pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-516b-1 |
Genomic Coordinates | chr19: 53736845 - 53736934 |
Synonyms | MIRN516-4, MIRN516B-1, MIRN516B1, MIR516B1 |
Description | Homo sapiens miR-516b-1 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases | |
pre-miRNA | hsa-mir-516b-2 |
Genomic Coordinates | chr19: 53725442 - 53725526 |
Synonyms | MIRN516-3, MIRN516B-2, MIRN516B2, MIR516B2 |
Description | Homo sapiens miR-516b-2 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-516b-3p | ||||||||||||||||||||||||||||||||||||||||||
Sequence | 56| UGCUUCCUUUCAGAGGGU |73 | ||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||
Experiments | Array-cloned | ||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | RGP1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | KIAA0258 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | RGP1 homolog, RAB6A GEF complex partner 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_001080496 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on RGP1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of RGP1 (miRNA target sites are highlighted) |
>RGP1|NM_001080496|3'UTR 1 AACTGGCCCACCCTGGTGCTAGTTCCTTCCGGATACTGAGAACTCAGCACCTGGACTCTAATGGGACCCACTTTTTCCAC 81 CTGGGGTCCAATGTCGTGGACAGTGAGAGTCGGGCTTTCAGCTATAGCATTAATTTATTTGTTCAGAATACATTGGCAGC 161 TGCTAGTGGTTTCCCTGGAAGTGGCAGCAGCAGTGAGCAGTCAGCAGATGGATGATCAGTTGAGTTTAGCTGGAGTGGGG 241 AGCAGGAGCCCCAGGAACAGGGGTGTTGGCTGAGCCCCATTCTGGGTCAGGCCCTCCCCCTTTGCAGGGCAGCCGAGGGT 321 CAGATTTTTGCACCAAGGAGAACTGGCAGGTTCCTGCCTCCTGACGTACCTCACACCCAGCCGGGAAGTCGAT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | TZM-bl |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HCT116 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11
PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000378078.4 | 3UTR | AUUCCACCUUCCCCCUUUCUCCCCCACUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
85 hsa-miR-516b-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT077049 | SMARCE1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 | 2 | 2 | ||||||||
MIRT155261 | IFNAR2 | interferon alpha and beta receptor subunit 2 | 2 | 4 | ||||||||
MIRT446119 | ASTN1 | astrotactin 1 | 2 | 2 | ||||||||
MIRT447355 | STOM | stomatin | 2 | 2 | ||||||||
MIRT469329 | RGP1 | RGP1 homolog, RAB6A GEF complex partner 1 | 2 | 2 | ||||||||
MIRT470201 | PSAT1 | phosphoserine aminotransferase 1 | 2 | 6 | ||||||||
MIRT475944 | GXYLT1 | glucoside xylosyltransferase 1 | 2 | 4 | ||||||||
MIRT498268 | KIAA1644 | KIAA1644 | 2 | 2 | ||||||||
MIRT501725 | OVOL1 | ovo like transcriptional repressor 1 | 2 | 2 | ||||||||
MIRT522860 | KIAA1551 | KIAA1551 | 2 | 2 | ||||||||
MIRT527900 | B3GALT5 | beta-1,3-galactosyltransferase 5 | 2 | 4 | ||||||||
MIRT528557 | DNAAF3 | dynein axonemal assembly factor 3 | 2 | 2 | ||||||||
MIRT531250 | peptide deformylase, mitochondrial | 2 | 2 | |||||||||
MIRT534410 | SENP1 | SUMO1/sentrin specific peptidase 1 | 2 | 2 | ||||||||
MIRT544656 | MED19 | mediator complex subunit 19 | 2 | 2 | ||||||||
MIRT550681 | YARS | tyrosyl-tRNA synthetase | 2 | 2 | ||||||||
MIRT557208 | HNRNPF | heterogeneous nuclear ribonucleoprotein F | 2 | 4 | ||||||||
MIRT611532 | DDB1 | damage specific DNA binding protein 1 | 2 | 2 | ||||||||
MIRT612087 | TIMM10 | translocase of inner mitochondrial membrane 10 | 2 | 2 | ||||||||
MIRT616535 | PARD6B | par-6 family cell polarity regulator beta | 2 | 4 | ||||||||
MIRT616738 | DCTN5 | dynactin subunit 5 | 2 | 2 | ||||||||
MIRT616754 | SVOP | SV2 related protein | 2 | 4 | ||||||||
MIRT617380 | FAM227A | family with sequence similarity 227 member A | 2 | 2 | ||||||||
MIRT617624 | RAB3IP | RAB3A interacting protein | 2 | 2 | ||||||||
MIRT620778 | MT1A | metallothionein 1A | 2 | 2 | ||||||||
MIRT623172 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | 2 | 2 | ||||||||
MIRT626034 | AREL1 | apoptosis resistant E3 ubiquitin protein ligase 1 | 2 | 2 | ||||||||
MIRT627376 | PRICKLE4 | prickle planar cell polarity protein 4 | 2 | 2 | ||||||||
MIRT630533 | AGO3 | argonaute 3, RISC catalytic component | 2 | 2 | ||||||||
MIRT631686 | NQO2 | N-ribosyldihydronicotinamide:quinone reductase 2 | 2 | 2 | ||||||||
MIRT633896 | FGF10 | fibroblast growth factor 10 | 2 | 2 | ||||||||
MIRT635933 | PLA2G12A | phospholipase A2 group XIIA | 2 | 2 | ||||||||
MIRT636275 | RFFL | ring finger and FYVE like domain containing E3 ubiquitin protein ligase | 2 | 2 | ||||||||
MIRT636285 | RAD51L3-RFFL | RAD51L3-RFFL readthrough | 2 | 2 | ||||||||
MIRT636502 | GDAP1L1 | ganglioside induced differentiation associated protein 1 like 1 | 2 | 2 | ||||||||
MIRT638037 | SHPK | sedoheptulokinase | 2 | 2 | ||||||||
MIRT639162 | LAMTOR3 | late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 | 2 | 2 | ||||||||
MIRT639571 | GORASP1 | golgi reassembly stacking protein 1 | 2 | 2 | ||||||||
MIRT641248 | CENPN | centromere protein N | 2 | 2 | ||||||||
MIRT643650 | MYOCD | myocardin | 2 | 2 | ||||||||
MIRT645490 | TRIM63 | tripartite motif containing 63 | 2 | 2 | ||||||||
MIRT648016 | SLCO4C1 | solute carrier organic anion transporter family member 4C1 | 2 | 2 | ||||||||
MIRT648102 | LRRFIP1 | LRR binding FLII interacting protein 1 | 2 | 2 | ||||||||
MIRT648729 | HIST1H2BD | histone cluster 1 H2B family member d | 2 | 2 | ||||||||
MIRT650177 | LILRA2 | leukocyte immunoglobulin like receptor A2 | 2 | 2 | ||||||||
MIRT652787 | TCEANC2 | transcription elongation factor A N-terminal and central domain containing 2 | 2 | 2 | ||||||||
MIRT653248 | SORD | sorbitol dehydrogenase | 2 | 2 | ||||||||
MIRT654859 | PPM1F | protein phosphatase, Mg2+/Mn2+ dependent 1F | 2 | 2 | ||||||||
MIRT655533 | PAG1 | phosphoprotein membrane anchor with glycosphingolipid microdomains 1 | 2 | 2 | ||||||||
MIRT656390 | MCU | mitochondrial calcium uniporter | 2 | 2 | ||||||||
MIRT656881 | KIF1C | kinesin family member 1C | 2 | 2 | ||||||||
MIRT657083 | JMY | junction mediating and regulatory protein, p53 cofactor | 2 | 2 | ||||||||
MIRT657629 | GPX8 | glutathione peroxidase 8 (putative) | 2 | 2 | ||||||||
MIRT658295 | FAM83F | family with sequence similarity 83 member F | 2 | 2 | ||||||||
MIRT659432 | COL1A1 | collagen type I alpha 1 chain | 2 | 2 | ||||||||
MIRT659791 | CBLB | Cbl proto-oncogene B | 2 | 2 | ||||||||
MIRT660153 | BRCC3 | BRCA1/BRCA2-containing complex subunit 3 | 2 | 2 | ||||||||
MIRT660490 | ARRDC3 | arrestin domain containing 3 | 2 | 2 | ||||||||
MIRT660503 | ARPC2 | actin related protein 2/3 complex subunit 2 | 2 | 2 | ||||||||
MIRT666356 | SIKE1 | suppressor of IKBKE 1 | 2 | 2 | ||||||||
MIRT677774 | FKTN | fukutin | 2 | 2 | ||||||||
MIRT688556 | DCAF16 | DDB1 and CUL4 associated factor 16 | 2 | 2 | ||||||||
MIRT697415 | ZFP91 | ZFP91 zinc finger protein | 2 | 2 | ||||||||
MIRT709468 | KRTAP19-1 | keratin associated protein 19-1 | 2 | 2 | ||||||||
MIRT711154 | WDR82P1 | WD repeat domain 82 pseudogene 1 | 2 | 2 | ||||||||
MIRT711467 | SRD5A1 | steroid 5 alpha-reductase 1 | 2 | 2 | ||||||||
MIRT712515 | ENPP5 | ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) | 2 | 2 | ||||||||
MIRT712661 | PCTP | phosphatidylcholine transfer protein | 2 | 2 | ||||||||
MIRT713304 | TYRP1 | tyrosinase related protein 1 | 2 | 2 | ||||||||
MIRT714597 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | 2 | 2 | ||||||||
MIRT716603 | MPPED1 | metallophosphoesterase domain containing 1 | 2 | 2 | ||||||||
MIRT717537 | PYGO2 | pygopus family PHD finger 2 | 2 | 2 | ||||||||
MIRT718058 | CYP3A5 | cytochrome P450 family 3 subfamily A member 5 | 2 | 2 | ||||||||
MIRT718539 | PIGQ | phosphatidylinositol glycan anchor biosynthesis class Q | 2 | 2 | ||||||||
MIRT719768 | ZNF236 | zinc finger protein 236 | 2 | 2 | ||||||||
MIRT720162 | PNPO | pyridoxamine 5'-phosphate oxidase | 2 | 2 | ||||||||
MIRT720360 | ZBTB8B | zinc finger and BTB domain containing 8B | 2 | 2 | ||||||||
MIRT721182 | HOPX | HOP homeobox | 2 | 2 | ||||||||
MIRT721278 | RAD54L2 | RAD54 like 2 | 2 | 2 | ||||||||
MIRT721357 | ENTHD1 | ENTH domain containing 1 | 2 | 2 | ||||||||
MIRT721504 | CARHSP1 | calcium regulated heat stable protein 1 | 2 | 2 | ||||||||
MIRT721918 | LINGO2 | leucine rich repeat and Ig domain containing 2 | 2 | 2 | ||||||||
MIRT722278 | LURAP1 | leucine rich adaptor protein 1 | 2 | 2 | ||||||||
MIRT722789 | FUT4 | fucosyltransferase 4 | 2 | 2 | ||||||||
MIRT724390 | ABAT | 4-aminobutyrate aminotransferase | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|