| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-6833 |
| Genomic Coordinates | chr6: 32179816 - 32179876 |
| Description | Homo sapiens miR-6833 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-6833-5p | ||||||||||||
| Sequence | 6| GUGUGGAAGAUGGGAGGAGAAA |27 | ||||||||||||
| Evidence | Experimental | ||||||||||||
| Experiments | Meta-analysis | ||||||||||||
| SNPs in miRNA |
|
||||||||||||
| Putative Targets | |||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | REST | ||||||||||||||||||||
| Synonyms | NRSF, WT6, XBR | ||||||||||||||||||||
| Description | RE1 silencing transcription factor | ||||||||||||||||||||
| Transcript | NM_005612 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on REST | |||||||||||||||||||||
| 3'UTR of REST (miRNA target sites are highlighted) |
>REST|NM_005612|3'UTR 1 TGAAACTTTGAACAAGGTTTCAGTTCTTAGTTTGTAAGGTATATTACATTTTATATTCATTTATGATAGCAGACAACCTT 81 TTAAGATTGCTTTAATTAGTATCTGATGTTGATTTTTAAGTGGCATTCTTTTCCTTAGGACTTTTTATGTATACCTGTTG 161 ATTGTTGTGTAAATTTTAGTAAATCTAAGAGAGTGTACTAAACCAGCAGGTATCTGTTAGCTTATGTGTTTAATTGAAAT 241 TAGAAGGCTAAGATGGTATAACAGCATTTTATTGCTTTGTCCAGCTACAACTTGTCATTTTTTTCTCCATGTCTTATCTT 321 CCTGTTTCACTTTAGTTTATTCTTCGTTTTTTATTGAGATCTATAAAAAATTGGCTTACTTAATAGCAAATTACTTGAAG 401 AATTTGCCTGCTTTATATAAAGTTAGCACTTTAAGATTTTTTTTTTTAGAGATGAGAAGACATTTAAATTGAAGAAAAAT 481 TCCCCCAGCAATAGACAGTCTATCAGTCCAAGTATTTACTTCCTGAGTTTTGATCAATATTTTTTATTTGTGTATGTTAA 561 TCGTCATAAAAACAGTGATTTTGGTGTGTTTTTTATTTTGGTGCTTTAATGGCTTAAGATGTTGCACATTTTTTTTTTCT 641 TTTGGTTTCTGTTTATGTTTTTTTGCCTATGCAGTTAAATTTTTCCTAGAAATAGCATTTGTGTTGAACAGTAACACTTT 721 ATACATATATATATGCATGTTTATTTTGTTTGGCGTCTTTGGAGGGATGCTTTTAGACTTGTTTGCAAAAGGGCAGTTTT 801 CTTTTTCTTTGCTGCAGTTGTCTATTTTGCAGAATAATAGTGTGTGCAAGTTTGTGAGCAAATGAAATATGCAGGTTCAA 881 TCTATTGATTTTGATTTTTACATCTTATATCTATGCCAGAATCTGTATTTCATATAACTTATTTATTTCGAATGGATGTA 961 GTAAATTCACAGCTATCAGTTTTGATTTTGCAATAAATAAACCACTAGGTTGCATGTCGAACAAATTTTTATCTCAAATA 1041 CCAACCATCAGTTTTTTTTTTCATGTGTTTTGGTACAGCTAATTCCTAATTGTAGAGTGTTAAATGTTTGAGGAGAACCT 1121 TTTCTCATAGATGGTTGGTGTTCATATGGCTACTTTACAATAAAGAGAACTGTAAGTGATATTTGGAAACTACAAACCTG 1201 GAATTAGGAGATATAATTATTCCTTCAAGTTTTATAGAATATCACTTGGGAGATTCCAAAGCCATAGCTATTACGCGGCA 1281 AACCTAGGATAAGAAAGGTAGTATGAGTGCTGGTAGACCAGCTGCAACTTTCCTATACAGTGAAAAAGGCTGGTGAAACA 1361 AGTACAGTCCAGATTTTTTAAAATCATACTTTCTCAGGGATCTCCACAAACTGGTGGGTGTCCTGGCTGTCTGTGTGATA 1441 GCCTCTTTCTATAGGTGAGGCCTCAAATGAATTGCAGCTATCCTGGTGTTCCTATGAGGGCACTTTGTATGAAAAAGGGC 1521 ATGTACTCCAAAACATTTTTGTAGGTTCTTTGGCCAGTTGCCAAAGAGTGTGAAAGAATCCAATAGAGGATTTTTCTTAC 1601 TGATAGCAGTCATTCATTGCAGTAAAATAAAATATGATCCCATTAGGGAATCTTGAATTCTGACCTCCCATACTCCGTTT 1681 TGAAATAACCACTTTATATTTCATTTTTTAAAAATCTGATGATCTCTTTGAGGCAGGTTTCAGATTTGGCAGTACAACAT 1761 GAAAGATTAGGAAAAGCATTAATAACGTGTGGGTGGAAAGCTTGTTAAAAATCTGAGAGTGAAGTTTGAGTTAAAAGTTG 1841 TTTGAACATGGCATTGACTGGGAGGCCAAAGATTTAAAGAAGCGGAAGATTCTTCTCTTAAGACATGAGGAGTAAGTTGT 1921 GTGATAATGGTATGTGTTTTGTGTGCATGAATGGACATTGTAAATGTTGAATTCTAGGCTCCGACAATCATTGTCAACAG 2001 AAGATCAAGCTGCAAATATTTATGTTTTAAAACTTAAATTATAAAGCTAGTTAAGTCTTTCTAATGACTAGTTTTAATGT 2081 TCATGGGTACATTTTACCTAAGTTACCGTTTACATTGTATAGAAAAAGATACATCTTAAGCACAGATTGGTTATTAGGAA 2161 TTAGTTTGGGGAAGAGGTTTTTTTGTGGATTCTTTCATACTGCAAAGAAAAACCATTTGCCTTTTGGGGAATTGAGCTAA 2241 CTTCTAATCTAGTCTTAAGACTAGAATGCTAAAAACAAAAACATGAAGGAAATTAAAACCCCTTATTATTAAATTGATTT 2321 GTAAAAACATTGTTACTGGAAATTTATTGGACTTGAGGCCTTCCTCCAGAAAATAAGGACTTGATTGTCAGGCCTATATT 2401 AGGTTCTGAACCTTAATGCCATGTATTTGTACTTACTAAAAATTGTTTCAATGAAAAGTACATTAGCAGTATGAACTTCT 2481 GGTCCAGTTGGAAGTTTTTCCATTTGAAAAATGTGATGTTTGCATGGAACTGTTTGAAACTTTTTTATTTTCTAGTCCCC 2561 CTCCCCCACACTGGATAGAATTTAGCCTAGAATTTTCCCTTTGGATAAAAGAACAAAAATTGAACATGTTATTTGTAAAT 2641 TGATGTTTAGTAATTAGTGATAAACTTGAAATACTAGCATATATTATAAGCCTTAATCTTAGGTAGTCTTATGAAAATGA 2721 ATCTCTTAACTATCTTTTGAACCTGTATTCACATTGGTTTTCAAGATATTTTAAGTTATATTTTTTCCTCTTTTCAGAGC 2801 TGCTTCTTATTCTGGGGCTACTTTTTTTTTTAGTTGTGTAATTCACAAAGGGCTGCATTTTTTTTTTTTTTTAATAAGGC 2881 TTATAACTATGGCTGGATCTTTTGCTCTAGTCTTCTAAGAAGGGCCATTTTATTTTTTAGAGTCACTTCTAAAGTCATGT 2961 GGTAATTAACTTTGGAGACTGTTTTGCGTATGAGTGCTGATACAAATTAAAACCCAAGTAGACCTCATTGCATGTCACCC 3041 TATGAATGTTGACAATGGAAGGAATACCTTGCCTGTAGTATACTGTCACTTCTGGATTGATAAGCTGAGGAAGAAAGTTA 3121 AGTTTCTTTTTTACATAAGTCAGAAAAACTTACAGCTGGTGTTCCTAGTTTCCTGGTTGACCTCAGCAGATGAAGTGAAC 3201 AGATAGTGTTAATTCAGATTGAAGAAATTATCTGAATCTTGGTTTGTGTAGATTTACAATCTACATGCAATATTAACTAA 3281 ATCAGATAGCTTTTACAGTTTCACATGTGTACATAGGTTCCCTCCCGGTCCCTTCCATATCCATTAGTTATTGAACTTTC 3361 TAAACTGGCATTGAAACATTACAACAATGTTTTGTTGCACCAATTTTATAAACTTAAGCAGTGCAATACGTGTTACTTTT 3441 CTGAGGCAAACCAAAGGTAAATTTCTCAAGGTTCTTGCTGCCTTCTTTAGCAGCATTTGATGGAAGATCTTTTATACATT 3521 TGTAATAGATAAAAATAAACCAGATTGCAAATCCTTTTTTAAAATCCTAAACCATGTACCAAGTTTTTGGTCCAAATTAT 3601 GTAGGATAAGTTAAACTTAAATTGCATTCTATTAACCAATATGAGTGTATTTCTGTAAGCATAGTTATGTTGAAATAAAG 3681 TTTTAAAAACCA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Disease | 5978.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | TZM-bl | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6
PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6
PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000309042.7 | 3UTR | AUUUUUUAAAAUCAUACUUUCUCAGGGAUCUCCACAAACUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000309042.7 | 3UTR | AUUUUUUAAAAUCAUACUUUCUCAGGGAUCUCCACAAACUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000309042.7 | 3UTR | AUUUUUUAAAAUCAUACUUUCUCAGGGAUCUCCACAAACUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
85 hsa-miR-6833-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT055111 | SCD | stearoyl-CoA desaturase |  |
|
2 | 2 | ||||||
| MIRT056784 | ARID5B | AT-rich interaction domain 5B | |
|
2 | 2 | ||||||
| MIRT063833 | SRP9 | signal recognition particle 9 | |
|
2 | 6 | ||||||
| MIRT068906 | TPRG1L | tumor protein p63 regulated 1 like | |
|
2 | 2 | ||||||
| MIRT087861 | CBY1 | chibby family member 1, beta catenin antagonist | |
|
2 | 4 | ||||||
| MIRT102313 | DNAJB9 | DnaJ heat shock protein family (Hsp40) member B9 | |
|
2 | 10 | ||||||
| MIRT189645 | AKAP11 | A-kinase anchoring protein 11 | |
|
2 | 2 | ||||||
| MIRT191247 | STYX | serine/threonine/tyrosine interacting protein | |
|
2 | 2 | ||||||
| MIRT195912 | SRSF11 | serine and arginine rich splicing factor 11 | |
|
2 | 4 | ||||||
| MIRT215291 | CREBRF | CREB3 regulatory factor | |
|
2 | 2 | ||||||
| MIRT219058 | TAF8 | TATA-box binding protein associated factor 8 | |
|
2 | 4 | ||||||
| MIRT240350 | UBXN2B | UBX domain protein 2B | |
|
2 | 2 | ||||||
| MIRT244626 | PLAG1 | PLAG1 zinc finger | |
|
2 | 2 | ||||||
| MIRT271181 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | |
|
2 | 2 | ||||||
| MIRT277519 | PPP2R5C | protein phosphatase 2 regulatory subunit B'gamma | |
|
2 | 4 | ||||||
| MIRT284544 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | |
|
2 | 2 | ||||||
| MIRT286223 | TMEM97 | transmembrane protein 97 | |
|
2 | 4 | ||||||
| MIRT314185 | OCLN | occludin | |
|
2 | 4 | ||||||
| MIRT336247 | SKI | SKI proto-oncogene | |
|
2 | 4 | ||||||
| MIRT357689 | PAIP2 | poly(A) binding protein interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT447422 | MED21 | mediator complex subunit 21 | |
|
2 | 2 | ||||||
| MIRT451274 | ZNF101 | zinc finger protein 101 | |
|
2 | 2 | ||||||
| MIRT453571 | CRCP | CGRP receptor component | |
|
2 | 2 | ||||||
| MIRT454361 | ASAH2 | N-acylsphingosine amidohydrolase 2 | |
|
2 | 2 | ||||||
| MIRT460906 | POLQ | DNA polymerase theta | |
|
2 | 2 | ||||||
| MIRT469362 | REST | RE1 silencing transcription factor | |
|
2 | 6 | ||||||
| MIRT470269 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | |
|
2 | 2 | ||||||
| MIRT471927 | NRAS | NRAS proto-oncogene, GTPase | |
|
2 | 2 | ||||||
| MIRT474227 | LCLAT1 | lysocardiolipin acyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT480241 | C8orf58 | chromosome 8 open reading frame 58 | |
|
2 | 2 | ||||||
| MIRT480543 | BZW1 | basic leucine zipper and W2 domains 1 | |
|
2 | 2 | ||||||
| MIRT480924 | BCAT1 | branched chain amino acid transaminase 1 | |
|
2 | 4 | ||||||
| MIRT497343 | RPP25L | ribonuclease P/MRP subunit p25 like | |
|
2 | 2 | ||||||
| MIRT498824 | DNTTIP2 | deoxynucleotidyltransferase terminal interacting protein 2 | |
|
2 | 8 | ||||||
| MIRT498928 | TMEM106B | transmembrane protein 106B | |
|
2 | 8 | ||||||
| MIRT499584 | INTU | inturned planar cell polarity protein | |
|
2 | 4 | ||||||
| MIRT500118 | ZNF106 | zinc finger protein 106 | |
|
2 | 4 | ||||||
| MIRT500474 | ZC3H11A | zinc finger CCCH-type containing 11A | |
|
2 | 2 | ||||||
| MIRT501717 | OVOL1 | ovo like transcriptional repressor 1 | |
|
2 | 2 | ||||||
| MIRT501908 | MBD4 | methyl-CpG binding domain 4, DNA glycosylase | |
|
2 | 4 | ||||||
| MIRT502197 | HSPB8 | heat shock protein family B (small) member 8 | |
|
2 | 2 | ||||||
| MIRT505229 | UBE2D3 | ubiquitin conjugating enzyme E2 D3 | |
|
2 | 2 | ||||||
| MIRT505945 | RAN | RAN, member RAS oncogene family | |
|
2 | 6 | ||||||
| MIRT507971 | BCL2L13 | BCL2 like 13 | |
|
2 | 4 | ||||||
| MIRT512251 | ARPP19 | cAMP regulated phosphoprotein 19 | |
|
2 | 6 | ||||||
| MIRT513024 | GPT2 | glutamic--pyruvic transaminase 2 | |
|
2 | 2 | ||||||
| MIRT530791 | SNRPD1 | small nuclear ribonucleoprotein D1 polypeptide | |
|
2 | 2 | ||||||
| MIRT533403 | TXLNG | taxilin gamma | |
|
2 | 2 | ||||||
| MIRT546728 | RNF217 | ring finger protein 217 | |
|
2 | 2 | ||||||
| MIRT554087 | SNRPB2 | small nuclear ribonucleoprotein polypeptide B2 | |
|
2 | 2 | ||||||
| MIRT559924 | SOD2 | superoxide dismutase 2 | |
|
2 | 2 | ||||||
| MIRT560258 | TMEM236 | transmembrane protein 236 | |
|
2 | 2 | ||||||
| MIRT560412 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | |
|
2 | 2 | ||||||
| MIRT560420 | ANGPTL3 | angiopoietin like 3 | |
|
2 | 2 | ||||||
| MIRT560495 | KCNJ10 | potassium voltage-gated channel subfamily J member 10 | |
|
2 | 2 | ||||||
| MIRT560549 | SIGLEC14 | sialic acid binding Ig like lectin 14 | |
|
2 | 2 | ||||||
| MIRT560802 | PPIP5K2 | diphosphoinositol pentakisphosphate kinase 2 | |
|
2 | 2 | ||||||
| MIRT560883 | SULT1B1 | sulfotransferase family 1B member 1 | |
|
2 | 2 | ||||||
| MIRT560997 | C8orf37 | chromosome 8 open reading frame 37 | |
|
2 | 2 | ||||||
| MIRT561090 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | |
|
2 | 2 | ||||||
| MIRT561193 | LDHD | lactate dehydrogenase D | |
|
2 | 2 | ||||||
| MIRT561835 | NREP | neuronal regeneration related protein | |
|
2 | 2 | ||||||
| MIRT562393 | EIF4E | eukaryotic translation initiation factor 4E | |
|
2 | 2 | ||||||
| MIRT568153 | CCDC6 | coiled-coil domain containing 6 | |
|
2 | 2 | ||||||
| MIRT572725 | NUP188 | nucleoporin 188 | |
|
2 | 2 | ||||||
| MIRT572886 | ADCY2 | adenylate cyclase 2 | |
|
2 | 2 | ||||||
| MIRT575747 | Tnfrsf10b | tumor necrosis factor receptor superfamily, member 10b | |
|
2 | 2 | ||||||
| MIRT606770 | KIAA0040 | KIAA0040 | |
|
2 | 5 | ||||||
| MIRT620360 | CD55 | CD55 molecule (Cromer blood group) | |
|
2 | 2 | ||||||
| MIRT623579 | IREB2 | iron responsive element binding protein 2 | |
|
2 | 2 | ||||||
| MIRT640726 | PHF13 | PHD finger protein 13 | |
|
2 | 2 | ||||||
| MIRT651579 | WDR26 | WD repeat domain 26 | |
|
2 | 2 | ||||||
| MIRT674927 | C1orf116 | chromosome 1 open reading frame 116 | |
|
2 | 2 | ||||||
| MIRT687378 | NT5DC3 | 5'-nucleotidase domain containing 3 | |
|
2 | 2 | ||||||
| MIRT687699 | KRR1 | KRR1, small subunit processome component homolog | |
|
2 | 2 | ||||||
| MIRT693331 | E2F2 | E2F transcription factor 2 | |
|
2 | 2 | ||||||
| MIRT695289 | TK1 | thymidine kinase 1 | |
|
2 | 2 | ||||||
| MIRT697691 | WAC | WW domain containing adaptor with coiled-coil | |
|
2 | 2 | ||||||
| MIRT699810 | SDHD | succinate dehydrogenase complex subunit D | |
|
2 | 2 | ||||||
| MIRT702280 | LEPROT | leptin receptor overlapping transcript | |
|
2 | 2 | ||||||
| MIRT708498 | FAM9C | family with sequence similarity 9 member C | |
|
2 | 2 | ||||||
| MIRT710101 | HEY2 | hes related family bHLH transcription factor with YRPW motif 2 | |
|
2 | 2 | ||||||
| MIRT717883 | GBP4 | guanylate binding protein 4 | |
|
2 | 2 | ||||||
| MIRT719248 | MS4A1 | membrane spanning 4-domains A1 | |
|
2 | 2 | ||||||
| MIRT719958 | SAMD15 | sterile alpha motif domain containing 15 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|