miRTarBase - #MIRT469224


—
pre-miRNA Information
pre-miRNA hsa-mir-379   
Genomic Coordinates chr14: 101022066 - 101022132
Synonyms MIRN379, hsa-mir-379, MIR379
Description Homo sapiens miR-379 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-379-5p
Sequence 6| UGGUAGACUAUGGAACGUAGG |26
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 14 + 101022075 16594986, 18684997, 21912681, 22499667, 24964909, 25692236, 26449202, 27229138, 28411194, 28550310, 29267965, 20591823, 27587585, 30022565, 29976955, 31682236, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1316049475 1 dbSNP
rs775428399 3 dbSNP
rs61991156 7 dbSNP
rs748621194 16 dbSNP
rs72631818 17 dbSNP
rs750490770 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RHOBTB3   
Synonyms -
Description Rho related BTB domain containing 3
Transcript NM_014899   
Expression
Putative miRNA Targets on RHOBTB3
3'UTR of RHOBTB3
(miRNA target sites are highlighted)		 
>RHOBTB3|NM_014899|3'UTR
   1 CCTGGAGCTTTTATACACTACATTTCTTTTTTATTATTATGAAGAATGGGATACCTCCAGGTTCCAGTAAAATTCTTCTG
  81 ACCGAAACCAATGTGGGTGTTAGAAAAATTACCATATAGCTTAATATGTTTATTAGTTCTCTTTGGAAAAAAACTACCAC
 161 TGTGGTCTTAAAAGGGAACAAAATATACCATAGGCTAAAACTAAGGCTTTCACTCTAGAATGCAAAGCTGTTTTGCAGCT
 241 GTTTTCCCTTAAAGATGTCCTGTTGCTTTAGTGATATTTAGACCCCTCTCAGTTAAGAAATGCTTAGATTAAAAAAAAAA
 321 AATTACGTAGGATTAATACAGAAATTTAATCATGTCTGATTAATTGCTCTATTAAAATAAGGGGCATTTAAAGACCCAGC
 401 ATAACCATTTGTATAATGAGAAATCTAGGGGAAAACCAATCAGTCCAACATGAGATTTTAGGAATAGAAATTTGCCGGCC
 481 ATTTGGAAAGTGAAATGCCACTTAGTTCTCAATTGATGACAGTGTTTGAATCATCATAAAAAAAATACCTGCTTTTCATC
 561 TGGACAACCCAATTGAGCCACTTTATCTCCTTTTGGCAATCTGAGTAGGCGGGGAACCTAGGCAGGGCTGGCTTTCTTAG
 641 CGTGTAACTTGTGTAGCAGCACAGGGCCCACACTTAGAAGGACCCCACACTTGGTTCAAGGCTCTGCTATAGCGGAAATT
 721 CTTAATAATGTTTGAAGAAGGGCCCCATGATTTCATTTTGTGCTGAGCCCTCAAAATTATGTCTGTTTCGTGGTGGGAAA
 801 TATCCTATGTTTTCTTGCTCAAACACCTTTCTCTCTGAAAGCAGAAAAAGGCACTGATATAAAGGGAAGAGAAGGAGGCT
 881 CACCGGAGGGAAGAGAACATAGTGAAGATTCCCGCCTTTGGGGAGGTCTGGACCACCCAGGGCCTCCACTGCCACCTTGG
 961 CTGGCAAGGGAGAAATGTGTTGTGTTGTCTTAGCTTTAAAACAGTCACAGTTCTTGCTCTATCATAGATGAACAAATACT
1041 TTCTTGATCATTCTGTAAGACCAGGAGGTTGGTAAGAGTGACTAACCAGCCTAACTTTAATACACATGTATAAAGATGTT
1121 CACAGAGAAAGATGCTCTGTAGAGAATTTGCTACCGAAGTTGGCTCAAGAATTTGTTTTTAGTGTTATTTACCAAGATTA
1201 GGACGTCAGTGGCTTAAATTCTTTGAATTCTTTTCAAGGACTGCAAGATTATTTGATAAAGAGTAGCATGAATCTTGTGC
1281 TCTAATATTACACAGTAAGTTCAAAGAAAGGATGTAAGTCAAAGACTTGTTACATAGAGGGAAAATGGACTGGGATAGAG
1361 GACAGACTGATAGTTTCTTTCTTTCATATCACATGTATAGAGAAATAATTATATCAGAAACTCACAAACCTAGACATGGA
1441 AAAACAGATTACTGTCTATTGTCAGCATCATTTTCATCTGTAAGTCACTACTGGAATATATTTTTCTTTTAATTTCCAGT
1521 GACTTTAGAATACACACAGTTTTTCCGACTTTTCAAAAATTTGATTAAATGGTTTTATAGTATAATATTGGGACCCCATA
1601 CCGTTAGCCCTTGTATGTATACCAACACTGCCAAAGTAAAACATTAGGTCAGGCATGGTGGCTCAGGCCTGTAATCCCAG
1681 CATTTTGGGAGGCTGAGGCAAGTGGATAACTTGAGGTCATGAGTTCGAAACCAGCCTGGCCAAAACAGTGAAACCCCGTC
1761 TCTACTAAAAATACAAAATTAGCCAGATGTGGTGGCGCACACCTGTAATCCCAGCTACTCAGGAAGCTGAGGCAGGAAAA
1841 TCGCTTGAACCTGGGAGGTGGAAGTTGCAGTGAGCCGAGATCGCACCACTGCACTCCAGCCTGGGTGACAAGAGCGAAAC
1921 TCCATCTCAAAAAAAAAAAAAAAACCAAAGTGAAACACTAAAAATTCCCTATAGATATATTCCAGGAAATATTTTAATTG
2001 GGCTGATTTTAATTAGGCTGTATCATTGATGATTACTGGAATCGATTTTATGTCTTTTGTATTTTAATCACTTGAGTTAA
2081 TCAACCACTGGCAAATCCCATTTGACAAAGATTAGCATTGTAAAAAACAGATACTGTGGTAGATTTCTAGAAATTCATTC
2161 ACATTTAAGACTTCTAAAATGGAATAATAGCCTTTTGTTTTTCATGAGCATATTCGCACCCCTATATGAATTACAGCATT
2241 TAAAGTTCAAAATCAGTAACTTTTAATCTAGGAAATTGAAAAATATTAAGTTGCAAAGCAAAAAAAGGTATTTTCTTGAA
2321 AATACTATTTAATGTTTAACTAGACTATAGGTAGTTCCTTAAGGTTGTTTGACCTGAAGTGGAGTTGGGTTTGGAAGCTG
2401 GTGCCCAGTTGGTGTGGAGTGTGTAGTTTTGTTATGAAAGTTCTCTACCACCTACCTGTGTGAGTGACACCAACATCCAG
2481 ATGTCACAGCTCTCCAGAGCTAGTCAGAAGAGAAATCAAATTAGTGTTTAAACCCATTTGCATATTGACTTGTCAGTACC
2561 TTTAACTCAATTTAATATAACAAGAAATCGTAAAATACTTATAACCTATCTTAGAGAAATGAGTGCTGGTTTTGAGAGTT
2641 GTTTTTTAACTGAAAGATTATTTCTAGATGGGTAGTGCTTTGTGCTGGTTTCTGCTTCCATATATTTCCCAGTCATTTTA
2721 ATTAGAGAAGATACTCTATGGTAGAACTAAGGCCTTTCCTTTCTTGGCCAAAGTCTTTACCCTATTTAACCCTTTGTATA
2801 TTTCTGACTGCTCACTGTTCATATTATAGGGGACCAGATTTGTAATATAGAATTCTCCATAACATGAATGAAATTAATTC
2881 TGTCCAAGCCAGCATGGTGGCTTCATATTAAGTAGTAACAGAAGTCTGAACAATTGGATAAATTTGACTTCCAAGACAGC
2961 TAAACTTTTCAACTGCAATTTTAAAAACTACACTACACTGTTATAGTTAATCTGACAAAAATGTCCTCAAAGAGTACTTT
3041 ATTTTATTTAAAGCATCTGTTTAATTCAACCTTTAATAATTTTGCAAAGAAGGGTATGTGTGTATTTTAATATAGCCTGA
3121 CCTGAATTTATATGTTTTTAGCTTTAGTATTTAACTTTTTGTAACAAATAAACCTTTTTTAAAACAAGTTTAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggAU-GCAA---GG--UAU-CAGAUGGu 5'
            || ||||   ||  :|| || |||| 
Target 5' caTACCGTTAGCCCTTGTATGTATACCa 3'
 1597 - 1624 121.00 -8.50
2 
miRNA  3' ggaugcaagguaucAGAUGGu 5'
                        |||||| 
Target 5' tgttatgaaagttcTCTACCa 3'
 2430 - 2450 120.00 -11.50
3 
miRNA  3' ggaugcaaGGUAUCAG--AUGGu 5'
                  ||| ||||  |||| 
Target 5' tttcttggCCAAAGTCTTTACCc 3'
 2760 - 2782 117.00 -11.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM1634383 7 COSMIC
COSN31513663 15 COSMIC
COSN31567009 22 COSMIC
COSN31568437 48 COSMIC
COSN31564312 85 COSMIC
COSN31605179 131 COSMIC
COSN26561762 177 COSMIC
COSN28765209 179 COSMIC
COSN19658154 323 COSMIC
COSN21567709 500 COSMIC
COSN28613015 744 COSMIC
COSN26731492 886 COSMIC
COSN30587483 901 COSMIC
COSN16147367 979 COSMIC
COSN17181648 1431 COSMIC
COSN19062583 1911 COSMIC
COSN20101530 1945 COSMIC
COSN21846639 2217 COSMIC
COSN14783959 2524 COSMIC
COSN24531906 2658 COSMIC
COSN25724368 2849 COSMIC
COSN31962433 2891 COSMIC
COSN26750718 3169 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs183222273 4 dbSNP
rs778700145 5 dbSNP
rs747123782 6 dbSNP
rs770844738 12 dbSNP
rs764753665 16 dbSNP
rs746140954 18 dbSNP
rs769976895 22 dbSNP
rs202048839 23 dbSNP
rs760302751 27 dbSNP
rs1221368052 28 dbSNP
rs113955811 31 dbSNP
rs1302600036 36 dbSNP
rs1179792898 37 dbSNP
rs1312213689 38 dbSNP
rs763216091 40 dbSNP
rs374326541 45 dbSNP
rs774656499 51 dbSNP
rs1342909728 57 dbSNP
rs1044033156 61 dbSNP
rs749966875 62 dbSNP
rs1405188860 65 dbSNP
rs1429605315 67 dbSNP
rs749789793 71 dbSNP
rs1005475801 81 dbSNP
rs554141957 82 dbSNP
rs186508280 84 dbSNP
rs542074449 85 dbSNP
rs1801904 97 dbSNP
rs757956504 98 dbSNP
rs1314081980 100 dbSNP
rs556049949 113 dbSNP
rs896510927 124 dbSNP
rs1320964988 127 dbSNP
rs1012708259 129 dbSNP
rs1045161814 139 dbSNP
rs14612 147 dbSNP
rs576090781 158 dbSNP
rs898650200 159 dbSNP
rs995726185 163 dbSNP
rs571248739 165 dbSNP
rs1208350229 166 dbSNP
rs951637963 172 dbSNP
rs6697 179 dbSNP
rs1167561967 185 dbSNP
rs754880480 186 dbSNP
rs1462392676 187 dbSNP
rs985369527 191 dbSNP
rs1411908433 196 dbSNP
rs1462956378 197 dbSNP
rs781057052 207 dbSNP
rs1157748291 208 dbSNP
rs957337000 213 dbSNP
rs1252225720 218 dbSNP
rs1177484492 224 dbSNP
rs1487961993 226 dbSNP
rs564985368 228 dbSNP
rs965742014 230 dbSNP
rs989030314 233 dbSNP
rs527324068 241 dbSNP
rs950107605 253 dbSNP
rs1267476899 255 dbSNP
rs921742862 259 dbSNP
rs1226613591 263 dbSNP
rs1045859792 268 dbSNP
rs1470838905 270 dbSNP
rs927241741 301 dbSNP
rs747833098 309 dbSNP
rs62364385 310 dbSNP
rs1328290367 311 dbSNP
rs879037198 311 dbSNP
rs76643686 312 dbSNP
rs771218932 317 dbSNP
rs1176732378 322 dbSNP
rs1319216716 323 dbSNP
rs1450981184 325 dbSNP
rs1407907160 327 dbSNP
rs968268670 328 dbSNP
rs1432193943 329 dbSNP
rs1335917199 332 dbSNP
rs560437336 332 dbSNP
rs1336115100 339 dbSNP
rs888013669 341 dbSNP
rs12515378 348 dbSNP
rs1371317850 350 dbSNP
rs1227812663 352 dbSNP
rs1468779513 370 dbSNP
rs1203374688 372 dbSNP
rs12351 374 dbSNP
rs1325977313 382 dbSNP
rs76881960 385 dbSNP
rs1278374184 386 dbSNP
rs997851183 389 dbSNP
rs1184634737 390 dbSNP
rs772133905 397 dbSNP
rs1295878325 401 dbSNP
rs1384350556 409 dbSNP
rs889428968 414 dbSNP
rs776035594 416 dbSNP
rs1045552327 418 dbSNP
rs898600564 431 dbSNP
rs138158782 440 dbSNP
rs1032700883 448 dbSNP
rs1430778855 477 dbSNP
rs957510943 478 dbSNP
rs1262406221 484 dbSNP
rs1181325193 492 dbSNP
rs368595180 506 dbSNP
rs988764100 508 dbSNP
rs1020097613 513 dbSNP
rs1341730332 515 dbSNP
rs1249935760 518 dbSNP
rs1396954491 519 dbSNP
rs551621580 521 dbSNP
rs1327509022 525 dbSNP
rs1326798291 533 dbSNP
rs1353915113 535 dbSNP
rs113237047 538 dbSNP
rs966098788 538 dbSNP
rs1353080843 547 dbSNP
rs1314187085 561 dbSNP
rs1405454209 566 dbSNP
rs971224064 568 dbSNP
rs967796854 571 dbSNP
rs979172022 573 dbSNP
rs923738860 574 dbSNP
rs956548326 575 dbSNP
rs992028327 577 dbSNP
rs1340523465 579 dbSNP
rs917879031 580 dbSNP
rs981502383 582 dbSNP
rs948029310 585 dbSNP
rs1045098867 597 dbSNP
rs776149271 608 dbSNP
rs919935016 611 dbSNP
rs182513265 612 dbSNP
rs1188786881 619 dbSNP
rs937471684 626 dbSNP
rs187977965 643 dbSNP
rs887238144 652 dbSNP
rs1197891373 656 dbSNP
rs944227781 673 dbSNP
rs1223861194 678 dbSNP
rs909254766 685 dbSNP
rs1231931560 691 dbSNP
rs764441077 693 dbSNP
rs1337586102 702 dbSNP
rs1489601376 710 dbSNP
rs1414924083 714 dbSNP
rs554179178 715 dbSNP
rs1326525713 720 dbSNP
rs1392906961 723 dbSNP
rs900112030 735 dbSNP
rs1396874576 737 dbSNP
rs567581429 745 dbSNP
rs191166149 748 dbSNP
rs1476179299 750 dbSNP
rs762032348 755 dbSNP
rs561115724 756 dbSNP
rs903522187 769 dbSNP
rs1425286943 773 dbSNP
rs1184318272 781 dbSNP
rs547152758 781 dbSNP
rs1267026754 784 dbSNP
rs1212238920 785 dbSNP
rs1465734806 786 dbSNP
rs572881926 787 dbSNP
rs1006678563 790 dbSNP
rs556421071 791 dbSNP
rs1277281853 806 dbSNP
rs1466013332 807 dbSNP
rs761416842 808 dbSNP
rs1247261921 810 dbSNP
rs1484775280 811 dbSNP
rs991974425 819 dbSNP
rs1268004537 821 dbSNP
rs762956700 825 dbSNP
rs1432634434 827 dbSNP
rs1174425840 829 dbSNP
rs767088080 838 dbSNP
rs1458025806 847 dbSNP
rs1428709254 851 dbSNP
rs1025295994 852 dbSNP
rs532866517 853 dbSNP
rs1386834933 858 dbSNP
rs1020232922 860 dbSNP
rs1439080431 861 dbSNP
rs1294592344 863 dbSNP
rs1382803676 867 dbSNP
rs1367567108 883 dbSNP
rs576199725 885 dbSNP
rs981114184 886 dbSNP
rs760444026 888 dbSNP
rs1228555147 896 dbSNP
rs1267120600 899 dbSNP
rs1192113762 905 dbSNP
rs971192994 912 dbSNP
rs545174511 915 dbSNP
rs1208589062 919 dbSNP
rs1341825461 932 dbSNP
rs1281475167 933 dbSNP
rs765978246 935 dbSNP
rs1206402056 948 dbSNP
rs1350915635 949 dbSNP
rs558399628 956 dbSNP
rs1294536944 961 dbSNP
rs541688648 962 dbSNP
rs1372984765 965 dbSNP
rs1303891281 966 dbSNP
rs1429853420 969 dbSNP
rs944175601 979 dbSNP
rs1320349055 980 dbSNP
rs1208776624 982 dbSNP
rs78379776 983 dbSNP
rs1448442592 985 dbSNP
rs578182601 994 dbSNP
rs940712504 1005 dbSNP
rs972258929 1017 dbSNP
rs1165413874 1019 dbSNP
rs748000145 1020 dbSNP
rs544137495 1022 dbSNP
rs1194657035 1035 dbSNP
rs1447141560 1039 dbSNP
rs1279143389 1040 dbSNP
rs1457313767 1041 dbSNP
rs1162808633 1050 dbSNP
rs903512289 1056 dbSNP
rs1213795295 1060 dbSNP
rs560511062 1070 dbSNP
rs1384147575 1072 dbSNP
rs1359748004 1073 dbSNP
rs1271932453 1083 dbSNP
rs1431558354 1093 dbSNP
rs183425513 1096 dbSNP
rs866061779 1133 dbSNP
rs1354838952 1137 dbSNP
rs1318708374 1138 dbSNP
rs1000524509 1140 dbSNP
rs1050548232 1143 dbSNP
rs910752607 1156 dbSNP
rs942412846 1157 dbSNP
rs1054216722 1160 dbSNP
rs1453775221 1167 dbSNP
rs892771559 1170 dbSNP
rs1169054994 1171 dbSNP
rs1009921236 1183 dbSNP
rs1472764952 1193 dbSNP
rs149637176 1205 dbSNP
rs1244696621 1206 dbSNP
rs755842620 1222 dbSNP
rs1257840924 1239 dbSNP
rs1002831496 1249 dbSNP
rs969629573 1252 dbSNP
rs1034589971 1256 dbSNP
rs980678872 1258 dbSNP
rs563185733 1264 dbSNP
rs779237089 1274 dbSNP
rs1416755752 1281 dbSNP
rs187227485 1283 dbSNP
rs962129138 1292 dbSNP
rs1267039007 1300 dbSNP
rs192098830 1307 dbSNP
rs113244386 1315 dbSNP
rs923311566 1320 dbSNP
rs954949145 1329 dbSNP
rs548700323 1335 dbSNP
rs986405611 1336 dbSNP
rs1416361963 1348 dbSNP
rs1423230637 1349 dbSNP
rs138569996 1352 dbSNP
rs1364463186 1356 dbSNP
rs1176214691 1357 dbSNP
rs977246610 1360 dbSNP
rs1455375828 1363 dbSNP
rs910674919 1368 dbSNP
rs1234355522 1372 dbSNP
rs921410315 1374 dbSNP
rs932848869 1376 dbSNP
rs936874762 1397 dbSNP
rs570070795 1398 dbSNP
rs1235208162 1401 dbSNP
rs1335614256 1409 dbSNP
rs1054587256 1414 dbSNP
rs1043310629 1423 dbSNP
rs549335749 1426 dbSNP
rs1375833982 1437 dbSNP
rs1395976779 1439 dbSNP
rs527751585 1456 dbSNP
rs1280449874 1462 dbSNP
rs936326097 1487 dbSNP
rs1392919324 1492 dbSNP
rs1328590137 1493 dbSNP
rs1462442695 1496 dbSNP
rs1052020368 1500 dbSNP
rs756393194 1509 dbSNP
rs1013297488 1515 dbSNP
rs1046579309 1525 dbSNP
rs1060488 1537 dbSNP
rs547822001 1547 dbSNP
rs1251044636 1548 dbSNP
rs1215423486 1549 dbSNP
rs1468862598 1550 dbSNP
rs1002471072 1554 dbSNP
rs567710333 1557 dbSNP
rs906901633 1580 dbSNP
rs1002751224 1581 dbSNP
rs1055733022 1583 dbSNP
rs536639356 1586 dbSNP
rs1015566559 1593 dbSNP
rs1205158618 1594 dbSNP
rs894270289 1595 dbSNP
rs184590081 1596 dbSNP
rs1482767222 1597 dbSNP
rs921390220 1600 dbSNP
rs569913522 1603 dbSNP
rs780364587 1604 dbSNP
rs1252517982 1610 dbSNP
rs1433728045 1611 dbSNP
rs993574974 1614 dbSNP
rs1030253716 1616 dbSNP
rs538480588 1624 dbSNP
rs1180158399 1626 dbSNP
rs954715150 1627 dbSNP
rs1480921421 1642 dbSNP
rs1210361779 1646 dbSNP
rs986767581 1646 dbSNP
rs1346035370 1658 dbSNP
rs1282853440 1659 dbSNP
rs1235539102 1667 dbSNP
rs910819727 1670 dbSNP
rs1294145219 1674 dbSNP
rs958562453 1678 dbSNP
rs926134634 1679 dbSNP
rs1363374901 1681 dbSNP
rs1298280023 1705 dbSNP
rs989646069 1707 dbSNP
rs558686556 1712 dbSNP
rs1373259864 1715 dbSNP
rs769225374 1727 dbSNP
rs868184774 1728 dbSNP
rs1299076210 1732 dbSNP
rs1053301621 1736 dbSNP
rs1168165863 1741 dbSNP
rs1430245196 1747 dbSNP
rs977177253 1754 dbSNP
rs1263952673 1755 dbSNP
rs928260861 1757 dbSNP
rs559624997 1758 dbSNP
rs755424281 1759 dbSNP
rs1287224445 1784 dbSNP
rs1480545236 1786 dbSNP
rs1230176018 1789 dbSNP
rs894373094 1789 dbSNP
rs75532002 1797 dbSNP
rs1037531565 1798 dbSNP
rs1232198972 1810 dbSNP
rs1353142838 1813 dbSNP
rs897668677 1816 dbSNP
rs1396376524 1826 dbSNP
rs993501501 1829 dbSNP
rs765519349 1832 dbSNP
rs1227948630 1835 dbSNP
rs1252823452 1839 dbSNP
rs1463420665 1842 dbSNP
rs1030394371 1843 dbSNP
rs187806869 1844 dbSNP
rs1251194576 1850 dbSNP
rs1474306702 1851 dbSNP
rs1490516271 1855 dbSNP
rs193284105 1867 dbSNP
rs1423380655 1877 dbSNP
rs1432785684 1878 dbSNP
rs762710948 1883 dbSNP
rs958312866 1884 dbSNP
rs112714866 1885 dbSNP
rs990174066 1904 dbSNP
rs965370823 1906 dbSNP
rs1285456858 1910 dbSNP
rs1307888945 1915 dbSNP
rs1365694044 1917 dbSNP
rs1304576442 1928 dbSNP
rs1392961102 1928 dbSNP
rs1406192763 1928 dbSNP
rs1253063599 1929 dbSNP
rs1362328577 1929 dbSNP
rs1362387010 1929 dbSNP
rs1469773780 1929 dbSNP
rs34389233 1929 dbSNP
rs397710500 1929 dbSNP
rs1291269156 1930 dbSNP
rs1366519407 1931 dbSNP
rs1184381298 1943 dbSNP
rs1021100078 1945 dbSNP
rs1214794800 1946 dbSNP
rs1297532497 1947 dbSNP
rs1192239220 1951 dbSNP
rs966885865 1952 dbSNP
rs1470246882 1960 dbSNP
rs184346419 1972 dbSNP
rs977139694 1985 dbSNP
rs1291348474 2003 dbSNP
rs1227585517 2005 dbSNP
rs1292363446 2014 dbSNP
rs928354140 2016 dbSNP
rs1361470279 2018 dbSNP
rs576649094 2026 dbSNP
rs11557538 2028 dbSNP
rs1028392661 2029 dbSNP
rs545288605 2044 dbSNP
rs1302416673 2070 dbSNP
rs1438572798 2075 dbSNP
rs1033101269 2076 dbSNP
rs1324258019 2079 dbSNP
rs991165916 2085 dbSNP
rs565439151 2086 dbSNP
rs1383064057 2092 dbSNP
rs879162314 2099 dbSNP
rs551205558 2107 dbSNP
rs1420549735 2112 dbSNP
rs956215463 2116 dbSNP
rs1192180679 2119 dbSNP
rs868257587 2121 dbSNP
rs1247848991 2122 dbSNP
rs189626302 2123 dbSNP
rs949068329 2128 dbSNP
rs1187271279 2132 dbSNP
rs139839676 2135 dbSNP
rs982157806 2158 dbSNP
rs1231870589 2164 dbSNP
rs1346997790 2166 dbSNP
rs1037582622 2172 dbSNP
rs751147916 2177 dbSNP
rs1168534746 2183 dbSNP
rs752664335 2191 dbSNP
rs897642386 2191 dbSNP
rs1048182146 2204 dbSNP
rs888275591 2205 dbSNP
rs1386462113 2211 dbSNP
rs1427077218 2216 dbSNP
rs758923000 2217 dbSNP
rs1426469015 2227 dbSNP
rs764071673 2227 dbSNP
rs1348781682 2233 dbSNP
rs561352187 2235 dbSNP
rs1474717070 2238 dbSNP
rs1051577089 2239 dbSNP
rs1036934314 2246 dbSNP
rs75608693 2249 dbSNP
rs1208452185 2253 dbSNP
rs550119412 2256 dbSNP
rs1279080556 2269 dbSNP
rs77390475 2273 dbSNP
rs1315431621 2290 dbSNP
rs1384984452 2298 dbSNP
rs1226518925 2300 dbSNP
rs1017597808 2309 dbSNP
rs368877830 2324 dbSNP
rs1280151284 2326 dbSNP
rs1321126607 2328 dbSNP
rs372491383 2332 dbSNP
rs755994749 2339 dbSNP
rs1355061870 2344 dbSNP
rs1216810991 2349 dbSNP
rs1311354701 2360 dbSNP
rs750530639 2364 dbSNP
rs1270194606 2365 dbSNP
rs1450482209 2381 dbSNP
rs889794965 2382 dbSNP
rs1328642901 2384 dbSNP
rs1463694926 2385 dbSNP
rs1426471906 2398 dbSNP
rs1188373629 2404 dbSNP
rs1172153144 2405 dbSNP
rs1011118184 2406 dbSNP
rs1416694062 2407 dbSNP
rs1185268097 2410 dbSNP
rs1021229363 2413 dbSNP
rs6815 2415 dbSNP
rs1474093082 2426 dbSNP
rs1259992584 2429 dbSNP
rs75616953 2435 dbSNP
rs1334181155 2437 dbSNP
rs1291520220 2438 dbSNP
rs1412453548 2441 dbSNP
rs1380193294 2453 dbSNP
rs181133310 2457 dbSNP
rs12089 2464 dbSNP
rs758648677 2465 dbSNP
rs1440512418 2474 dbSNP
rs1403075661 2476 dbSNP
rs1402813585 2478 dbSNP
rs534502512 2485 dbSNP
rs116573897 2493 dbSNP
rs991653733 2498 dbSNP
rs184902304 2499 dbSNP
rs1386044839 2505 dbSNP
rs1162125797 2516 dbSNP
rs7622 2524 dbSNP
rs963391181 2528 dbSNP
rs972034044 2534 dbSNP
rs1445736457 2536 dbSNP
rs1239795220 2541 dbSNP
rs1179107702 2576 dbSNP
rs1283484053 2581 dbSNP
rs1223926716 2582 dbSNP
rs1322520908 2590 dbSNP
rs376810016 2591 dbSNP
rs1222407026 2599 dbSNP
rs1379503004 2611 dbSNP
rs926249214 2614 dbSNP
rs919165352 2620 dbSNP
rs556883074 2623 dbSNP
rs576673699 2630 dbSNP
rs574319800 2646 dbSNP
rs929250749 2652 dbSNP
rs1051545548 2653 dbSNP
rs59723543 2655 dbSNP
rs1291261472 2657 dbSNP
rs1327427619 2658 dbSNP
rs943434922 2669 dbSNP
rs1350096610 2672 dbSNP
rs1157842097 2675 dbSNP
rs909657808 2681 dbSNP
rs535184517 2683 dbSNP
rs1039531675 2688 dbSNP
rs939820984 2694 dbSNP
rs893778599 2696 dbSNP
rs901021461 2701 dbSNP
rs933860985 2703 dbSNP
rs1192984879 2704 dbSNP
rs1208684976 2706 dbSNP
rs1237366505 2726 dbSNP
rs574725399 2727 dbSNP
rs565568591 2728 dbSNP
rs1042435076 2729 dbSNP
rs552620266 2729 dbSNP
rs1423051517 2730 dbSNP
rs544635752 2730 dbSNP
rs1183794615 2731 dbSNP
rs575448275 2731 dbSNP
rs200908250 2732 dbSNP
rs1049673376 2733 dbSNP
rs1287128325 2737 dbSNP
rs768583814 2739 dbSNP
rs1003829979 2752 dbSNP
rs1304127175 2753 dbSNP
rs1387874467 2754 dbSNP
rs1367618436 2758 dbSNP
rs1176619702 2767 dbSNP
rs1397700016 2771 dbSNP
rs1035150952 2774 dbSNP
rs1362122872 2783 dbSNP
rs1298545323 2790 dbSNP
rs959806393 2792 dbSNP
rs891852549 2793 dbSNP
rs781754788 2808 dbSNP
rs1333235232 2817 dbSNP
rs1433706039 2824 dbSNP
rs188963096 2826 dbSNP
rs1012643386 2832 dbSNP
rs1191622737 2835 dbSNP
rs1489379912 2836 dbSNP
rs1264256822 2853 dbSNP
rs748593959 2860 dbSNP
rs1002187876 2865 dbSNP
rs769613303 2869 dbSNP
rs3184188 2880 dbSNP
rs973026480 2892 dbSNP
rs1307452547 2895 dbSNP
rs561387347 2898 dbSNP
rs1348651459 2901 dbSNP
rs1298489541 2920 dbSNP
rs959011380 2923 dbSNP
rs918964186 2932 dbSNP
rs1399710406 2935 dbSNP
rs950629720 2937 dbSNP
rs909559658 2941 dbSNP
rs1353908214 2957 dbSNP
rs1228022688 2963 dbSNP
rs181651981 2967 dbSNP
rs1424445155 2968 dbSNP
rs1284119381 2976 dbSNP
rs911689424 2977 dbSNP
rs943216134 2979 dbSNP
rs143291303 2982 dbSNP
rs1201439130 3004 dbSNP
rs563651169 3013 dbSNP
rs1217888965 3019 dbSNP
rs915293384 3025 dbSNP
rs186229312 3027 dbSNP
rs1319312712 3038 dbSNP
rs11557537 3042 dbSNP
rs1278279701 3046 dbSNP
rs1243561309 3057 dbSNP
rs1338359481 3059 dbSNP
rs1050104516 3060 dbSNP
rs1396429313 3076 dbSNP
rs1438954711 3080 dbSNP
rs1042403507 3093 dbSNP
rs1248988862 3097 dbSNP
rs11952481 3098 dbSNP
rs1003756525 3114 dbSNP
rs565625348 3131 dbSNP
rs528300019 3134 dbSNP
rs1057135204 3136 dbSNP
rs891800434 3146 dbSNP
rs770731146 3149 dbSNP
rs895285814 3153 dbSNP
rs1418917325 3160 dbSNP
rs547955501 3161 dbSNP
rs1017128967 3162 dbSNP
rs1171855097 3180 dbSNP
rs370978447 3186 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggaugcaagguaucAGAUGGu 5'
                        |||||| 
Target 5' -------------cUCUACCa 3'
 		1 - 8
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000379982.3 | 3UTR | CUCUACCACCUACCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE27834 Pluripotent stem cells -0.759 3.3e-4 -0.706 1.1e-3 16 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.524 8.9e-3 0.183 2.2e-1 20 Click to see details
GSE19350 CNS germ cell tumors 0.494 5.1e-2 0.490 5.3e-2 12 Click to see details
GSE19783 ER+ ER+ breast cancer 0.361 5.9e-2 0.248 1.5e-1 20 Click to see details
GSE19783 ER- ER- breast cancer 0.169 6.8e-2 0.238 1.7e-2 79 Click to see details
GSE19536 Breast cancer 0.136 8.9e-2 0.252 5.7e-3 100 Click to see details
GSE38226 Liver fibrosis 0.231 1.6e-1 0.000 5.0e-1 21 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.199 1.7e-1 0.544 2.5e-3 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.19 1.8e-1 0.028 4.5e-1 25 Click to see details
GSE28544 Breast cancer -0.192 1.8e-1 -0.281 9.2e-2 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.189 1.9e-1 0.004 4.9e-1 24 Click to see details
GSE28260 Renal cortex and medulla 0.262 1.9e-1 0.159 3.0e-1 13 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.808 2.0e-1 -0.500 3.3e-1 3 Click to see details
GSE42095 Differentiated embryonic stem cells 0.097 3.3e-1 -0.071 3.7e-1 23 Click to see details
GSE21687 Ependynoma primary tumors 0.045 3.6e-1 0.182 7.5e-2 64 Click to see details
GSE21032 Prostate cancer -0.024 4.1e-1 -0.058 3.0e-1 83 Click to see details
GSE17306 Multiple myeloma 0.019 4.5e-1 -0.044 3.8e-1 49 Click to see details
GSE32688 Pancreatic cancer -0.016 4.7e-1 0.033 4.3e-1 32 Click to see details
GSE17498 Multiple myeloma 0.014 4.7e-1 0.018 4.6e-1 40 Click to see details
GSE14794 Lymphoblastoid cells 0.005 4.8e-1 0.028 4.0e-1 90 Click to see details
GSE14794 Lymphoblastoid cells 0.005 4.8e-1 0.028 4.0e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.351 0.01 0.487 0 42 Click to see details
COAD -0.718 0.02 -0.214 0.31 8 Click to see details
PAAD 0.888 0.06 0.400 0.3 4 Click to see details
KIRP 0.253 0.08 0.319 0.04 32 Click to see details
UCEC 0.254 0.15 0.311 0.1 19 Click to see details
LUSC -0.164 0.16 -0.165 0.16 38 Click to see details
STAD -0.156 0.2 -0.098 0.3 32 Click to see details
ESCA 0.271 0.21 0.236 0.24 11 Click to see details
KICH 0.168 0.21 0.059 0.39 25 Click to see details
KIRC -0.085 0.25 -0.087 0.24 68 Click to see details
PCPG -0.592 0.3 -0.500 0.33 3 Click to see details
PRAD -0.062 0.33 -0.029 0.42 50 Click to see details
LUAD -0.118 0.36 -0.098 0.38 12 Click to see details
CESC -0.401 0.37 -0.500 0.33 3 Click to see details
CHOL -0.096 0.4 -0.067 0.43 9 Click to see details
LIHC -0.034 0.41 -0.014 0.46 49 Click to see details
BRCA -0.022 0.42 -0.007 0.47 84 Click to see details
BLCA 0.024 0.46 0.119 0.32 18 Click to see details
THCA -0.01 0.47 0.011 0.47 59 Click to see details
THCA -0.01 0.47 0.011 0.47 59 Click to see details
THCA -0.01 0.47 0.011 0.47 59 Click to see details
70 hsa-miR-379-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT007025 IL11 interleukin 11 1 1
MIRT068534 NHLRC3 NHL repeat containing 3 2 6
MIRT094166 PCGF3 polycomb group ring finger 3 2 6
MIRT100098 ABT1 activator of basal transcription 1 2 8
MIRT120926 PDE12 phosphodiesterase 12 2 8
MIRT179051 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT202043 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT215726 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT254608 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT266219 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT297447 SLC20A1 solute carrier family 20 member 1 2 4
MIRT315444 SLC16A10 solute carrier family 16 member 10 2 2
MIRT442137 C3orf17 nucleolus and neural progenitor protein 2 2
MIRT453878 IFRD1 interferon related developmental regulator 1 2 12
MIRT456258 TDRKH tudor and KH domain containing 2 12
MIRT456412 MTRF1L mitochondrial translational release factor 1 like 2 2
MIRT459729 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT461474 METTL1 methyltransferase like 1 2 2
MIRT463791 YBX1 Y-box binding protein 1 2 6
MIRT464031 WASL Wiskott-Aldrich syndrome like 2 2
MIRT464206 VGLL4 vestigial like family member 4 2 2
MIRT466712 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT467957 SLC16A1 solute carrier family 16 member 1 2 4
MIRT469224 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT473958 LRRC58 leucine rich repeat containing 58 2 2
MIRT475309 IFNLR1 interferon lambda receptor 1 2 2
MIRT476945 FAM83G family with sequence similarity 83 member G 2 4
MIRT477747 EDN1 endothelin 1 2 2
MIRT478260 DDX19B DEAD-box helicase 19B 2 2
MIRT478680 CSRP2 cysteine and glycine rich protein 2 2 4
MIRT490255 HAAO 3-hydroxyanthranilate 3,4-dioxygenase 2 2
MIRT493289 LNPEP leucyl and cystinyl aminopeptidase 2 2
MIRT493564 HSPA5 heat shock protein family A (Hsp70) member 5 2 2
MIRT495960 TBC1D19 TBC1 domain family member 19 2 2
MIRT497106 BEST3 bestrophin 3 2 2
MIRT498348 CISD1 CDGSH iron sulfur domain 1 2 2
MIRT500783 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 8
MIRT501091 SLC5A6 solute carrier family 5 member 6 2 4
MIRT505309 TPD52 tumor protein D52 2 2
MIRT511107 NFIB nuclear factor I B 2 4
MIRT512737 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT514269 ZNF519 zinc finger protein 519 2 2
MIRT514602 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 2 4
MIRT515378 RPL7 ribosomal protein L7 2 2
MIRT518564 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT520459 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT529765 SF3B1 splicing factor 3b subunit 1 2 2
MIRT538005 DNAL1 dynein axonemal light chain 1 2 2
MIRT538250 CUL3 cullin 3 2 4
MIRT543777 RBM12B RNA binding motif protein 12B 2 4
MIRT546203 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT547201 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT548440 ELMOD2 ELMO domain containing 2 2 2
MIRT551634 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT553334 TSC22D2 TSC22 domain family member 2 2 2
MIRT556169 MCC mutated in colorectal cancers 2 2
MIRT557968 FAM222B family with sequence similarity 222 member B 2 2
MIRT560021 TM2D2 TM2 domain containing 2 2 2
MIRT560716 ZNF749 zinc finger protein 749 2 2
MIRT564114 ZYG11B zyg-11 family member B, cell cycle regulator 2 4
MIRT564374 MRPS18B mitochondrial ribosomal protein S18B 2 2
MIRT566935 LIN28B lin-28 homolog B 5 2
MIRT573340 TUBD1 tubulin delta 1 2 2
MIRT607186 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT698515 TGFBR1 transforming growth factor beta receptor 1 2 2
MIRT704039 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT714582 PRRC1 proline rich coiled-coil 1 2 2
MIRT732163 PTK2 protein tyrosine kinase 2 3 1
MIRT732827 LINC00665 long intergenic non-protein coding RNA 665 3 0
MIRT735832 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-379 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-379 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 up-regulated
miR-379 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-379 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-379 Rifampicin approved 5381226 TaqMan low-density array hepatocellular carcinoma HepG2 cells 21540293 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-379 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-379 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-379-5p (1Z)-2-anilino-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-oxoethanimidoyl cyanide 5466279 NSC683605 resistant
hsa-miR-379-5p (2e)-2-hydroxyimino-4-(3-methyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl)-4-oxo-n-(2,4,5-trichlorophenyl)butanamide 6399319 NSC635544 resistant
hsa-miR-379-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-379-5p (2R)-2-(1H-benzimidazol-2-yl)-2-(2-chloro-6-methylpyrimidin-4-yl)acetonitrile 390694 NSC688326 resistant
hsa-miR-379-5p (2r,6r)-9,11-dibromo-10-thia-3,5-diazatricyclo[6.3.0.02,6]undeca-1(11),8-diene-4,7-dione 400215 NSC711733 resistant
hsa-miR-379-5p (2S,6S,7S,12R)-16-bromo-9-tert-butyl-4-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 372657 NSC648154 sensitive
hsa-miR-379-5p (3-(trifluoromethyl)anilino)(2-(trifluoromethyl)phenyl)acetonitrile 375079 NSC654017 resistant
hsa-miR-379-5p (3e)-3-[(6-methylimidazo[2,1-b]thiazol-5-yl)methylene]-1,3-dihydro-2h-indol-2-one 10755270 NSC726902 resistant
hsa-miR-379-5p (3e)-4-chloro-3-[(6-chloro-2-methylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471424 NSC711079 sensitive
hsa-miR-379-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-5-hydroxy-3-(4-methoxyphenyl)-4h-pyrazol-1-yl]methanone 400818 NSC713324 resistant
hsa-miR-379-5p (4-chlorophenyl) 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxylate 24204990 NSC733906 sensitive
hsa-miR-379-5p (4-chlorophenyl) 3-methyl-5-nitroimidazole-4-sulfonate 236063 NSC38086 resistant
hsa-miR-379-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-379-5p (4e,12z,27z,43z)-hexatetraconta-4,12,27,43-tetraen-1,18,21,45-tetrayne-3,20-diol 5470605 NSC703544 resistant
hsa-miR-379-5p (5e)-5-[(3,4-dimethoxyphenyl)methylidene]-3-phenyl-2-propylimino-1,3-thiazolidin-4-one 5471348 NSC710598 sensitive
hsa-miR-379-5p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 resistant
hsa-miR-379-5p (E)-3-(3-chlorophenyl)-N-[2-[(1,1-dioxothian-4-yl)-methylamino]-2-oxoethyl]prop-2-enamide 51003603 NSC761184 resistant
hsa-miR-379-5p (e)-phenyl(2-pyridinyl)methanone (6-chloro-4-pyrimidinyl)hydrazone 9571636 NSC693248 resistant
hsa-miR-379-5p (NE)-N-[(6E)-2-[(hydroxyamino)-(4-phenylmethoxyphenyl)methyl]-6-[(4-phenylmethoxyphenyl)methylidene]cyclohexylidene]hydroxylamine 5928828 NSC632824 resistant
hsa-miR-379-5p [(1h-benzimidazole-2-yl)dithio]-9h-purine 54613148 NSC750485 resistant
hsa-miR-379-5p [(4S,5R,6S)-4-[(3,4-dimethoxyphenyl)methyl]-6-(2,2-diphenylcyclopentyl)oxy-4-ethyl-2-oxido-5,6-dihydrooxazin-2-ium-5-yl] benzoate 395287 NSC699767 resistant
hsa-miR-379-5p [(5R,6S)-4-cyclohexyl-6-(2,2-diphenylcyclopentyl)oxy-2-oxido-5,6-dihydro-4H-oxazin-2-ium-5-yl] acetate 395278 NSC699756 resistant
hsa-miR-379-5p [(6z)-1-thiacyclodec-6-en-3,8-diyn-5-yl] 9,10-dioxoanthracene-2-carboxylate 5468578 NSC671898 sensitive
hsa-miR-379-5p [(6Z,10Z)-6,10-dimethyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-4-yl] (Z)-4-hydroxy-2-(hydroxymethyl)but-2-enoate 6477984 NSC659936 resistant
hsa-miR-379-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 sensitive
hsa-miR-379-5p [(E)-1-chlorobutylideneamino] N-[4-(trifluoromethoxy)phenyl]carbamate 5466270 NSC682840 resistant
hsa-miR-379-5p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-379-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(4-bromophenyl)carbamate 9556248 NSC682825 resistant
hsa-miR-379-5p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 resistant
hsa-miR-379-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-379-5p [3,4,5-triacetyloxy-6-(3-cyano-6-phenyl-2-sulfanyl-4-thiophen-2-yl-4h-pyridin-1-yl)oxan-2-yl]methyl acetate 381303 NSC667740 sensitive
hsa-miR-379-5p [3,4,5-triacetyloxy-6-[(e)-2-(azidomethyl)-3-oxobut-1-enoxy]oxan-2-yl]methyl acetate 5471355 NSC710716 resistant
hsa-miR-379-5p [3,4,5-triacetyloxy-6-[6-(4-chlorophenyl)-3-cyano-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 386296 NSC678057 sensitive
hsa-miR-379-5p [4-[(4-bromophenyl)carbamothioyl]phenyl] n-(4-chlorophenyl)carbamate 5471250 NSC710003 resistant
hsa-miR-379-5p [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl [5-[5-fluoro-4-(octadecylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate 390213 NSC687370 sensitive
hsa-miR-379-5p [5-[[2-chloroethyl(nitroso)carbamoyl]amino]-3-hydroxy-2-(hydroxymethyl)-6-methoxyoxan-4-yl] tetradecanoate 370169 NSC642913 sensitive
hsa-miR-379-5p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-379-5p 1-(2-methoxyphenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5367237 NSC668297 resistant
hsa-miR-379-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-379-5p 1-[(4-bromophenyl)amino]cyclopentanecarbonitrile 238637 NSC43101 resistant
hsa-miR-379-5p 1-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]-3-(2-pyridin-2-ylethyl)thiourea 9571616 NSC689531 resistant
hsa-miR-379-5p 1-[1-(3,4-dimethoxyphenyl)-5-ethyl-7,8-dimethoxy-4-methyl-2,3-benzodiazepin-3-yl]ethanone 343249 NSC382585 resistant
hsa-miR-379-5p 1-[3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-5-(4-methylphenyl)-3,4-dihydropyrazol-2-yl]ethanone 155808269 NSC762557 sensitive
hsa-miR-379-5p 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-2,5-dihydrofuran-2-yl]-5-methylpyrimidine-2,4-dione 404846 NSC721390 sensitive
hsa-miR-379-5p 1-benzyl-2-methyl-1-(2-phenylethyl)-4,5-dihydroimidazol-1-ium 413544 NSC49460 sensitive
hsa-miR-379-5p 1-cyclopentyl-3-[(Z)-1-pyridin-2-ylethylideneamino]thiourea 5468465 NSC670783 resistant
hsa-miR-379-5p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 sensitive
hsa-miR-379-5p 17-acetyl-15-benzyl-9,14-dihydroxy-16-methyl-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 24203201 NSC727113 resistant
hsa-miR-379-5p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-379-5p 2'-(4-chlorobenzoyl)-1'-(4-chlorophenyl)-1'-hydroxyspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione 388188 NSC682756 sensitive
hsa-miR-379-5p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 resistant
hsa-miR-379-5p 2-(2-(dimethylamino)ethylamino)naphthazarin 376950 NSC658145 resistant
hsa-miR-379-5p 2-(3,5-di-tert-butyl-4-methoxybenzyl)cyclopent-4-ene-1,3-dione 403662 NSC718730 resistant
hsa-miR-379-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-379-5p 2-[(1-anilino-4h-thiochromeno[3,4-d]imidazol-2-yl)sulfanyl]-n-[4-(4-chlorophenyl)-1,3-thiazol-2-yl]acetamide 60148157 NSC753769 sensitive
hsa-miR-379-5p 2-[[4-[methyl-[(2,4,7-triaminopteridin-6-yl)methyl]amino]benzoyl]amino]pentanedioic acid 387951 NSC682306 resistant
hsa-miR-379-5p 2-[2-(aziridin-1-yl)ethoxy]quinoline 268715 NSC109084 resistant
hsa-miR-379-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-379-5p 2-[2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenoxy]acetic acid 5934333 NSC643813 sensitive
hsa-miR-379-5p 2-azaadenine 5480214 NSC57048 resistant
hsa-miR-379-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-379-5p 2-hydroxy discorhabdin d 362391 NSC626161 resistant
hsa-miR-379-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-379-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-379-5p 2-methylolivacinium acetate 5458752 NSC336003 sensitive
hsa-miR-379-5p 2-n-methyl-6-oxaellipticinium acetate 10018975 NSC638788 sensitive
hsa-miR-379-5p 2-n-methyl-6-thiaellipticinum iodide 367888 NSC638066 sensitive
hsa-miR-379-5p 2-phenyl-6-((1-phenyl-1h-tetraazol-5-yl)oxy)-4h-chromen-4-one 386037 NSC677603 sensitive
hsa-miR-379-5p 2,4-dinitro-1-benzofuran 332391 NSC329127 resistant
hsa-miR-379-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-379-5p 2,5,12-trimethyl-[1,4]benzodioxino[3,2-g]isoquinolin-2-ium acetate 388316 NSC683048 sensitive
hsa-miR-379-5p 2,9-dimethylellipticinium acetate 10472068 NSC639364 sensitive
hsa-miR-379-5p 3-(4-bromophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388536 NSC683517 sensitive
hsa-miR-379-5p 3-(4-chlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 396385 NSC702338 resistant
hsa-miR-379-5p 3-(hydroxymethyl)-5-(6-methylsulfanylpurin-9-yl)-1,4-dioxane-2,6-diol 269951 NSC111702 resistant
hsa-miR-379-5p 3-[(e)-1-(2-hydroxy-4-methoxy-phenyl)ethylideneamino]-1,1-dimethyl-thiourea 135493996 NSC689547 resistant
hsa-miR-379-5p 3-[(E)-3-(4-chlorophenyl)prop-2-enoyl]-2-hydroxycyclohepta-2,4,6-trien-1-one 5918418 NSC356777 resistant
hsa-miR-379-5p 3-[10-(3-cyanophenyl)-3,5,9,11-tetraoxo-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-en-4-yl]benzonitrile 365552 NSC633258 sensitive
hsa-miR-379-5p 3-bromo-4-(3,3-dimethyl-but-1-ynyl)-2(5h)-furanone 11413833 NSC726328 resistant
hsa-miR-379-5p 3-chloro-6-[(4-fluorophenoxy)methyl]-2-phenylquinoxaline 392817 NSC693773 sensitive
hsa-miR-379-5p 3-methoxy-1-[(2-methoxyphenyl)methyl]-5-nitroindazole 386342 NSC678125 sensitive
hsa-miR-379-5p 3-methyl-1-(4-nitrobenzoyl)-5-(2-phenylethyl)-2-[[4-tri(propan-2-yl)silyloxyphenyl]methyl]pyrrolidine-3-carbaldehyde 401723 NSC715453 sensitive
hsa-miR-379-5p 3-phenacyliden-5-brom-2-indolinon 5351299 NSC294961 resistant
hsa-miR-379-5p 3,3-bis(3-(trifluoromethyl)phenyl)naphtho[1,2-c]furan-1(3h)-one 362080 NSC625603 sensitive
hsa-miR-379-5p 3no2-2pyrid-so2-ph 371687 NSC646125 resistant
hsa-miR-379-5p 4-((3-chlorobenzyl)oxy)-n-hydroxybenzamide 392397 NSC692761 resistant
hsa-miR-379-5p 4-(4-methoxyphenyl)-16-methyl-9-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390919 NSC689140 sensitive
hsa-miR-379-5p 4-(4-methoxyphenyl)-16-phenylmethoxy-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390917 NSC689138 sensitive
hsa-miR-379-5p 4-(bromomethyl)-2,2,5,5-tetramethyl-1-imidazolidinol 3-oxide 378673 NSC661470 resistant
hsa-miR-379-5p 4-[(5s,8ar)-5-(4-fluoroanilino)-5,5a,6,8,8a,9-hexahydro-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-2,6-dimethoxyphenol 378224 NSC660027 sensitive
hsa-miR-379-5p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-379-5p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-379-5p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-379-5p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 sensitive
hsa-miR-379-5p 4-methoxy-1,5-benzothiazepine-1,1-dioxide 358940 NSC619102 resistant
hsa-miR-379-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-379-5p 4-pyridin-3-yl-2-(2,3,5-trichlorophenyl)-1,3-thiazole 24814783 NSC742842 resistant
hsa-miR-379-5p 4,10-bis(3-ethynylphenyl)-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-ene-3,5,9,11-tetrone 365547 NSC633253 sensitive
hsa-miR-379-5p 4,16-difluoro-8,11,20-trimethyl-8-aza-20-azoniapentacyclo[11.7.1.02,7.09,21.014,19]henicosa-1(20),2(7),3,5,9,11,13(21),14(19),15,17-decaene;methyl sulfate 9804187 NSC714187 sensitive
hsa-miR-379-5p 5-(3,5-dimethoxybenzyl)-2-hydroxy-5,11-dihydro-6h-benzo[b]carbazol-6-one 403878 NSC719411 resistant
hsa-miR-379-5p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 resistant
hsa-miR-379-5p 5-hydroxy-3,7-dimethoxy-3',4'-methylenedioxyflavone 5466137 NSC678102 sensitive
hsa-miR-379-5p 5-methoxy-17-nitroso-8,9,10,12-tetrazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(17),2(7),3,5,8,11(16),12,14-octaene 54613484 NSC749292 resistant
hsa-miR-379-5p 5-methyl-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 53329052 NSC748147 sensitive
hsa-miR-379-5p 5-methyl-2-thiophenecarbaldehyde (7-methoxy-4-methyl-2-quinolinyl)hydrazone 9556289 NSC683922 resistant
hsa-miR-379-5p 5,10-dihydroxy-1-(4-piperidin-1-ylbutyl)naphtho[2,3-f]indole-4,11-dione 406505 NSC724632 resistant
hsa-miR-379-5p 5,10-dihydroxy-3-[[4-(2-hydroxyethyl)piperazin-1-yl]methyl]-1H-naphtho[2,3-f]indole-4,11-dione;hydrochloride 135585401 NSC726442 resistant
hsa-miR-379-5p 5,11-dimethyl-2-[(pentanoyloxy)methyl]-6h-pyrido[4,3-b]carbazol-2-ium iodide 367409 NSC637130 sensitive
hsa-miR-379-5p 5,7-dichloro-3-[(2-nitrophenyl)diazenyl]-1H-indol-2-ol 3724036 NSC117187 sensitive
hsa-miR-379-5p 5.alpha.,25d-spirostan-3.beta.-ol glycoside NSC106557 sensitive
hsa-miR-379-5p 6-(2-(3-chlorophenyl)hydrazino)-2,4-pyrimidinediol 385879 NSC677279 resistant
hsa-miR-379-5p 6-(4-acetylanilino)-9-methoxyindeno[1,2-c]quinolin-11-one 24205210 NSC734628 sensitive
hsa-miR-379-5p 6-[2-(dimethylamino)ethyl]-13-(2-isothiocyanatoethyl)-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone 57327694 NSC757982 resistant
hsa-miR-379-5p 6-amino-1,3-dichloro-5,6-dihydrocyclopenta[c]thiophen-4-one 378800 NSC662120 resistant
hsa-miR-379-5p 6-amino-5-[(4-fluorophenyl)methyl]-7-(1-methylbenzimidazol-2-yl)pyrrolo[2,3-b]pyrazine-2,3-dicarbonitrile 1179229 NSC730035 resistant
hsa-miR-379-5p 6-aminotoyocamycin 300567 NSC175630 resistant
hsa-miR-379-5p 6-benzyl-3,8,9-trimethoxy-11-methyl-6,11-dihydro-5h-indeno[1,2-c]isoquinolin-5-one 373164 NSC649107 sensitive
hsa-miR-379-5p 6-bromosangivamycin 270853 NSC113943 resistant
hsa-miR-379-5p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-379-5p 6-ethoxy-2-(hydroxymethyl)-2h-pyran-3(6h)-one 398342 NSC708062 resistant
hsa-miR-379-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-379-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-379-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-379-5p 8-aminoadenosine 259812 NSC90394 resistant
hsa-miR-379-5p 8-azainosine 135443893 NSC130279 resistant
hsa-miR-379-5p 8-chloro-7-methyl-5,5-dioxo-n-phenyl-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400657 NSC713019 sensitive
hsa-miR-379-5p 8-chloro-7-methyl-n-(4-methylphenyl)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400656 NSC713018 sensitive
hsa-miR-379-5p 8-trichloromethyldihydroberberine 320713 NSC269192 sensitive
hsa-miR-379-5p 9-((2-chloroethyl)thio)acridine 395387 NSC699923 resistant
hsa-miR-379-5p 9-(benzylsulfinyl)-2,7-dimethoxyacridine 395397 NSC699933 resistant
hsa-miR-379-5p 9-chloro-12,13-dimethoxy-6-phenyl-2,10-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4(16),5,7,9,11(15),12-heptaen-3-one 5470922 NSC706236 resistant
hsa-miR-379-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium acetate 373614 NSC650263 sensitive
hsa-miR-379-5p 9-hydroxy-2-(.beta.-diethylaminoethyl)ellipticinium acetate 72034 NSC311152 sensitive
hsa-miR-379-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 sensitive
hsa-miR-379-5p Ak136303 388306 NSC682996 resistant
hsa-miR-379-5p Allopurinol 2094 NSC1390 approved resistant
hsa-miR-379-5p Antibiotic x-14766a 434840 NSC359239 sensitive
hsa-miR-379-5p Ao-267/15176074 393944 NSC696916 resistant
hsa-miR-379-5p Bafilomycin antibiotic NSC381867 resistant
hsa-miR-379-5p Berberine iodide 72350 NSC150446 sensitive
hsa-miR-379-5p Bis(2-nitrophenyl)sulfilimine 371591 NSC645984 resistant
hsa-miR-379-5p Carboplatin 38904 NSC241240 approved sensitive
hsa-miR-379-5p Cgp 57380 11644425 NSC741567 resistant
hsa-miR-379-5p Chloroplatinum(1+);2-(4-methylpiperidin-1-yl)ethanethiolate;dihydrate 431390 NSC292596 resistant
hsa-miR-379-5p Chrysarobin 221502 NSC6152 sensitive
hsa-miR-379-5p Crotonosid 223996 NSC12161 resistant
hsa-miR-379-5p Destruxin b NSC236580 resistant
hsa-miR-379-5p Dezaguanine 55710 NSC261726 resistant
hsa-miR-379-5p Diaporthein b 54612739 NSC751295 resistant
hsa-miR-379-5p Diethyl (Z)-2-(2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469884 NSC693983 resistant
hsa-miR-379-5p Diethyl 2-[[4-[[6-(trifluoromethyl)quinoxalin-2-yl]amino]benzoyl]amino]pentanedioate 384948 NSC675772 sensitive
hsa-miR-379-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-379-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-379-5p Elliptinium acetate 42722 NSC264137 sensitive
hsa-miR-379-5p Ethyl 16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaene-4-carboxylate 391836 NSC691424 sensitive
hsa-miR-379-5p Ethyl 2-[4-(16-methyl-8-oxo-5-phenyl-2,3,4,7,16-pentazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10,12,14-hexaen-7-yl)butanoylamino]acetate 24205302 NSC734977 sensitive
hsa-miR-379-5p Ethyl 3,5-dinitro-2-(7H-purin-6-ylsulfanyl)benzoate 4331266 NSC244714 resistant
hsa-miR-379-5p Ethyl 7-(3,4-dihydro-2h-1,5-benzodioxepin-7-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399951 NSC711103 sensitive
hsa-miR-379-5p Eupachlorin 5458217 NSC114567 resistant
hsa-miR-379-5p Euphorbia substance spr5 5459191 NSC640929 sensitive
hsa-miR-379-5p Granatomycin a 135476747 NSC355063 resistant
hsa-miR-379-5p Gw701427a 10276395 NSC756323 sensitive
hsa-miR-379-5p Haloprogin 3561 NSC100071 resistant
hsa-miR-379-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-379-5p Hsdb 8106 16129719 NSC676825 resistant
hsa-miR-379-5p Inosine, 6-thio-, 2',3',5'-tripentanoate 4208664 NSC77495 resistant
hsa-miR-379-5p Isobaccharin 5358646 NSC269760 sensitive
hsa-miR-379-5p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-379-5p J3.522.543i 6163542 NSC113053 resistant
hsa-miR-379-5p Justicidin b 122805 NSC254665 resistant
hsa-miR-379-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-379-5p Laurusin 135476719 NSC106486 resistant
hsa-miR-379-5p Litomycin 135460332 NSC77038 resistant
hsa-miR-379-5p Ls-94160 135408599 NSC52426 resistant
hsa-miR-379-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-379-5p Mefloquine hydrochloride 456309 NSC157387 resistant
hsa-miR-379-5p Methyl (3r)-3-[[(3r)-3-[[(3r)-3-[(2-methylpropan-2-yl)oxycarbonylamino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoate 403118 NSC717705 sensitive
hsa-miR-379-5p Methyl (Z)-4-[(5-bromothiophen-2-yl)methylideneamino]-4,4-dicyanobut-2-enoate 5470186 NSC698282 resistant
hsa-miR-379-5p Methyl (Z)-4,4-dicyano-4-[(3-methoxyphenyl)methylideneamino]but-2-enoate 5470182 NSC698278 resistant
hsa-miR-379-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-379-5p Methyl 6-[bis-(4-methylphenyl)sulfonylamino]-7-methoxy-12-oxo-3,13,23-triazahexacyclo[11.10.1.02,11.04,9.014,19.020,24]tetracosa-1(24),2(11),3,5,7,9,14,16,18,20,22-undecaene-22-carboxylate 45028276 NSC742036 sensitive
hsa-miR-379-5p Methyl ester prodigiosene 136040158 NSC753661 resistant
hsa-miR-379-5p Musennin 267361 NSC106554 sensitive
hsa-miR-379-5p N'-(cyano(4-hydroxyphenyl)methyl)-2-hydroxybenzohydrazide 375017 NSC653843 sensitive
hsa-miR-379-5p N'-chloro-4-[2-[2-[4-[(Z)-N'-chlorocarbamimidoyl]phenoxy]ethyl-(4-methylphenyl)sulfonylamino]ethoxy]benzenecarboximidamide 45028721 NSC743909 sensitive
hsa-miR-379-5p N-(1,3-benzothiazol-2-yl)-2-phenyl-7-(3,4,5-trimethoxyphenyl)pyrazolo[1,5-a]pyrimidine-5-carboxamide 71624130 NSC763635 sensitive
hsa-miR-379-5p N-(4-methylphenyl)-3-[3-(4-methylphenyl)imino-2-phenylinden-1-yl]sulfanyl-2-phenylinden-1-imine 389841 NSC686473 sensitive
hsa-miR-379-5p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-379-5p N-[(e)-[(4-methoxyphenyl)-pyridin-2-ylmethylidene]amino]pyridin-2-amine 9630043 NSC693622 resistant
hsa-miR-379-5p N-[(e)-1-isoquinolin-3-ylethylideneamino]-1-methylbenzimidazol-2-amine 9572093 NSC703108 resistant
hsa-miR-379-5p N-[(e)-1-pyridin-2-ylethylideneamino]-[1,3]thiazolo[5,4-b]pyridin-2-amine 9572047 NSC693635 resistant
hsa-miR-379-5p N-[(e)-1-pyridin-2-ylethylideneamino]-5-(trifluoromethyl)-1,3-benzothiazol-2-amine 9572095 NSC703110 resistant
hsa-miR-379-5p N-[(e)-1-pyrimidin-2-ylethylideneamino]-1,3-benzothiazol-2-amine 9572048 NSC693636 resistant
hsa-miR-379-5p N-[(z)-[phenyl(pyridin-2-yl)methylidene]amino]quinoxalin-2-amine 5869744 NSC693626 resistant
hsa-miR-379-5p N-[[4-[10-[4-[[acetyl(2-phenylethyl)amino]-cyanomethyl]phenoxy]decoxy]phenyl]-cyanomethyl]-n-(2-phenylethyl)acetamide 387721 NSC681750 sensitive
hsa-miR-379-5p N-[2-(dimethylamino)ethyl]-4-(furo[3,2-c]quinolin-4-ylamino)benzamide 24204686 NSC732490 resistant
hsa-miR-379-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 sensitive
hsa-miR-379-5p N-[3-[(z)-n-methoxy-c-methylcarbonimidoyl]phenyl]-11h-indolo[3,2-c]quinolin-6-amine 9572585 NSC721041 resistant
hsa-miR-379-5p N-[dimethoxyphosphoryl(furan-2-yl)methyl]-4-[[4-[[dimethoxyphosphoryl(furan-2-yl)methyl]amino]phenyl]methyl]aniline 399251 NSC709928 sensitive
hsa-miR-379-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-379-5p N,n-dimethyl-4-[(e)-2-(1-methyl-2,5-diphenylpyrazol-1-ium-3-yl)ethenyl]aniline;trifluoromethanesulfonate 5469868 NSC693576 sensitive
hsa-miR-379-5p Naphtho[1,2-b]quinolizinium, 9-methyl-, bromide 21144314 NSC77810 sensitive
hsa-miR-379-5p Naphtho[2,1-b]quinolizinium, 7-methyl- chloride 5351151 NSC28002 sensitive
hsa-miR-379-5p Nigericin 34230 NSC292567 sensitive
hsa-miR-379-5p NSC372474 NSC372474 resistant
hsa-miR-379-5p NSC631451 NSC631451 resistant
hsa-miR-379-5p NSC751830 NSC751830 resistant
hsa-miR-379-5p NSC755523 NSC755523 resistant
hsa-miR-379-5p Pan (van) 6825 NSC5332 resistant
hsa-miR-379-5p Paucin 282787 NSC136722 resistant
hsa-miR-379-5p Pectenotoxin ii 5468320 NSC668555 sensitive
hsa-miR-379-5p Phenoxathiin-2-ylmethyl carbamimidothioate;hydrochloride 392088 NSC691900 resistant
hsa-miR-379-5p Phosphinic acid, bis(1-aziridinyl)-, 2-naphthyl ester NSC55720 sensitive
hsa-miR-379-5p Phosphonium, triphenylpropenyl-, bromide, (e)- (8ci) 10714966 NSC289922 sensitive
hsa-miR-379-5p Pinnatin b 5470399 NSC700892 resistant
hsa-miR-379-5p Platinum(2+);2,5,11-trimethyl-6H-pyrido[4,3-b]carbazol-2-ium-9-ol;tetrachloride 6477738 NSC620256 sensitive
hsa-miR-379-5p Propan-2-ylsulfanyl-(2,3,5,6-tetrachloropyridin-4-yl)sulfanylmethanethione 399833 NSC710969 resistant
hsa-miR-379-5p Protein: pahiv4 NSC678525 sensitive
hsa-miR-379-5p Pyrazoloadenine 75420 NSC1393 resistant
hsa-miR-379-5p S-[2-(2,6-dichlorophenyl)-3-oxoinden-1-yl] N,N-dimethylcarbamothioate 333069 NSC332837 resistant
hsa-miR-379-5p Salicyl n-salicylidenehydrazide 135445765 NSC87864 resistant
hsa-miR-379-5p Sarcoviolin 24202820 NSC726045 sensitive
hsa-miR-379-5p Silver methylsulfonate 6712944 NSC83223 resistant
hsa-miR-379-5p Stereoisomer of nsc 674067-p 384359 NSC674066 resistant
hsa-miR-379-5p Stk134301 135400303 NSC715186 resistant
hsa-miR-379-5p Stl298328 387753 NSC681782 resistant
hsa-miR-379-5p Stl323102 375895 NSC656208 resistant
hsa-miR-379-5p Stl361983 256661 NSC83715 resistant
hsa-miR-379-5p Stl434863 394348 NSC697730 resistant
hsa-miR-379-5p Suavedol 65631 NSC141545 resistant
hsa-miR-379-5p Tetramethyl (1r,5r,6s,9s)-3,5-dihydroxy-7-[4-[(e)-3-phenylprop-2-enoyl]oxyphenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681586 NSC717065 resistant
hsa-miR-379-5p Tetramethyl (1r,5r,6s,9s)-7-[4-[(e)-2,3-bis(4-chlorophenyl)prop-2-enoyl]oxyphenyl]-3,5-dihydroxybicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681588 NSC717067 resistant
hsa-miR-379-5p Thiosangivamycin 3006170 NSC105827 resistant
hsa-miR-379-5p Timtec1_002753 404248 NSC720426 sensitive
hsa-miR-379-5p Tridecyl 5-[(Z)-[3-methoxy-5-(1H-pyrrol-2-yl)pyrrol-2-ylidene]methyl]-2,4-dimethyl-1H-pyrrole-3-carboxylate 136226144 NSC763730 resistant
hsa-miR-379-5p Trimethyl-[[2-oxo-3-[(trimethylazaniumyl)methyl]cyclohexyl]methyl]azanium;iodide 360569 NSC622700 resistant
hsa-miR-379-5p Varacin trifluoroacetate salt 54611558 NSC722218 resistant
hsa-miR-379-5p Vorinostat 5311 NSC701852 approved resistant
hsa-miR-379-5p Xestin a 5352066 NSC647638 resistant
hsa-miR-379-5p Xk-469 148183 NSC656889 sensitive
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved resistant High Small Cell Lung Cancer cell line (NCI-H69)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-379-5p Vorinostat 5311 NSC701852 approved sensitive Low Malignant Pleural Mesothelioma cell line (MESO1)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-379-5p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Fluorouracil 3385 NSC19893 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, HepG2)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-379-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-379-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-379-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-379-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-379-5p Bromocriptine 31101 NSC169774 approved resistant High Prolactinoma tissue
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-379-5p Ruxolitinib 25126798 NSC763371 approved resistant Low Myelofibrosis tissue
hsa-miR-379-5p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562, KU812)
hsa-miR-379-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-379-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-379-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-379-5p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-379-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (HCT116)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-379-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-379-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-379-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-379-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-379-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (K562)
hsa-miR-379-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR200)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-379-5p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR20)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-379-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-379-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)
hsa-miR-379-5p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission