 dbSNP
rs200753251 1321 dbSNP
rs565626388 1323 dbSNP
rs1034475467 1324 dbSNP
rs1247051266 1325 dbSNP
rs980532627 1325 dbSNP
rs1266057144 1326 dbSNP
rs969095388 1330 dbSNP
rs1485365128 1332 dbSNP
rs1281152941 1335 dbSNP
rs1220817714 1345 dbSNP
rs1000260379 1350 dbSNP
rs1254611003 1350 dbSNP
rs904550018 1355 dbSNP
rs1177059323 1356 dbSNP
rs748036894 1360 dbSNP
rs569227107 1362 dbSNP
rs551005228 1363 dbSNP
rs12302908 1364 dbSNP
rs371757933 1367 dbSNP
rs1161539725 1379 dbSNP
rs1372397843 1381 dbSNP
rs369539586 1382 dbSNP
rs890662603 1396 dbSNP
rs1308611849 1403 dbSNP
rs1051886377 1405 dbSNP
rs899142539 1406 dbSNP
rs143478391 1410 dbSNP
rs754984303 1411 dbSNP
rs900675873 1417 dbSNP
rs1315998079 1418 dbSNP
rs1007612673 1420 dbSNP
rs1039458340 1421 dbSNP
rs1051550401 1425 dbSNP
rs1343550384 1425 dbSNP
rs941079430 1429 dbSNP
rs77518455 1433 dbSNP
rs1484463032 1434 dbSNP
rs201976347 1434 dbSNP
rs560795201 1434 dbSNP
rs766939883 1435 dbSNP
rs1243394544 1438 dbSNP
rs1443471588 1441 dbSNP
rs1181255969 1442 dbSNP
rs1157944833 1444 dbSNP
rs766398199 1446 dbSNP
rs936376526 1447 dbSNP
rs1169692348 1449 dbSNP
rs190986922 1454 dbSNP
rs1337621351 1458 dbSNP
rs187405679 1462 dbSNP
rs992743774 1464 dbSNP
rs1362778938 1465 dbSNP
rs754140055 1469 dbSNP
rs758504463 1471 dbSNP
rs1271513115 1473 dbSNP
rs1204779356 1474 dbSNP
rs969127856 1474 dbSNP
rs1258273396 1475 dbSNP
rs1190231771 1479 dbSNP
rs1487585165 1481 dbSNP
rs958554106 1483 dbSNP
rs1034169649 1487 dbSNP
rs1249299521 1489 dbSNP
rs556503335 1491 dbSNP
rs1261571652 1497 dbSNP
rs761373828 1498 dbSNP
rs1417364439 1503 dbSNP
rs978851621 1504 dbSNP
rs993044576 1508 dbSNP
rs1176942245 1512 dbSNP
rs1405595786 1519 dbSNP
rs750576405 1520 dbSNP
rs774205997 1532 dbSNP
rs1345797829 1535 dbSNP
rs182291394 1539 dbSNP
rs1231042672 1542 dbSNP
rs1333787435 1548 dbSNP
rs1224479745 1550 dbSNP
rs1402998962 1553 dbSNP
rs745819551 1559 dbSNP
rs1321889504 1567 dbSNP
rs1221233602 1568 dbSNP
rs994173644 1571 dbSNP
rs554052052 1586 dbSNP
rs190120882 1587 dbSNP
rs1016226891 1590 dbSNP
rs1030579494 1597 dbSNP
rs553018635 1599 dbSNP
rs1428293745 1602 dbSNP
rs889240059 1603 dbSNP
rs1052276002 1607 dbSNP
rs997390001 1613 dbSNP
rs1409067312 1614 dbSNP
rs892277862 1616 dbSNP
rs1162572530 1621 dbSNP
rs1316369816 1626 dbSNP
rs540460652 1628 dbSNP
rs56245303 1628 dbSNP
rs560214845 1629 dbSNP
rs1230685977 1630 dbSNP
rs1388481282 1633 dbSNP
rs138632625 1638 dbSNP
rs574584603 1641 dbSNP
rs1037811470 1647 dbSNP
rs917701062 1658 dbSNP
rs1418918355 1663 dbSNP
rs1281464590 1669 dbSNP
rs992299092 1671 dbSNP
rs1005304826 1672 dbSNP
rs888161809 1685 dbSNP
rs1268116656 1689 dbSNP
rs1489795712 1694 dbSNP
rs1046805536 1700 dbSNP
rs1183812977 1701 dbSNP
rs1233641571 1705 dbSNP
rs1469771670 1707 dbSNP
rs1157075842 1713 dbSNP
rs929672376 1718 dbSNP
rs916902681 1723 dbSNP
rs1425395120 1724 dbSNP
rs536906378 1729 dbSNP
rs929717595 1731 dbSNP
rs1372607719 1733 dbSNP
rs1057097466 1745 dbSNP
rs1194456589 1746 dbSNP
rs937209759 1748 dbSNP
rs1265702828 1753 dbSNP
rs927127523 1759 dbSNP
rs147125882 1760 dbSNP
rs540326503 1761 dbSNP
rs972224934 1761 dbSNP
rs1440976519 1766 dbSNP
rs1016469366 1772 dbSNP
rs532521229 1782 dbSNP
rs1246153684 1788 dbSNP
rs953368658 1790 dbSNP
rs1473551277 1798 dbSNP
rs1234784938 1799 dbSNP
rs988908858 1804 dbSNP
rs1336829710 1807 dbSNP
rs777118436 1807 dbSNP
rs1269133559 1809 dbSNP
rs998029905 1810 dbSNP
rs1030260573 1811 dbSNP
rs996403607 1816 dbSNP
rs1328194367 1818 dbSNP
rs1169001329 1823 dbSNP
rs1323625989 1827 dbSNP
rs1396175743 1833 dbSNP
rs964892996 1837 dbSNP
rs554645840 1840 dbSNP
rs1006836309 1844 dbSNP
rs186153473 1845 dbSNP
rs1408453255 1847 dbSNP
rs1418866289 1854 dbSNP
rs1229472990 1855 dbSNP
rs1168632611 1856 dbSNP
rs543629564 1864 dbSNP
rs761289864 1868 dbSNP
rs181512585 1869 dbSNP
rs560706081 1874 dbSNP
rs746097307 1879 dbSNP
rs1241281538 1882 dbSNP
rs947731179 1889 dbSNP
rs895495215 1897 dbSNP
rs1373055600 1899 dbSNP
rs1255307043 1909 dbSNP
rs1474611748 1911 dbSNP
rs12301352 1913 dbSNP
rs1435765235 1916 dbSNP
rs1271680543 1919 dbSNP
rs1469940389 1920 dbSNP
rs1335713090 1923 dbSNP
rs937242440 1924 dbSNP
rs569173248 1926 dbSNP
rs1403209695 1930 dbSNP
rs927158635 1932 dbSNP
rs1056110375 1935 dbSNP
rs530686276 1936 dbSNP
rs1224951209 1937 dbSNP
rs1301079042 1941 dbSNP
rs770504060 1944 dbSNP
rs1324002613 1946 dbSNP
rs1233518456 1947 dbSNP
rs1261521510 1954 dbSNP
rs1486875882 1955 dbSNP
rs1205833924 1962 dbSNP
rs188691015 1964 dbSNP
rs1371399824 1965 dbSNP
rs1445826875 1968 dbSNP
rs1305415814 1971 dbSNP
rs1202237861 1976 dbSNP
rs58862482 1977 dbSNP
rs1354224320 1979 dbSNP
rs1480328613 1980 dbSNP
rs1175238539 1983 dbSNP
rs1329805734 1986 dbSNP
rs972674630 1987 dbSNP
rs184008349 1993 dbSNP
rs1373739773 2009 dbSNP
rs913046352 2015 dbSNP
rs56882949 2023 dbSNP
rs541074438 2024 dbSNP
rs909490140 2025 dbSNP
rs1397231716 2030 dbSNP
rs1345855731 2031 dbSNP
rs986331585 2032 dbSNP
rs1468273645 2036 dbSNP
rs954770378 2043 dbSNP
rs573790111 2044 dbSNP
rs1260154944 2045 dbSNP
rs1348676520 2046 dbSNP
rs141847102 2048 dbSNP
rs1225311648 2052 dbSNP
rs974682347 2060 dbSNP
rs1277604077 2061 dbSNP
rs964675817 2067 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aucGAGGAAAGGUG-UCUGUCCa 5'
             :||| ||  ||  |||||| 
Target 5' cacUUCCAUUAAACUUGACAGGa 3'
 		8 - 30
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 65117.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aucGAGGAAAGGUG-UCUGUCCa 5'
             :||| ||  ||  |||||| 
Target 5' cacUUCCAUUAAACUUGACAGGa 3'
 		8 - 30
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000331738.7 | 3UTR | UUAAACCCACUUCCAUUAAACUUGACAGGACUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000331738.7 | 3UTR | UUAAACCCACUUCCAUUAAACUUGACAGGACUAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000331738.7 | 3UTR | UUAAACCCACUUCCAUUAAACUUGACAGGACUAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
151 hsa-miR-4421 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT293805 FEM1A fem-1 homolog A 2 2
MIRT468824 RSRC2 arginine and serine rich coiled-coil 2 2 6
MIRT470326 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT474293 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 2 2
MIRT480821 BLCAP bladder cancer associated protein 2 10
MIRT496455 N6AMT1 N-6 adenine-specific DNA methyltransferase 1 2 2
MIRT500021 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT508622 PLA2G2C phospholipase A2 group IIC 2 2
MIRT514258 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514574 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 4
MIRT515040 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515686 TFPI tissue factor pathway inhibitor 2 2
MIRT517385 METTL7A methyltransferase like 7A 2 4
MIRT519320 TIMELESS timeless circadian clock 2 2
MIRT519728 ZNF460 zinc finger protein 460 2 2
MIRT520243 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520266 URGCP upregulator of cell proliferation 2 2
MIRT523695 FHL2 four and a half LIM domains 2 2 4
MIRT525357 HPR haptoglobin-related protein 2 2
MIRT530203 ALX1 ALX homeobox 1 2 2
MIRT530217 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT539888 IRGQ immunity related GTPase Q 2 2
MIRT540203 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540544 MYO1H myosin IH 2 2
MIRT540946 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541928 ORC1 origin recognition complex subunit 1 2 4
MIRT542086 IKZF3 IKAROS family zinc finger 3 2 2
MIRT542191 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542342 LIMD1 LIM domains containing 1 2 2
MIRT542499 WDR13 WD repeat domain 13 2 2
MIRT542571 ZNF280B zinc finger protein 280B 2 2
MIRT542706 RPS15A ribosomal protein S15a 2 2
MIRT542902 HSBP1 heat shock factor binding protein 1 2 2
MIRT557044 HOXB3 homeobox B3 2 2
MIRT559285 AURKA aurora kinase A 2 2
MIRT563692 RPS26 ribosomal protein S26 2 2
MIRT564324 CCNT1 cyclin T1 2 2
MIRT573774 PRKAG1 protein kinase AMP-activated non-catalytic subunit gamma 1 2 2
MIRT576319 Zfp703 zinc finger protein 703 1 1
MIRT576660 Fam216a family with sequence similarity 216, member A 2 2
MIRT609117 ZNF703 zinc finger protein 703 2 7
MIRT609183 DPY19L3 dpy-19 like C-mannosyltransferase 3 2 4
MIRT610539 FAM46A family with sequence similarity 46 member A 2 4
MIRT611598 JAKMIP3 Janus kinase and microtubule interacting protein 3 2 4
MIRT618036 CTU1 cytosolic thiouridylase subunit 1 2 2
MIRT622442 RNF217 ring finger protein 217 2 2
MIRT622562 PTPN3 protein tyrosine phosphatase, non-receptor type 3 2 2
MIRT623831 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT624397 CD3D CD3d molecule 2 2
MIRT627578 SLC24A4 solute carrier family 24 member 4 2 2
MIRT627862 PITPNM3 PITPNM family member 3 2 2
MIRT631108 SLC15A2 solute carrier family 15 member 2 2 2
MIRT631115 ATCAY ATCAY, caytaxin 2 2
MIRT631204 ZNF724P zinc finger protein 724 2 2
MIRT631454 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 2 2
MIRT632347 SWSAP1 SWIM-type zinc finger 7 associated protein 1 2 2
MIRT633901 FGF10 fibroblast growth factor 10 2 2
MIRT634398 PLSCR1 phospholipid scramblase 1 2 2
MIRT634924 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635867 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636633 CHAF1B chromatin assembly factor 1 subunit B 2 2
MIRT637153 PCDHA6 protocadherin alpha 6 2 2
MIRT640789 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 2
MIRT645416 FAM110A family with sequence similarity 110 member A 2 2
MIRT645530 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT647100 GNL3L G protein nucleolar 3 like 2 2
MIRT649262 IMPA2 inositol monophosphatase 2 2 2
MIRT650491 UFM1 ubiquitin fold modifier 1 2 2
MIRT650795 GSR glutathione-disulfide reductase 2 2
MIRT651039 ZNF652 zinc finger protein 652 2 2
MIRT654018 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT655523 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 2
MIRT657308 HOXA9 homeobox A9 2 2
MIRT657789 GK5 glycerol kinase 5 (putative) 2 4
MIRT659400 CORO2A coronin 2A 2 2
MIRT659992 C2CD2L C2CD2 like 2 2
MIRT661391 RHCG Rh family C glycoprotein 2 2
MIRT662013 ZNF445 zinc finger protein 445 2 2
MIRT664012 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT664052 KIAA1551 KIAA1551 2 2
MIRT667065 PAOX polyamine oxidase 2 2
MIRT669160 CCNG1 cyclin G1 2 2
MIRT669650 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
MIRT673233 KLHDC8A kelch domain containing 8A 2 2
MIRT680480 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683571 CARD8 caspase recruitment domain family member 8 2 2
MIRT683816 CBS cystathionine-beta-synthase 2 2
MIRT684555 ZNF708 zinc finger protein 708 2 2
MIRT685418 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT686046 SLC5A5 solute carrier family 5 member 5 2 2
MIRT686135 B4GALT7 beta-1,4-galactosyltransferase 7 2 2
MIRT686799 SOX12 SRY-box 12 2 2
MIRT687477 NHLRC2 NHL repeat containing 2 2 2
MIRT687951 HHIP hedgehog interacting protein 2 2
MIRT688178 FRRS1 ferric chelate reductase 1 2 2
MIRT688300 FAM208A family with sequence similarity 208 member A 2 2
MIRT688895 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689199 ZNF574 zinc finger protein 574 2 2
MIRT690854 PVR poliovirus receptor 2 2
MIRT691258 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT692923 EXOSC2 exosome component 2 2 2
MIRT693625 CENPL centromere protein L 2 2
MIRT694994 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT695368 PHAX phosphorylated adaptor for RNA export 2 2
MIRT696626 WDR77 WD repeat domain 77 2 2
MIRT696686 APOC3 apolipoprotein C3 2 2
MIRT697364 ZNF394 zinc finger protein 394 2 2
MIRT697609 XIAP X-linked inhibitor of apoptosis 2 2
MIRT697733 USP6NL USP6 N-terminal like 2 2
MIRT697785 UBXN7 UBX domain protein 7 2 2
MIRT698357 TMEM127 transmembrane protein 127 2 2
MIRT698484 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT699855 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT704344 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT704595 CLN8 CLN8, transmembrane ER and ERGIC protein 2 2
MIRT705845 AHCY adenosylhomocysteinase 2 2
MIRT706305 NT5C2 5'-nucleotidase, cytosolic II 2 2
MIRT707090 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT707138 TRA2B transformer 2 beta homolog 2 2
MIRT707150 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT707240 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT707352 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT707456 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707499 AXL AXL receptor tyrosine kinase 2 2
MIRT707643 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT707696 FAM118A family with sequence similarity 118 member A 2 2
MIRT707711 CDC6 cell division cycle 6 2 2
MIRT707822 TMEM170A transmembrane protein 170A 2 2
MIRT707963 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT708002 NUDT4 nudix hydrolase 4 2 2
MIRT708031 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT708065 LIX1L limb and CNS expressed 1 like 2 2
MIRT708197 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT708206 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT711531 TRIP11 thyroid hormone receptor interactor 11 2 2
MIRT712637 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 2
MIRT713697 CYB5R4 cytochrome b5 reductase 4 2 2
MIRT714244 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT714397 FBXO31 F-box protein 31 2 2
MIRT714626 KIAA1143 KIAA1143 2 2
MIRT714911 CHMP3 charged multivesicular body protein 3 2 2
MIRT715568 EPHB4 EPH receptor B4 2 2
MIRT715846 SZT2 SZT2, KICSTOR complex subunit 2 2
MIRT716321 SIGLEC10 sialic acid binding Ig like lectin 10 2 2
MIRT718142 PALM paralemmin 2 2
MIRT720737 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT722174 MRPS15 mitochondrial ribosomal protein S15 2 2
MIRT723223 FMNL3 formin like 3 2 2
MIRT723518 SIGLEC8 sialic acid binding Ig like lectin 8 2 2
MIRT724796 C1D C1D nuclear receptor corepressor 2 2
MIRT725280 OSTM1 osteopetrosis associated transmembrane protein 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4421 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4421 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4421 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4421 Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)

Error report submission