pre-miRNA Information
pre-miRNA hsa-mir-575   
Genomic Coordinates chr4: 82753337 - 82753430
Synonyms MIRN575, hsa-mir-575, MIR575
Description Homo sapiens miR-575 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-575
Sequence 61| GAGCCAGUUGGACAGGAGC |79
Evidence Experimental
Experiments Microarray
Expression Profile
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN24408949 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs764082710 1 dbSNP
rs1459291554 3 dbSNP
rs149186367 4 dbSNP
rs764367689 8 dbSNP
rs748026086 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RBFOX2   
Synonyms FOX2, Fox-2, HNRBP2, HRNBP2, RBM9, RTA, dJ106I20.3, fxh
Description RNA binding protein, fox-1 homolog 2
Transcript NM_001031695   
Other Transcripts NM_001082576 , NM_001082577 , NM_001082578 , NM_001082579 , NM_014309   
Expression
Putative miRNA Targets on RBFOX2
3'UTR of RBFOX2
(miRNA target sites are highlighted)
>RBFOX2|NM_001031695|3'UTR
   1 AGTGACGTGAGACCCCTGCAAATGGGACAGCCCCCCAGTTCATGAGGCCTGGCTATTGCAATATTTACTAGTAGAGGAAC
  81 TCTATAGCAAGATGAAGAGGAAAAACAAACAAACAAACAAAAAAAAACACAAAAAAAGAAAGAATACTTTTTTATACCTC
 161 ACTATGTTCTTTGAATATGTATTTTTCCTTTAAATTTCTGCCTTTAATTCTTTTGTTCCAAAGATTGTGCATTTTTTTCT
 241 TTTTTTTTTTAAACTGTGGTAAAAAAAAAAAAAATAATGCATTTCCATGTCTGTATGTCCGTGCTTAGCTTATTCTATCA
 321 ATCACGGAAGAGGCAGTCAAGGAGGAAGGAGAGACATTAGGAGCCGATAAATGCATCTGATCAGAAATCAGCAGACAGAA
 401 TTACCAAAGTGTATCTGGTGCTGAATGACTGGGGGACAAGCAGAAGTGGAAGAGATCTTTCTGCAACAGGATATTCTTCT
 481 AGTCTTCTGAGTTTCTGGTCTTTGACAGGCAATTCTGGTTGGCTGTGGCTGGAATCCACATGCTGATAGATAGGAATTTG
 561 TGCTTACAAAGCAGGAGAATTAAAAAGACGCTTTCCTCTCCTCTTCCCTCCTGTCTTCTCCGTTCTTTTTACAATCATCT
 641 TACACGCACAGCCTGAGACAGCTGGCATAGTTTTTGGAATTATAGTATTGATATTTCCAAACGTGCTCTCAGACAGTGGA
 721 TAATAAACACCTCATTAGGAAACCGATCTCAGAATGAACTCTGGAGTATGAAAAAGATCATTTCTTTTTGTTCCTGTAAC
 801 CTAGCATTCCTTCTAGGCTTCTTCTCCTTTAATTGAACCACAGCTTAGCTCATGTATTCTTTTATTAACACCCTGCTCTC
 881 ATGTCCATAAGATTCAGGAATTTAGGACCCAGGGACAGAAAAGTGAATAAGCCAGTGACCAGATTTCCCCCAGATGTCTT
 961 GAGGATTAGAAGTACAAATTGTTGACAGCCATTAAAGAGGGTGAGGAAGGGAAAAGGAATATTAGAAGATCTGGTATTTC
1041 TTACTTTTTTCTTGCCTCAGAAAGTACAAAGTTTAAAAAATAGAATAAAGAATCTGCTGGGGAAAGATAGAGTACCAGGT
1121 CCTAGGTCAGTAGTCCCTGGAAGTTTTGGTGATGAGGACATGGAAGGGCAGGCAGAGGCACTTTGTACTTGCTCCAAAGC
1201 CATAGGAATTTTCATCTTCCAGAGCCTTTATGAGTCACTTCTCTATCCACAGTCTTGAGCCTGTGGCTATCCCGCTGAGC
1281 TTCTCACTGTCCTCCAAAAACACCCCGCTGAGCACCCGGACCACTTTGTACACATTAACACTACAGGACATAAAATGCAG
1361 AGGCCCTGAGATTGCTGCCCTCCCATATTGGAAGGAGGGTCTGCGATGGCAAGGGTCTTCTATATCACCAGAAAGAGTCG
1441 CGCAGTGAGTCACTGCCGTTGCCATCTGGCTGTAATTTTCTATGTTATCAAGGTAGGAGGGAGTGTTTCTCTTCTAGCTG
1521 TTAGATAGAACTGATAAAAGCAAGTGTCCTACAGCATTTCCCAAATGAAGGCATTAGGAAATAGAAAAGCACGGTCTTTT
1601 TGGCTCCCTGGTCTAGTCACATTGGTACTAGGGTGACCTTTCACCCAAGGGACAGCTGCTAAAGGGAGTAATTCAGAGAC
1681 ATGGAGCTTCTGGTTATGGGTTTGTTTTGGGTTTGTTTTTAACTCCTGCCTCCACACATGTTCTTGACTGATAACTGACT
1761 CATGTCCCTGAATTAAAATGACTGACCTATGACAGCATCAAGCATTCTTTGTAAGCAGAGTGATATATCTGAGAGGGCGT
1841 TGACCTGTTGTGTAGAATACATATCCTTTCCCCCTTCAGAATCCTGTCTCGCCTCGTAACTGGGAGAGAGGCTGTGCCTG
1921 AAACTAGGGGCGATGTCAAGGAAGCTAGAGGCCTCGATGCAATTATTACTGACTCTGGGGAGGAAGACAGAGAATAAGGG
2001 GACACCAACTGCCCAGTCCACTGGCCATTTTTAAGGGTCCCCCCACCCCAAGCCAAAGTTTGGTTTGTTGCTGTTAAGAC
2081 AATTTTTGTTGTATGTATATAAATATTTTAGTTAGAGGAGCGGGGAATGGGATGCGGGCTTTCACAGTTCTAGGGAATGG
2161 GGGCAGGGAGGATTTTGCTTTTGCTTTTGCTTTGAGGGAGAACTTTAGCTGACTAAAAAAACAGAAGTTTGGGGTCATGA
2241 TCACAAAGGGGCCATTCCCAAAAGATGGCAAGCCACGTATTCAGTGGAGACTAGGCCAAATTCTAAATGGTTTTATCCAT
2321 AGCAGGGGAGAATAGGAGAATGAGTTTAAGAGTTTTTCTCTTCTTTTTTCCTAGAAAGAGGTAAGGATAATGGGAAAGGT
2401 AGAGAAGGCGGCTCCCACAGACCTTTTAAGAGAGGCAGAATCTTGAGCTTGAGGCACCTTGAGTGCATCTCAGTTCAGCT
2481 GGTTCTGGCTGAGGCCTCCAAAGGCAAGCTCTGTGCTTTCCAGTGGTTTCTGCTGCATTTCCAGGGATGGTGTTTAACAC
2561 CGCTTCCTCCAGCTCCCTTTTCTAAGAAAGAATAAATGGAGTTCTGCTTTTTATGAAAGGGTCTTTGGTTTTCAGTGTCA
2641 ACACTGAGAATTGGGGCTCTTGCAAGCATCTGGATTTCACAGTATCAACCTCCCCGTCACCTTTTGAACTTTGAGACTCC
2721 GTACGGTCAACTTCACCAGAGGCAGGTTGCTCGAAGCAGCACTGCTTGTCTGTTCCTGACTCTGGTTCTCACTGTATTAA
2801 AAAAGAGAGTCAGAGGAGTCTGGCATTTCGTGAGTTTGTTAGAGGATGCTGGCTGATAATTCCAGAAAACTTACTGATGC
2881 TAAATCACAGTACATGCATGATTCTTTTTCAGCTTTACTATAGTTCATGACCTGGACTTTCTGTACTCTTGGAAGCTGGG
2961 CTCCTTAAAGGAGGCCTCTAGTGAACACCTTTATCTCCATGTCCCTCTTAGAGCCCAGAGAGCTGCCCATAGGCATTTTC
3041 CAGAATTCCTCATGTCACCTAGTTCAATTTCCATTAACTCAGATCAGCCATTGTGATTCACCATTTGTCAGGCTCTCAGG
3121 TTTAACAAAACCTACTATCACCATCATCCTTCAACAGCCACAGTCTGAATTGAGCCAACATTTTTTTTTCTTTGAGAAAG
3201 AAGTGGACTGGGGCACAACTTTTAGTCTGAGGGGAGCTAGTGGAAATCTAGACAATAGAAGTCATCGATAGCAGCTTTTC
3281 CTCAAATGTGTGACTCCTCAGGGGCTAAACTGCTCTTAGCTTAGAATTATGCTTTACTAGAGATCTAGCAGATAAGTGGG
3361 TTAATCACTACCATCCTGTAACTAGTTATATAGCTTCCAGACATGAGGGAGACATCAAACAGGGATGGAAGCAACCCCAA
3441 GGATATGCAAGAAGGGCATGATGAACCCCCTTCCCTCTGGCAGGAGAACAAGGCCAACCAAGGGACAGACTGGAAAGCAC
3521 TTAGATGTTTAAGGAGGAGAAAGGGGAAGCTTTGACCAGTCCTTGCCTTTTGCCAAGTTCAGCCAGTTCTCCGCTGCTTG
3601 CAACCTCTAGCGCAGTAACATTTGCAGAATTGCAGATTTTCCCCCAGATACTAGGAGGAAAGGGACTTTGGGGGGTGGGG
3681 AAGGGGTCGTGGTGTTTTAAAAGCATAAGTTACCTGTTTGCACTGTTTTAAGATAGGAAAAAAAAATAGTGGGCAAGGTG
3761 AACATCAGACGTAAATTTGTGTGTTTTTATTTTGTCATGCTCTTGAAAATGTTTGACCATTTGTAGTATACACAGTGAAA
3841 CTTGATTCTCTGTTGCATAAAACACTATATTTTTTTGGAAATGTTACTGTCCAAAAGCCTCTTCCCTCCCTTTCCTTTTC
3921 CTATGTACTTCCTTCATACTTGCTTTACTGATCAGCCAGGCAATAGCCATCCAAGAGCTAGAGCATGAAACAGGGCCCTT
4001 TCCAAGTAGGCTCTGGGTGTCCTAAGCCAGCGTGTGCCCTCTGGTTTAGTGAGTGTAATAGAGTCCCTGGCACCTTTCTT
4081 TGCAAATGAGGCTAACAGACCAGACTGCAGCAAGTTATCAGATTCCTCAATCAGATGCACTAGGAGTGAGGAGCCCAGGG
4161 ATGGAGGGGGTTCCTGAAGTATTGCAGTTGGCTGTAGTAGCTGAGTTCTTTTCCATGTTACCGAAACTGTAGCCAGTTAC
4241 AGTTTACTCAGGAAAACGGTAGATCAATTCAGCCATGGTAGTGCTGGTTGGCAGGGATTGGTAACGGAGAGAACTGCTCA
4321 TCAGCCAAAACTCAAGCCTTGCCTTTTAGGAGGCCACCAGCAGAGGGACTTGGTCCTCCTTGTCTGGTACTTGTGTACAT
4401 GCCGGTGACCTGAGGACTCCACTCACACTGGCGAGCAAAAAGGGAGCAGTGATTCTCTTTTCTCTCCCCACCCCCTGCCC
4481 TTTGTTACCAACACCAGTTTCCCAGGGGGTACATGAGTTTCTGAATTTTTAAAAAATGTTTTTGGTTTGGTTTTTCTGGG
4561 GACTGATAAGTGCTTTAAGCAATGTCCATACCCCGTCAAGACTCCCAGCTTAGTCATTTTCTTGTATTTTTCTGTTCACA
4641 GTATTTGTGTGTGTGCTTGTTTTGGCAGCTCATTTTGGCTGTATTATATATTGAGTGATGAATTGATCCTCTTTTTTCCC
4721 TAAGGGATATGAATTGTTTTTCTTGTGTTATATTCTGCTTGTGAATAGCTGGAGCAAACCTGGGGCTGACACGCGTAAGC
4801 TAGGGCTGCAAAGCGAGAAGAGAGCCGGTGGAGTGTACTTGTCCCTGACAGGCTGACCTACCTGAGTCTCTGAGCTTTTC
4881 AGTCCAAATCTTTGCAAGGCTCAAAATGCCACAGAACCTCTCCTCTTCTCCCCACTCCCCATGGCAGGGACCGGACCATC
4961 CCTACATGCAACATGCTGTTCCTCCAGCCCCTCCCATTGCCATGGCAAAACAGGTACCTTTGGGGCATGGGGGCATTACA
5041 TGGGATGCTTGTGTAATCGACCACCTAGCCTTCTCTCTCCCCTCCCGTCCTCCCCCAGAATCACTTCCTAGGACACCCGA
5121 GCTGCTTGCCCAGGGTCCTGTTTCCCTGCTAACTCCAGAGAAGCATCCCAGGGCTTTGTGACAGTCTCTAATTCCCTTCC
5201 CTTCTCGTTAAGAATCATATTGTATAGTAGCTTTCAGACCATACAGTATTCATTGGGTTACTCCTATTATTATCAAGTAG
5281 CTGGAATTGTGAAGGTCGGAGTAGTTAGATCTTTAGCTTTTATTCCTTATTTTTTTGTATTACTCTCCATGTGTATAAAT
5361 TATTGATCATGTTGCTGGCTTTTATAAACTCTAAGCGAAGGAGGAGCACTGCCTCAGCCTTTGCACATGGTAATGAAGCA
5441 CTGTTTTTAAATAAAAGAGAGAAACACCATTAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' cgaGGACAGGUUGACCGag 5'
             || |||| ||||||  
Target 5' tgcCCAGTCC-ACTGGCca 3'
2010 - 2027 139.00 -19.60
2
miRNA  3' cgAGGACAGGUUGACCGAg 5'
            || |||:  :|||||| 
Target 5' gaTCATGTT--GCTGGCTt 3'
5365 - 5381 137.00 -11.80
3
miRNA  3' cgAGGACAGGUUGACCGag 5'
            |||  ||  ||||||  
Target 5' acTCCACTCACACTGGCga 3'
4416 - 4434 133.00 -15.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM186131 6 COSMIC
COSM8179501 7 COSMIC
COSM4004922 9 COSMIC
COSM270007 10 COSMIC
COSM8360080 10 COSMIC
COSN30475271 24 COSMIC
COSN30478131 25 COSMIC
COSN20073061 31 COSMIC
COSN30481548 33 COSMIC
COSN30451049 36 COSMIC
COSN31531207 88 COSMIC
COSN30154126 97 COSMIC
COSN31534378 109 COSMIC
COSN20117415 119 COSMIC
COSN8010334 122 COSMIC
COSN27501926 239 COSMIC
COSN23973507 254 COSMIC
COSN31535801 260 COSMIC
COSN20117414 261 COSMIC
COSN8017992 272 COSMIC
COSN29461439 275 COSMIC
COSN1261374 281 COSMIC
COSN31611228 284 COSMIC
COSN26565918 300 COSMIC
COSN26573545 326 COSMIC
COSN31588264 340 COSMIC
COSN31479988 349 COSMIC
COSN8017991 439 COSMIC
COSN31523897 1198 COSMIC
COSN16886387 1272 COSMIC
COSN20993431 1518 COSMIC
COSN31526747 1593 COSMIC
COSN31551569 1710 COSMIC
COSN31595724 1737 COSMIC
COSN31529462 1890 COSMIC
COSN30045394 1908 COSMIC
COSN9165262 1932 COSMIC
COSN8017990 2159 COSMIC
COSN9165261 2226 COSMIC
COSN31548570 2580 COSMIC
COSN31553268 2720 COSMIC
COSN1898392 3108 COSMIC
COSN5455649 3633 COSMIC
COSN8612639 3635 COSMIC
COSN31521367 3737 COSMIC
COSN5991956 4046 COSMIC
COSN31531223 4188 COSMIC
COSN31564975 4284 COSMIC
COSN28201664 4367 COSMIC
COSN5455648 4372 COSMIC
COSN20812989 4759 COSMIC
COSN10030144 4792 COSMIC
COSN10030143 4953 COSMIC
COSN28798551 5025 COSMIC
COSN25696641 5031 COSMIC
COSN1898391 5056 COSMIC
COSN31568395 5058 COSMIC
COSN30116438 5086 COSMIC
COSN31568118 5216 COSMIC
COSN30166583 5299 COSMIC
COSN27542704 5329 COSMIC
COSN31570133 5330 COSMIC
COSN23572885 5467 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1352427170 2 dbSNP
rs776577786 6 dbSNP
rs371844393 7 dbSNP
rs368537797 9 dbSNP
rs1302146011 14 dbSNP
rs768311951 17 dbSNP
rs1377018531 22 dbSNP
rs1389985358 23 dbSNP
rs758671765 24 dbSNP
rs748563938 27 dbSNP
rs991566214 27 dbSNP
rs1379859724 29 dbSNP
rs779417558 30 dbSNP
rs374999950 32 dbSNP
rs1312989799 33 dbSNP
rs1358895300 35 dbSNP
rs754303742 36 dbSNP
rs749176289 37 dbSNP
rs779721558 37 dbSNP
rs766867880 42 dbSNP
rs756739583 44 dbSNP
rs751057219 47 dbSNP
rs1211228868 52 dbSNP
rs545279111 54 dbSNP
rs1258512462 55 dbSNP
rs761124564 58 dbSNP
rs1316965416 60 dbSNP
rs376707088 65 dbSNP
rs926502197 67 dbSNP
rs1242461373 68 dbSNP
rs1449486692 85 dbSNP
rs1194727940 87 dbSNP
rs982374917 99 dbSNP
rs1461210191 102 dbSNP
rs934120265 109 dbSNP
rs1323442823 114 dbSNP
rs1167675250 115 dbSNP
rs576305834 118 dbSNP
rs374794528 119 dbSNP
rs117617596 122 dbSNP
rs1297855332 122 dbSNP
rs1335230331 122 dbSNP
rs970560630 122 dbSNP
rs146996497 125 dbSNP
rs1032004040 128 dbSNP
rs1201552380 128 dbSNP
rs555384019 128 dbSNP
rs957730839 128 dbSNP
rs988017628 128 dbSNP
rs1206356083 132 dbSNP
rs1259119632 138 dbSNP
rs1007345541 145 dbSNP
rs542490804 146 dbSNP
rs1430975995 151 dbSNP
rs1398889190 154 dbSNP
rs888880116 164 dbSNP
rs1405942652 166 dbSNP
rs1454799057 173 dbSNP
rs1290696235 181 dbSNP
rs1030052169 187 dbSNP
rs964522500 187 dbSNP
rs998100367 188 dbSNP
rs1174089222 203 dbSNP
rs897954182 209 dbSNP
rs1221424519 213 dbSNP
rs1317426107 215 dbSNP
rs1217933183 225 dbSNP
rs1037058350 229 dbSNP
rs1222598494 230 dbSNP
rs942277839 231 dbSNP
rs887806418 235 dbSNP
rs1055702551 239 dbSNP
rs1161829437 239 dbSNP
rs1362585263 239 dbSNP
rs1420201652 239 dbSNP
rs573895033 240 dbSNP
rs937320638 242 dbSNP
rs1303872913 245 dbSNP
rs1367652412 246 dbSNP
rs928725937 250 dbSNP
rs1225259087 251 dbSNP
rs1373868384 251 dbSNP
rs35925116 251 dbSNP
rs1242807358 254 dbSNP
rs1215074153 256 dbSNP
rs1246019913 259 dbSNP
rs1316291894 259 dbSNP
rs1293368013 260 dbSNP
rs1356795324 261 dbSNP
rs981517567 261 dbSNP
rs949244866 271 dbSNP
rs187725493 272 dbSNP
rs988091374 273 dbSNP
rs1039926848 275 dbSNP
rs1248989271 275 dbSNP
rs71658610 275 dbSNP
rs76084830 275 dbSNP
rs879230730 275 dbSNP
rs1347583634 276 dbSNP
rs1355348563 288 dbSNP
rs1296269824 293 dbSNP
rs534289647 300 dbSNP
rs1301644709 301 dbSNP
rs985805932 302 dbSNP
rs953040622 312 dbSNP
rs1008026423 315 dbSNP
rs910355306 317 dbSNP
rs1362143919 321 dbSNP
rs979335682 326 dbSNP
rs1250029310 327 dbSNP
rs1428027397 342 dbSNP
rs967918866 345 dbSNP
rs1020644554 349 dbSNP
rs1245512838 357 dbSNP
rs1433918049 359 dbSNP
rs1181374140 363 dbSNP
rs1009637681 365 dbSNP
rs1411904348 366 dbSNP
rs1170205612 374 dbSNP
rs1430525551 376 dbSNP
rs751791437 378 dbSNP
rs960527743 379 dbSNP
rs1035187682 395 dbSNP
rs796467520 413 dbSNP
rs28562663 415 dbSNP
rs1001921628 424 dbSNP
rs1474451167 429 dbSNP
rs774563214 432 dbSNP
rs767663315 440 dbSNP
rs1260291732 446 dbSNP
rs1270312383 447 dbSNP
rs1212254893 450 dbSNP
rs571625183 463 dbSNP
rs138820911 466 dbSNP
rs1293881112 471 dbSNP
rs538525364 475 dbSNP
rs1317599958 477 dbSNP
rs569486569 479 dbSNP
rs777893842 480 dbSNP
rs751665732 485 dbSNP
rs1460394085 488 dbSNP
rs1209466650 497 dbSNP
rs1005831333 506 dbSNP
rs1476505677 515 dbSNP
rs1055945854 520 dbSNP
rs1001950787 521 dbSNP
rs1480612955 522 dbSNP
rs1178365491 524 dbSNP
rs887344348 525 dbSNP
rs1403777892 537 dbSNP
rs549668936 539 dbSNP
rs1046273342 540 dbSNP
rs529439556 546 dbSNP
rs566728897 550 dbSNP
rs1428048808 554 dbSNP
rs1287862420 556 dbSNP
rs1345773508 558 dbSNP
rs1212329958 566 dbSNP
rs1224458702 568 dbSNP
rs1356787859 571 dbSNP
rs933987277 573 dbSNP
rs922594733 574 dbSNP
rs936459534 579 dbSNP
rs1040204589 582 dbSNP
rs925198078 589 dbSNP
rs1293309965 595 dbSNP
rs1262697080 602 dbSNP
rs1490586985 604 dbSNP
rs551520981 619 dbSNP
rs371513393 621 dbSNP
rs184549066 622 dbSNP
rs1486974215 625 dbSNP
rs1299679754 634 dbSNP
rs1410080916 640 dbSNP
rs1398399147 645 dbSNP
rs566156006 646 dbSNP
rs1365775962 659 dbSNP
rs564536871 667 dbSNP
rs913803723 669 dbSNP
rs1329779453 677 dbSNP
rs552989953 683 dbSNP
rs988038115 685 dbSNP
rs1426912991 691 dbSNP
rs1014602309 703 dbSNP
rs1285463643 706 dbSNP
rs1360424017 708 dbSNP
rs960662644 719 dbSNP
rs1034664522 721 dbSNP
rs1001974137 728 dbSNP
rs5755938 731 dbSNP
rs1450768360 733 dbSNP
rs1182280916 734 dbSNP
rs1420153546 744 dbSNP
rs1468570871 759 dbSNP
rs1157503651 761 dbSNP
rs1385377922 766 dbSNP
rs1426158491 770 dbSNP
rs952182036 776 dbSNP
rs1389595874 779 dbSNP
rs1405097204 784 dbSNP
rs1330017928 800 dbSNP
rs1338028914 801 dbSNP
rs1445293428 802 dbSNP
rs1034569792 806 dbSNP
rs1001791231 814 dbSNP
rs907232603 815 dbSNP
rs1263849597 820 dbSNP
rs1045719860 822 dbSNP
rs1196124706 824 dbSNP
rs1010761387 826 dbSNP
rs1435993409 828 dbSNP
rs891897437 831 dbSNP
rs1243679442 833 dbSNP
rs1054508886 841 dbSNP
rs969109870 850 dbSNP
rs1445860142 851 dbSNP
rs1017144851 852 dbSNP
rs1181251218 854 dbSNP
rs1367500808 856 dbSNP
rs1179391280 859 dbSNP
rs535966088 864 dbSNP
rs1168841642 868 dbSNP
rs1399170815 869 dbSNP
rs1464400691 870 dbSNP
rs867472854 871 dbSNP
rs1331201059 874 dbSNP
rs1407506690 876 dbSNP
rs755930359 878 dbSNP
rs1310713425 880 dbSNP
rs7511547 893 dbSNP
rs1250458499 895 dbSNP
rs1202028870 898 dbSNP
rs1271709747 903 dbSNP
rs925104878 906 dbSNP
rs1197793418 916 dbSNP
rs1263638447 919 dbSNP
rs1462629048 923 dbSNP
rs887407257 924 dbSNP
rs1336436639 928 dbSNP
rs1273273636 931 dbSNP
rs1428744645 934 dbSNP
rs1232089267 937 dbSNP
rs1026323495 940 dbSNP
rs1309050613 950 dbSNP
rs931902819 968 dbSNP
rs77463193 973 dbSNP
rs200514647 975 dbSNP
rs922952164 981 dbSNP
rs998420026 985 dbSNP
rs1391809504 991 dbSNP
rs901186953 1000 dbSNP
rs1301151626 1006 dbSNP
rs1039660739 1016 dbSNP
rs961986619 1018 dbSNP
rs1320468036 1028 dbSNP
rs1338741178 1029 dbSNP
rs907639802 1031 dbSNP
rs1283743515 1034 dbSNP
rs1325571817 1045 dbSNP
rs1464267945 1049 dbSNP
rs1396895393 1051 dbSNP
rs764166498 1054 dbSNP
rs1231062480 1056 dbSNP
rs1165827609 1058 dbSNP
rs1255342825 1059 dbSNP
rs984468345 1061 dbSNP
rs1206396975 1066 dbSNP
rs942815355 1068 dbSNP
rs544707017 1081 dbSNP
rs762978754 1087 dbSNP
rs1430505772 1099 dbSNP
rs1481704361 1108 dbSNP
rs1250290852 1110 dbSNP
rs1043578125 1112 dbSNP
rs1469545270 1119 dbSNP
rs567399351 1121 dbSNP
rs1034473074 1122 dbSNP
rs780931642 1124 dbSNP
rs775485249 1126 dbSNP
rs1358835117 1137 dbSNP
rs1332006825 1138 dbSNP
rs1002223720 1155 dbSNP
rs1261922986 1156 dbSNP
rs971655674 1169 dbSNP
rs1239720194 1170 dbSNP
rs913704303 1185 dbSNP
rs754929054 1187 dbSNP
rs988478247 1192 dbSNP
rs1024956045 1194 dbSNP
rs1317475653 1212 dbSNP
rs1304620892 1219 dbSNP
rs878874233 1220 dbSNP
rs531617408 1221 dbSNP
rs562605949 1223 dbSNP
rs1010245115 1224 dbSNP
rs542928453 1225 dbSNP
rs1283327975 1226 dbSNP
rs550584328 1234 dbSNP
rs751517601 1237 dbSNP
rs1373553559 1245 dbSNP
rs1222858523 1247 dbSNP
rs939260943 1250 dbSNP
rs891761815 1264 dbSNP
rs573832868 1269 dbSNP
rs1440320936 1271 dbSNP
rs927644652 1272 dbSNP
rs1033134323 1275 dbSNP
rs554017776 1282 dbSNP
rs1000273399 1283 dbSNP
rs1454763087 1285 dbSNP
rs1363668649 1286 dbSNP
rs1378616339 1293 dbSNP
rs1157289812 1306 dbSNP
rs980421396 1307 dbSNP
rs969160845 1313 dbSNP
rs1456158382 1315 dbSNP
rs1292763823 1317 dbSNP
rs1016691363 1318 dbSNP
rs1050250495 1331 dbSNP
rs983837944 1334 dbSNP
rs931782283 1335 dbSNP
rs1246097211 1339 dbSNP
rs951644392 1343 dbSNP
rs1293435189 1350 dbSNP
rs1319586047 1358 dbSNP
rs1219784928 1359 dbSNP
rs1192643988 1362 dbSNP
rs901770805 1363 dbSNP
rs1449477994 1369 dbSNP
rs1200998003 1377 dbSNP
rs1263226122 1379 dbSNP
rs1439107709 1381 dbSNP
rs1025786073 1385 dbSNP
rs1485538186 1388 dbSNP
rs765845419 1389 dbSNP
rs1163794352 1398 dbSNP
rs1463338358 1399 dbSNP
rs1329155149 1404 dbSNP
rs940365911 1405 dbSNP
rs901410535 1413 dbSNP
rs757953831 1422 dbSNP
rs367633849 1426 dbSNP
rs540718437 1440 dbSNP
rs578176250 1441 dbSNP
rs927490899 1442 dbSNP
rs764901887 1446 dbSNP
rs946125947 1451 dbSNP
rs1308388740 1453 dbSNP
rs1329490120 1453 dbSNP
rs892313794 1457 dbSNP
rs1052259180 1458 dbSNP
rs538229290 1469 dbSNP
rs939294718 1472 dbSNP
rs927859464 1475 dbSNP
rs558108414 1482 dbSNP
rs537820198 1483 dbSNP
rs1482399140 1484 dbSNP
rs909518833 1488 dbSNP
rs1032996542 1489 dbSNP
rs1420514498 1500 dbSNP
rs1478653922 1502 dbSNP
rs1384955006 1505 dbSNP
rs983890289 1512 dbSNP
rs951143595 1526 dbSNP
rs1437074812 1530 dbSNP
rs575619812 1533 dbSNP
rs1173333152 1534 dbSNP
rs1335616507 1534 dbSNP
rs1476845290 1535 dbSNP
rs530552288 1543 dbSNP
rs535756550 1565 dbSNP
rs1289034299 1570 dbSNP
rs1363673235 1571 dbSNP
rs976937432 1578 dbSNP
rs193055847 1592 dbSNP
rs546837643 1593 dbSNP
rs533620877 1594 dbSNP
rs569452170 1599 dbSNP
rs1040331265 1601 dbSNP
rs1209534062 1602 dbSNP
rs36085732 1602 dbSNP
rs940604661 1604 dbSNP
rs868634307 1606 dbSNP
rs374995625 1613 dbSNP
rs1007064443 1615 dbSNP
rs1262288582 1617 dbSNP
rs1480643166 1647 dbSNP
rs1174189887 1649 dbSNP
rs968706278 1653 dbSNP
rs1423001568 1664 dbSNP
rs1413364118 1677 dbSNP
rs1159242848 1680 dbSNP
rs1021559540 1681 dbSNP
rs1048694560 1682 dbSNP
rs1010762920 1708 dbSNP
rs1208381901 1708 dbSNP
rs891866631 1709 dbSNP
rs144941938 1710 dbSNP
rs1340220562 1720 dbSNP
rs1405950516 1721 dbSNP
rs927078979 1724 dbSNP
rs1228292716 1728 dbSNP
rs1003376220 1730 dbSNP
rs1285106891 1732 dbSNP
rs1356107797 1736 dbSNP
rs1214641388 1737 dbSNP
rs775940029 1738 dbSNP
rs1490437803 1740 dbSNP
rs950283837 1742 dbSNP
rs917395295 1752 dbSNP
rs906327235 1767 dbSNP
rs1177257048 1778 dbSNP
rs1417167836 1779 dbSNP
rs1381700617 1785 dbSNP
rs1417330773 1786 dbSNP
rs1157618144 1787 dbSNP
rs767831871 1789 dbSNP
rs551468737 1790 dbSNP
rs1406281575 1796 dbSNP
rs141298442 1797 dbSNP
rs1329834110 1809 dbSNP
rs1048045529 1826 dbSNP
rs562507072 1838 dbSNP
rs749407345 1839 dbSNP
rs1238083800 1844 dbSNP
rs976867428 1850 dbSNP
rs548963787 1854 dbSNP
rs1028411988 1855 dbSNP
rs998674742 1856 dbSNP
rs529243633 1861 dbSNP
rs1019183732 1872 dbSNP
rs1437227798 1886 dbSNP
rs1177505392 1890 dbSNP
rs1385439544 1891 dbSNP
rs560382702 1893 dbSNP
rs540458253 1895 dbSNP
rs1389110981 1896 dbSNP
rs1405154095 1902 dbSNP
rs577931110 1905 dbSNP
rs1332574159 1912 dbSNP
rs886378319 1917 dbSNP
rs1475500308 1918 dbSNP
rs1048939327 1924 dbSNP
rs985695885 1929 dbSNP
rs1341275607 1930 dbSNP
rs1247338825 1931 dbSNP
rs1282652315 1931 dbSNP
rs905522281 1932 dbSNP
rs1439305629 1942 dbSNP
rs1044184867 1948 dbSNP
rs949823625 1949 dbSNP
rs1456419683 1954 dbSNP
rs968927006 1955 dbSNP
rs770066555 1956 dbSNP
rs1300002231 1973 dbSNP
rs934786981 1975 dbSNP
rs1184884235 1983 dbSNP
rs1256251152 1989 dbSNP
rs1472650216 1990 dbSNP
rs1235200578 1992 dbSNP
rs765751573 1994 dbSNP
rs1464571016 2006 dbSNP
rs1293184928 2008 dbSNP
rs1402915534 2012 dbSNP
rs117149350 2013 dbSNP
rs956357906 2014 dbSNP
rs1332384544 2017 dbSNP
rs1337927567 2025 dbSNP
rs1329913007 2031 dbSNP
rs549611613 2034 dbSNP
rs921256384 2037 dbSNP
rs1397600252 2042 dbSNP
rs1315977708 2045 dbSNP
rs1166541011 2046 dbSNP
rs781036448 2049 dbSNP
rs1461503548 2055 dbSNP
rs1003336128 2061 dbSNP
rs1161367022 2063 dbSNP
rs965828694 2073 dbSNP
rs1015657449 2077 dbSNP
rs1471091730 2080 dbSNP
rs1194825929 2091 dbSNP
rs754771325 2094 dbSNP
rs1004687364 2097 dbSNP
rs950521472 2098 dbSNP
rs1027566246 2099 dbSNP
rs1467615484 2111 dbSNP
rs1170936615 2116 dbSNP
rs1044901045 2121 dbSNP
rs544697438 2122 dbSNP
rs779990179 2128 dbSNP
rs1044432317 2131 dbSNP
rs1013898611 2132 dbSNP
rs888356311 2135 dbSNP
rs1048572656 2136 dbSNP
rs934818049 2147 dbSNP
rs926108833 2149 dbSNP
rs1043363949 2150 dbSNP
rs929658626 2161 dbSNP
rs575510717 2163 dbSNP
rs1040810800 2169 dbSNP
rs1335528287 2178 dbSNP
rs1487486148 2180 dbSNP
rs371530983 2186 dbSNP
rs943768273 2188 dbSNP
rs757865943 2191 dbSNP
rs1268635171 2194 dbSNP
rs977178088 2195 dbSNP
rs1196829210 2202 dbSNP
rs944026051 2203 dbSNP
rs985582856 2204 dbSNP
rs1353383296 2206 dbSNP
rs1418831778 2211 dbSNP
rs1293944993 2212 dbSNP
rs947674848 2214 dbSNP
rs914826778 2215 dbSNP
rs749942759 2219 dbSNP
rs555773659 2220 dbSNP
rs1027430401 2222 dbSNP
rs1306582596 2233 dbSNP
rs1374282102 2240 dbSNP
rs1327463881 2243 dbSNP
rs1266462368 2245 dbSNP
rs1489752159 2246 dbSNP
rs373372113 2247 dbSNP
rs981572878 2252 dbSNP
rs970117716 2266 dbSNP
rs1252939079 2274 dbSNP
rs970397897 2276 dbSNP
rs1023507625 2277 dbSNP
rs1378674605 2278 dbSNP
rs1439380140 2292 dbSNP
rs1351331816 2293 dbSNP
rs535744614 2295 dbSNP
rs1456208949 2297 dbSNP
rs764813966 2298 dbSNP
rs573229115 2306 dbSNP
rs1292817941 2310 dbSNP
rs1400984092 2325 dbSNP
rs1448313176 2326 dbSNP
rs1393125987 2329 dbSNP
rs1012081752 2333 dbSNP
rs1228599219 2337 dbSNP
rs553135723 2337 dbSNP
rs754192888 2339 dbSNP
rs1402390263 2343 dbSNP
rs756924553 2345 dbSNP
rs1243100785 2347 dbSNP
rs753505134 2348 dbSNP
rs188047238 2349 dbSNP
rs528250572 2352 dbSNP
rs551141188 2358 dbSNP
rs1378755311 2372 dbSNP
rs537954254 2373 dbSNP
rs1182601849 2377 dbSNP
rs568748989 2380 dbSNP
rs1421795448 2386 dbSNP
rs559287448 2386 dbSNP
rs183413621 2389 dbSNP
rs752070058 2400 dbSNP
rs1246202089 2407 dbSNP
rs529359407 2409 dbSNP
rs889526863 2410 dbSNP
rs1448142515 2411 dbSNP
rs1304173420 2413 dbSNP
rs1285567383 2417 dbSNP
rs932814625 2424 dbSNP
rs113159456 2434 dbSNP
rs766994301 2444 dbSNP
rs763066840 2453 dbSNP
rs947559972 2455 dbSNP
rs914692914 2460 dbSNP
rs989090617 2471 dbSNP
rs772682645 2482 dbSNP
rs1256727724 2501 dbSNP
rs944041410 2506 dbSNP
rs908541426 2516 dbSNP
rs982856857 2520 dbSNP
rs1366396617 2550 dbSNP
rs934889021 2560 dbSNP
rs191100074 2562 dbSNP
rs981433410 2567 dbSNP
rs1478683592 2570 dbSNP
rs970168688 2572 dbSNP
rs1432286011 2577 dbSNP
rs1418741730 2578 dbSNP
rs775363208 2581 dbSNP
rs1023056612 2589 dbSNP
rs188061884 2599 dbSNP
rs919985075 2606 dbSNP
rs1433787661 2607 dbSNP
rs1298436314 2620 dbSNP
rs1456542239 2633 dbSNP
rs533116513 2635 dbSNP
rs1317534343 2645 dbSNP
rs564316384 2651 dbSNP
rs1361914490 2655 dbSNP
rs544372078 2661 dbSNP
rs1027208478 2663 dbSNP
rs1280901920 2666 dbSNP
rs1310665323 2666 dbSNP
rs1210357517 2668 dbSNP
rs969883641 2678 dbSNP
rs1489121417 2686 dbSNP
rs1191278678 2688 dbSNP
rs1023305850 2690 dbSNP
rs529527074 2692 dbSNP
rs1424704511 2695 dbSNP
rs1189612235 2696 dbSNP
rs994123719 2709 dbSNP
rs769831675 2712 dbSNP
rs762062748 2720 dbSNP
rs5755937 2721 dbSNP
rs1421871089 2723 dbSNP
rs182183370 2724 dbSNP
rs1021358797 2725 dbSNP
rs768448693 2726 dbSNP
rs899960457 2730 dbSNP
rs1049477068 2731 dbSNP
rs1365508242 2740 dbSNP
rs1233688783 2743 dbSNP
rs1041726106 2746 dbSNP
rs947110207 2752 dbSNP
rs746839830 2753 dbSNP
rs1283377929 2755 dbSNP
rs1451969957 2765 dbSNP
rs1053683238 2768 dbSNP
rs1362074127 2775 dbSNP
rs1244928007 2779 dbSNP
rs1467603397 2784 dbSNP
rs1178755986 2792 dbSNP
rs190892855 2794 dbSNP
rs779901901 2799 dbSNP
rs1437502383 2804 dbSNP
rs1407635841 2805 dbSNP
rs572918295 2805 dbSNP
rs1398080487 2807 dbSNP
rs766741087 2810 dbSNP
rs1392959146 2812 dbSNP
rs1440225282 2814 dbSNP
rs928878249 2827 dbSNP
rs1045974092 2829 dbSNP
rs1379389827 2830 dbSNP
rs151061359 2834 dbSNP
rs1465353383 2838 dbSNP
rs1229849854 2846 dbSNP
rs546092124 2858 dbSNP
rs915884296 2863 dbSNP
rs1178569383 2874 dbSNP
rs1287602100 2877 dbSNP
rs984890356 2881 dbSNP
rs1174189254 2883 dbSNP
rs1045115415 2884 dbSNP
rs1456075610 2891 dbSNP
rs772013361 2901 dbSNP
rs1237716689 2906 dbSNP
rs915739560 2912 dbSNP
rs952211342 2920 dbSNP
rs1416305149 2926 dbSNP
rs1461437422 2936 dbSNP
rs1172015600 2937 dbSNP
rs919800310 2940 dbSNP
rs1402478685 2941 dbSNP
rs959927387 2941 dbSNP
rs1328386144 2942 dbSNP
rs972972901 2945 dbSNP
rs1341335699 2947 dbSNP
rs1192953109 2954 dbSNP
rs1477161989 2955 dbSNP
rs745865585 2956 dbSNP
rs1260224940 2963 dbSNP
rs1334067278 2975 dbSNP
rs1219095723 2976 dbSNP
rs1259936005 2978 dbSNP
rs1315474644 2980 dbSNP
rs924499895 2997 dbSNP
rs977100290 2999 dbSNP
rs186136341 3015 dbSNP
rs1255766881 3017 dbSNP
rs961359530 3021 dbSNP
rs1464493366 3023 dbSNP
rs1460498748 3024 dbSNP
rs1167454979 3026 dbSNP
rs74880125 3029 dbSNP
rs1416448428 3040 dbSNP
rs1206223795 3049 dbSNP
rs1008065560 3052 dbSNP
rs1311299215 3056 dbSNP
rs1307654168 3059 dbSNP
rs1400412338 3061 dbSNP
rs1279972064 3062 dbSNP
rs964587058 3065 dbSNP
rs953728001 3067 dbSNP
rs1027922719 3071 dbSNP
rs1011309095 3074 dbSNP
rs1208207189 3087 dbSNP
rs892869053 3090 dbSNP
rs1279188096 3100 dbSNP
rs1053329353 3104 dbSNP
rs1485526782 3114 dbSNP
rs1008324567 3127 dbSNP
rs1395287349 3132 dbSNP
rs887371078 3135 dbSNP
rs1376730141 3136 dbSNP
rs367975367 3153 dbSNP
rs374373374 3154 dbSNP
rs999431895 3165 dbSNP
rs1479058110 3168 dbSNP
rs77287008 3169 dbSNP
rs1375107361 3170 dbSNP
rs1420055287 3172 dbSNP
rs1444643012 3178 dbSNP
rs995469293 3179 dbSNP
rs1381511500 3180 dbSNP
rs1301908322 3181 dbSNP
rs1170145735 3189 dbSNP
rs1464104199 3190 dbSNP
rs1302199728 3203 dbSNP
rs1354031386 3212 dbSNP
rs1046025154 3216 dbSNP
rs948925402 3222 dbSNP
rs1485101401 3224 dbSNP
rs915935260 3228 dbSNP
rs1423704110 3233 dbSNP
rs1049079324 3235 dbSNP
rs1469849393 3236 dbSNP
rs930779928 3237 dbSNP
rs1394684421 3239 dbSNP
rs1440614336 3243 dbSNP
rs1254519902 3248 dbSNP
rs1160234361 3255 dbSNP
rs756761803 3266 dbSNP
rs915754626 3267 dbSNP
rs1179264592 3268 dbSNP
rs919335908 3275 dbSNP
rs1324700988 3276 dbSNP
rs1438049906 3276 dbSNP
rs1056984333 3280 dbSNP
rs1241781138 3286 dbSNP
rs1480785609 3288 dbSNP
rs1315455866 3290 dbSNP
rs972135058 3294 dbSNP
rs577636669 3297 dbSNP
rs1237177970 3302 dbSNP
rs1337651281 3303 dbSNP
rs5750173 3307 dbSNP
rs977299799 3315 dbSNP
rs1194029904 3325 dbSNP
rs968413668 3330 dbSNP
rs550204644 3333 dbSNP
rs535415652 3344 dbSNP
rs35509587 3352 dbSNP
rs986699796 3352 dbSNP
rs1165278886 3357 dbSNP
rs1370103379 3364 dbSNP
rs1459870773 3366 dbSNP
rs1319785928 3374 dbSNP
rs1400321989 3375 dbSNP
rs1308895614 3378 dbSNP
rs1296052104 3379 dbSNP
rs953950706 3384 dbSNP
rs1391161333 3386 dbSNP
rs1224126556 3388 dbSNP
rs1313963694 3389 dbSNP
rs963844332 3390 dbSNP
rs1019750840 3393 dbSNP
rs564197057 3397 dbSNP
rs746122051 3400 dbSNP
rs1246465424 3403 dbSNP
rs1377978860 3406 dbSNP
rs1330911109 3409 dbSNP
rs1444776675 3422 dbSNP
rs1318647355 3423 dbSNP
rs1008358708 3424 dbSNP
rs1249810320 3428 dbSNP
rs181584791 3441 dbSNP
rs143151515 3445 dbSNP
rs1027978375 3450 dbSNP
rs1182228556 3457 dbSNP
rs1396826421 3472 dbSNP
rs1011656172 3477 dbSNP
rs781317083 3489 dbSNP
rs1424287956 3495 dbSNP
rs1411123670 3498 dbSNP
rs957021999 3502 dbSNP
rs1167765657 3505 dbSNP
rs111572670 3508 dbSNP
rs533300580 3510 dbSNP
rs1304234751 3518 dbSNP
rs1294123608 3531 dbSNP
rs757468873 3536 dbSNP
rs1293176634 3538 dbSNP
rs759470423 3540 dbSNP
rs907387253 3543 dbSNP
rs1341728360 3550 dbSNP
rs1367226099 3551 dbSNP
rs1293607000 3559 dbSNP
rs1306996530 3565 dbSNP
rs898519933 3586 dbSNP
rs1282769295 3592 dbSNP
rs1045055660 3593 dbSNP
rs1440663321 3611 dbSNP
rs1045912168 3612 dbSNP
rs1263788034 3613 dbSNP
rs1176415350 3618 dbSNP
rs896583490 3622 dbSNP
rs1013204791 3624 dbSNP
rs1056530458 3626 dbSNP
rs570552331 3630 dbSNP
rs149080420 3634 dbSNP
rs1373277139 3638 dbSNP
rs1433218731 3644 dbSNP
rs1312709925 3651 dbSNP
rs1361727357 3670 dbSNP
rs769595531 3671 dbSNP
rs1049132251 3672 dbSNP
rs1208667989 3675 dbSNP
rs62233617 3678 dbSNP
rs764256337 3683 dbSNP
rs897792165 3688 dbSNP
rs1036868829 3689 dbSNP
rs944785908 3696 dbSNP
rs1213491293 3700 dbSNP
rs951581873 3705 dbSNP
rs1025754115 3707 dbSNP
rs192012138 3709 dbSNP
rs986586683 3712 dbSNP
rs963012288 3713 dbSNP
rs751983924 3716 dbSNP
rs1409097959 3717 dbSNP
rs1024278760 3719 dbSNP
rs1306762881 3720 dbSNP
rs1345162736 3725 dbSNP
rs1012257840 3727 dbSNP
rs896441294 3728 dbSNP
rs1373403281 3732 dbSNP
rs1302146355 3734 dbSNP
rs1386276243 3736 dbSNP
rs1389250604 3737 dbSNP
rs776839293 3738 dbSNP
rs1440366230 3743 dbSNP
rs1310284413 3744 dbSNP
rs1420787270 3746 dbSNP
rs1035144398 3747 dbSNP
rs1360322694 3747 dbSNP
rs1157161123 3749 dbSNP
rs1455316430 3751 dbSNP
rs1215008608 3758 dbSNP
rs1250523256 3760 dbSNP
rs1467649902 3763 dbSNP
rs572551574 3767 dbSNP
rs1377829920 3770 dbSNP
rs1197595722 3771 dbSNP
rs1157244761 3779 dbSNP
rs1407876759 3780 dbSNP
rs1430929169 3785 dbSNP
rs1167747489 3787 dbSNP
rs932609104 3788 dbSNP
rs903040278 3789 dbSNP
rs766906235 3794 dbSNP
rs1329751211 3796 dbSNP
rs763548828 3802 dbSNP
rs541941065 3804 dbSNP
rs1355858765 3813 dbSNP
rs374708151 3816 dbSNP
rs1271219626 3826 dbSNP
rs1333473408 3827 dbSNP
rs1487884745 3829 dbSNP
rs990048518 3832 dbSNP
rs186653016 3834 dbSNP
rs942419959 3839 dbSNP
rs1232601907 3848 dbSNP
rs1475749186 3852 dbSNP
rs1031309876 3857 dbSNP
rs771124414 3870 dbSNP
rs1190639350 3871 dbSNP
rs145305954 3877 dbSNP
rs546078096 3891 dbSNP
rs912205352 3892 dbSNP
rs1038078451 3904 dbSNP
rs1398898342 3907 dbSNP
rs1408353801 3914 dbSNP
rs977596707 3918 dbSNP
rs1328449376 3920 dbSNP
rs1375783045 3923 dbSNP
rs1256773385 3935 dbSNP
rs971121246 3936 dbSNP
rs1232682660 3937 dbSNP
rs1024513711 3942 dbSNP
rs772916092 3947 dbSNP
rs1291327469 3949 dbSNP
rs914516711 3951 dbSNP
rs1227504568 3953 dbSNP
rs765337034 3957 dbSNP
rs918312757 3981 dbSNP
rs1194822127 3994 dbSNP
rs181590175 3996 dbSNP
rs1340390276 4010 dbSNP
rs139725808 4010 dbSNP
rs974226026 4022 dbSNP
rs963170082 4027 dbSNP
rs1475203336 4031 dbSNP
rs894611093 4032 dbSNP
rs1374807024 4033 dbSNP
rs1028330697 4037 dbSNP
rs1436937172 4044 dbSNP
rs995071668 4055 dbSNP
rs960774586 4058 dbSNP
rs1374768938 4063 dbSNP
rs544025544 4064 dbSNP
rs1199026191 4065 dbSNP
rs376833328 4070 dbSNP
rs1324127251 4082 dbSNP
rs1226101894 4083 dbSNP
rs944820200 4092 dbSNP
rs1193689118 4094 dbSNP
rs1349669319 4100 dbSNP
rs1477490173 4101 dbSNP
rs902611596 4117 dbSNP
rs147772426 4118 dbSNP
rs5750172 4121 dbSNP
rs1206185913 4126 dbSNP
rs1264519701 4129 dbSNP
rs1445321315 4132 dbSNP
rs1011409201 4134 dbSNP
rs530507624 4136 dbSNP
rs1253855088 4138 dbSNP
rs1455798774 4139 dbSNP
rs1050430332 4146 dbSNP
rs892957737 4150 dbSNP
rs1172014743 4151 dbSNP
rs1394189427 4156 dbSNP
rs1039658048 4161 dbSNP
rs1442762792 4167 dbSNP
rs932494305 4175 dbSNP
rs761822009 4177 dbSNP
rs1007205909 4179 dbSNP
rs776875164 4183 dbSNP
rs890815369 4191 dbSNP
rs768767776 4194 dbSNP
rs1372541540 4196 dbSNP
rs1255154676 4208 dbSNP
rs1438185010 4213 dbSNP
rs1302264688 4214 dbSNP
rs929617273 4215 dbSNP
rs555457628 4216 dbSNP
rs535556234 4222 dbSNP
rs935913788 4223 dbSNP
rs1253161785 4235 dbSNP
rs924299792 4241 dbSNP
rs1038489340 4249 dbSNP
rs977108047 4253 dbSNP
rs1317904508 4256 dbSNP
rs941579764 4257 dbSNP
rs916729877 4258 dbSNP
rs971176845 4267 dbSNP
rs1419424700 4271 dbSNP
rs5750171 4272 dbSNP
rs1183788959 4281 dbSNP
rs1361987089 4283 dbSNP
rs991118147 4284 dbSNP
rs1165576710 4289 dbSNP
rs1395968660 4296 dbSNP
rs1341478997 4297 dbSNP
rs1024065377 4305 dbSNP
rs760406605 4306 dbSNP
rs1373668476 4317 dbSNP
rs928170914 4319 dbSNP
rs1393943908 4325 dbSNP
rs978092452 4330 dbSNP
rs1334358307 4331 dbSNP
rs566468818 4333 dbSNP
rs553052837 4338 dbSNP
rs1336993227 4341 dbSNP
rs958874997 4350 dbSNP
rs1421446042 4359 dbSNP
rs1265067390 4363 dbSNP
rs1167035915 4366 dbSNP
rs1481117551 4372 dbSNP
rs1022426441 4375 dbSNP
rs189531457 4378 dbSNP
rs570759829 4382 dbSNP
rs1185066384 4384 dbSNP
rs1472153498 4390 dbSNP
rs1011399667 4394 dbSNP
rs995522273 4395 dbSNP
rs1240256965 4399 dbSNP
rs183828929 4403 dbSNP
rs957256028 4404 dbSNP
rs1473926602 4409 dbSNP
rs11705413 4410 dbSNP
rs1015377948 4411 dbSNP
rs1354748357 4422 dbSNP
rs1008855705 4428 dbSNP
rs775256301 4432 dbSNP
rs1394723610 4433 dbSNP
rs1230533396 4434 dbSNP
rs1006701657 4453 dbSNP
rs1294414952 4455 dbSNP
rs891055618 4464 dbSNP
rs771925292 4472 dbSNP
rs1050936848 4473 dbSNP
rs1312009291 4478 dbSNP
rs996190839 4483 dbSNP
rs180683597 4488 dbSNP
rs1206827042 4494 dbSNP
rs1054280915 4502 dbSNP
rs1038157994 4504 dbSNP
rs941097502 4506 dbSNP
rs1259513737 4509 dbSNP
rs916781136 4510 dbSNP
rs1484688785 4511 dbSNP
rs144198954 4513 dbSNP
rs1181214233 4517 dbSNP
rs1055712867 4518 dbSNP
rs1331578014 4530 dbSNP
rs1429801701 4534 dbSNP
rs1445514068 4536 dbSNP
rs75941801 4539 dbSNP
rs924551004 4540 dbSNP
rs778734772 4551 dbSNP
rs1167832057 4556 dbSNP
rs939463956 4566 dbSNP
rs928203305 4567 dbSNP
rs548236818 4569 dbSNP
rs1397536974 4571 dbSNP
rs1041988347 4572 dbSNP
rs949710210 4573 dbSNP
rs1302795141 4580 dbSNP
rs1362699878 4582 dbSNP
rs770431976 4594 dbSNP
rs916892888 4595 dbSNP
rs1341791727 4613 dbSNP
rs1161313158 4614 dbSNP
rs370733197 4616 dbSNP
rs989603389 4621 dbSNP
rs1345486121 4633 dbSNP
rs958426830 4634 dbSNP
rs1471021633 4637 dbSNP
rs41283203 4638 dbSNP
rs189553844 4639 dbSNP
rs962481493 4640 dbSNP
rs1179531582 4642 dbSNP
rs1175138796 4656 dbSNP
rs1295029547 4656 dbSNP
rs1397214495 4657 dbSNP
rs1413150618 4669 dbSNP
rs1015183204 4672 dbSNP
rs1009074919 4683 dbSNP
rs954725236 4687 dbSNP
rs1287256201 4688 dbSNP
rs184776138 4695 dbSNP
rs996243210 4696 dbSNP
rs1007143782 4699 dbSNP
rs893881667 4703 dbSNP
rs1029574241 4706 dbSNP
rs866940932 4708 dbSNP
rs765114129 4711 dbSNP
rs1318723033 4718 dbSNP
rs896857151 4718 dbSNP
rs532676873 4719 dbSNP
rs1289749340 4726 dbSNP
rs1213035290 4727 dbSNP
rs1054738042 4729 dbSNP
rs1000037716 4730 dbSNP
rs1468552266 4735 dbSNP
rs150532024 4736 dbSNP
rs1310404859 4742 dbSNP
rs543765590 4744 dbSNP
rs1402884352 4745 dbSNP
rs1041671657 4750 dbSNP
rs574938015 4753 dbSNP
rs1305069689 4755 dbSNP
rs1436568401 4760 dbSNP
rs1462061795 4761 dbSNP
rs949924924 4764 dbSNP
rs916943578 4776 dbSNP
rs368807085 4779 dbSNP
rs371816163 4792 dbSNP
rs920358619 4793 dbSNP
rs780534588 4794 dbSNP
rs541944287 4795 dbSNP
rs962249716 4797 dbSNP
rs1042689448 4798 dbSNP
rs1450748501 4799 dbSNP
rs796749535 4801 dbSNP
rs945592775 4804 dbSNP
rs1233752790 4805 dbSNP
rs375466419 4806 dbSNP
rs1378689170 4809 dbSNP
rs367650148 4814 dbSNP
rs954944127 4815 dbSNP
rs943350013 4817 dbSNP
rs1167264661 4824 dbSNP
rs572725699 4826 dbSNP
rs996130110 4827 dbSNP
rs958241122 4830 dbSNP
rs1197415435 4834 dbSNP
rs1032436633 4835 dbSNP
rs1043123 4843 dbSNP
rs903034576 4849 dbSNP
rs193074709 4860 dbSNP
rs1281853900 4861 dbSNP
rs955244061 4864 dbSNP
rs1216331217 4875 dbSNP
rs552777231 4881 dbSNP
rs1355055129 4886 dbSNP
rs1029439923 4887 dbSNP
rs1214745540 4887 dbSNP
rs1439889396 4893 dbSNP
rs1351141550 4895 dbSNP
rs1203514969 4897 dbSNP
rs1280261109 4901 dbSNP
rs576785958 4903 dbSNP
rs1251713260 4907 dbSNP
rs771787876 4911 dbSNP
rs1219357257 4917 dbSNP
rs895729656 4920 dbSNP
rs1055679089 4923 dbSNP
rs1272506047 4925 dbSNP
rs1401779930 4926 dbSNP
rs937028915 4929 dbSNP
rs1341036460 4935 dbSNP
rs1297422001 4939 dbSNP
rs1417594790 4949 dbSNP
rs370281818 4952 dbSNP
rs567230055 4953 dbSNP
rs1427563765 4954 dbSNP
rs1016815525 4955 dbSNP
rs940416376 4957 dbSNP
rs1415220965 4958 dbSNP
rs1416481259 4960 dbSNP
rs1332141194 4963 dbSNP
rs908079646 4964 dbSNP
rs866171707 4965 dbSNP
rs1424561453 4972 dbSNP
rs1271550668 4973 dbSNP
rs557172563 4976 dbSNP
rs1226646974 4979 dbSNP
rs933612806 4985 dbSNP
rs1479123247 5000 dbSNP
rs922191582 5002 dbSNP
rs1213591050 5004 dbSNP
rs1254730595 5005 dbSNP
rs1441891562 5006 dbSNP
rs1194064549 5007 dbSNP
rs536955728 5012 dbSNP
rs1168211993 5013 dbSNP
rs1193447971 5023 dbSNP
rs1487500134 5024 dbSNP
rs1436390434 5026 dbSNP
rs761424513 5026 dbSNP
rs1210391383 5032 dbSNP
rs1170709370 5040 dbSNP
rs11542071 5041 dbSNP
rs1275961755 5042 dbSNP
rs1319799867 5046 dbSNP
rs548027879 5058 dbSNP
rs1433832615 5059 dbSNP
rs1303726569 5060 dbSNP
rs1372136573 5063 dbSNP
rs1235946377 5065 dbSNP
rs1318565227 5067 dbSNP
rs1345004975 5071 dbSNP
rs1206242644 5072 dbSNP
rs1277457836 5075 dbSNP
rs1270029827 5077 dbSNP
rs906722613 5079 dbSNP
rs1463654760 5080 dbSNP
rs1398012640 5082 dbSNP
rs1042597759 5084 dbSNP
rs945498462 5085 dbSNP
rs775733191 5086 dbSNP
rs61744622 5087 dbSNP
rs1449052469 5092 dbSNP
rs767281867 5093 dbSNP
rs537012179 5100 dbSNP
rs748696827 5107 dbSNP
rs565869048 5108 dbSNP
rs1467222044 5109 dbSNP
rs144766970 5118 dbSNP
rs369816045 5119 dbSNP
rs771500171 5122 dbSNP
rs1477089382 5136 dbSNP
rs1416427851 5137 dbSNP
rs972555857 5139 dbSNP
rs961195184 5140 dbSNP
rs1240450608 5143 dbSNP
rs1327203953 5145 dbSNP
rs1208131621 5146 dbSNP
rs1274053039 5148 dbSNP
rs895615335 5149 dbSNP
rs1182789927 5154 dbSNP
rs1034279170 5156 dbSNP
rs1266478305 5159 dbSNP
rs1001832784 5164 dbSNP
rs898852041 5174 dbSNP
rs774274454 5182 dbSNP
rs1183947406 5185 dbSNP
rs138989282 5195 dbSNP
rs1471988298 5197 dbSNP
rs1200034494 5199 dbSNP
rs866460474 5204 dbSNP
rs959326282 5206 dbSNP
rs1033326549 5207 dbSNP
rs1456122020 5216 dbSNP
rs1292561105 5220 dbSNP
rs1256820853 5221 dbSNP
rs1390518696 5224 dbSNP
rs1216732585 5225 dbSNP
rs1323375150 5228 dbSNP
rs886185387 5229 dbSNP
rs1227864550 5235 dbSNP
rs550441559 5242 dbSNP
rs551656971 5243 dbSNP
rs1227530053 5245 dbSNP
rs970477792 5251 dbSNP
rs1242941369 5252 dbSNP
rs34310596 5258 dbSNP
rs1020682836 5261 dbSNP
rs1480851796 5265 dbSNP
rs933499390 5266 dbSNP
rs1378774183 5274 dbSNP
rs1249540309 5278 dbSNP
rs1009741083 5283 dbSNP
rs749302912 5291 dbSNP
rs1054480843 5295 dbSNP
rs1401165116 5297 dbSNP
rs1163675367 5298 dbSNP
rs561447464 5299 dbSNP
rs373838355 5309 dbSNP
rs1170800559 5310 dbSNP
rs9610345 5327 dbSNP
rs1369089808 5329 dbSNP
rs1330692513 5336 dbSNP
rs889140807 5337 dbSNP
rs572694041 5339 dbSNP
rs370502120 5341 dbSNP
rs1352116780 5344 dbSNP
rs936901877 5345 dbSNP
rs1165974378 5346 dbSNP
rs1312301833 5349 dbSNP
rs925339095 5355 dbSNP
rs1308234409 5358 dbSNP
rs1230883282 5365 dbSNP
rs1423573368 5368 dbSNP
rs978492719 5369 dbSNP
rs1051735145 5370 dbSNP
rs1272286484 5384 dbSNP
rs1341170600 5393 dbSNP
rs1412007313 5393 dbSNP
rs772591081 5396 dbSNP
rs1439859157 5397 dbSNP
rs919343151 5402 dbSNP
rs1196198126 5405 dbSNP
rs1489463455 5407 dbSNP
rs769467467 5408 dbSNP
rs1451015413 5409 dbSNP
rs1036399648 5412 dbSNP
rs1388755879 5413 dbSNP
rs992214246 5414 dbSNP
rs14870 5425 dbSNP
rs1319728701 5426 dbSNP
rs984467195 5427 dbSNP
rs747780337 5433 dbSNP
rs1437612213 5440 dbSNP
rs1295640783 5443 dbSNP
rs188780133 5457 dbSNP
rs1311131815 5459 dbSNP
rs1242603789 5461 dbSNP
rs1364232772 5462 dbSNP
rs1234690936 5463 dbSNP
rs1280666370 5463 dbSNP
rs1310297536 5465 dbSNP
rs1377910657 5465 dbSNP
rs3177046 5466 dbSNP
rs1209329741 5467 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' cgaggacagguuGACCGAg 5'
                      |||||| 
Target 5' --------aggcCUGGCUa 3'
1 - 11
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 23543.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase "PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 23543.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000449924.2 | 3UTR | AGGCCUGGCUAUUGCAAUAUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000449924.2 | 3UTR | AGGCCUGGCUAUUGCAAUAUUUACUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714646
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repA
Location of target site ENST00000449924.2 | 3UTR | AGUUCAUGAGGCCUGGCUAUUGCAAUAUUUACUAGUAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714647
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repB
Location of target site ENST00000449924.2 | 3UTR | UCAUGAGGCCUGGCUAUUGCAAUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000449924.2 | 3UTR | AGGCCUGGCUAUUGCAAUAUUUACUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000449924.2 | 3UTR | AGGCCUGGCUAUUGCAAUAUUUACUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000449924.2 | 3UTR | UUCAUGAGGCCUGGCUAUUGCAAUAUUUACUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000449924.2 | 3UTR | UUCAUGAGGCCUGGCUAUUGCAAUAUUUACUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer -0.615 9.0e-5 -0.599 1.5e-4 32 Click to see details
GSE21687 Ependynoma primary tumors 0.438 1.5e-4 0.427 2.2e-4 64 Click to see details
GSE27834 Pluripotent stem cells -0.71 1.0e-3 -0.694 1.4e-3 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.522 4.4e-3 0.573 1.7e-3 24 Click to see details
GSE21032 Prostate cancer -0.227 2.0e-2 -0.234 1.7e-2 83 Click to see details
GSE19783 ER- ER- breast cancer 0.173 6.4e-2 0.160 7.9e-2 79 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.273 9.3e-2 0.310 6.6e-2 25 Click to see details
GSE19536 Breast cancer 0.133 9.4e-2 0.140 8.2e-2 100 Click to see details
GSE19350 CNS germ cell tumors 0.322 1.5e-1 0.245 2.2e-1 12 Click to see details
GSE28544 Breast cancer 0.187 1.9e-1 0.216 1.6e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.196 2.0e-1 -0.153 2.6e-1 20 Click to see details
GSE17498 Multiple myeloma -0.112 2.5e-1 -0.064 3.5e-1 40 Click to see details
GSE21849 B cell lymphoma 0.108 2.9e-1 0.500 2.9e-3 29 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.086 3.4e-1 0.019 4.6e-1 25 Click to see details
GSE38226 Liver fibrosis -0.046 4.2e-1 -0.088 3.5e-1 21 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.073 4.3e-1 -0.367 1.7e-1 9 Click to see details
GSE28260 Renal cortex and medulla 0.048 4.4e-1 -0.231 2.2e-1 13 Click to see details
GSE17306 Multiple myeloma -0.02 4.5e-1 0.064 3.3e-1 49 Click to see details
GSE14794 Lymphoblastoid cells -0.005 4.8e-1 0.057 3.0e-1 90 Click to see details
GSE19783 ER+ ER+ breast cancer 0.004 4.9e-1 -0.099 3.4e-1 20 Click to see details
GSE42095 Differentiated embryonic stem cells 0.002 5.0e-1 -0.137 2.7e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
114 hsa-miR-575 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054110 NCAPG non-SMC condensin I complex subunit G 1 1
MIRT054111 CDC45 cell division cycle 45 1 1
MIRT055398 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT062437 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 2 2
MIRT442670 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT443285 ZC3H12A zinc finger CCCH-type containing 12A 2 2
MIRT455302 BCL2L1 BCL2 like 1 2 2
MIRT457921 ZNF212 zinc finger protein 212 2 2
MIRT459272 ADRBK1 G protein-coupled receptor kinase 2 2 2
MIRT464099 VPS36 vacuolar protein sorting 36 homolog 2 2
MIRT467462 SNAPIN SNAP associated protein 2 2
MIRT469518 RBFOX2 RNA binding protein, fox-1 homolog 2 2 8
MIRT469951 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT473003 MRPS23 mitochondrial ribosomal protein S23 2 4
MIRT473372 MEF2D myocyte enhancer factor 2D 2 2
MIRT478148 DGKH diacylglycerol kinase eta 2 6
MIRT478957 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT479081 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT479810 CCNA2 cyclin A2 2 8
MIRT482602 ABHD14B abhydrolase domain containing 14B 2 2
MIRT484005 ATAD5 ATPase family, AAA domain containing 5 2 12
MIRT485431 KLF6 Kruppel like factor 6 2 2
MIRT489818 LSP1 lymphocyte-specific protein 1 2 4
MIRT492036 TSG101 tumor susceptibility 101 2 4
MIRT495228 SIK2 salt inducible kinase 2 2 4
MIRT496091 C17orf85 nuclear cap binding subunit 3 2 2
MIRT496848 KCNIP2 potassium voltage-gated channel interacting protein 2 2 2
MIRT499421 PLCG2 phospholipase C gamma 2 2 7
MIRT503095 BTG2 BTG anti-proliferation factor 2 2 2
MIRT503650 POLR2F RNA polymerase II subunit F 2 4
MIRT507549 DHX33 DEAH-box helicase 33 2 2
MIRT509096 SYNPO2L synaptopodin 2 like 2 4
MIRT511359 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 6
MIRT512883 PITX3 paired like homeodomain 3 2 2
MIRT513072 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT513109 DYNAP dynactin associated protein 2 2
MIRT515214 CRCP CGRP receptor component 2 2
MIRT516385 TRAF3IP2 TRAF3 interacting protein 2 2 4
MIRT520311 UBXN2A UBX domain protein 2A 2 2
MIRT521130 SHROOM4 shroom family member 4 2 2
MIRT522059 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT524422 CNKSR3 CNKSR family member 3 2 2
MIRT525154 ZNF329 zinc finger protein 329 2 2
MIRT525444 RBM23 RNA binding motif protein 23 2 2
MIRT528541 TTC22 tetratricopeptide repeat domain 22 2 2
MIRT530479 PPP1R3B protein phosphatase 1 regulatory subunit 3B 2 4
MIRT530562 AKNA AT-hook transcription factor 2 2
MIRT531815 POLD3 DNA polymerase delta 3, accessory subunit 2 2
MIRT542622 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT546419 SOWAHC sosondowah ankyrin repeat domain family member C 2 4
MIRT549552 CLPP caseinolytic mitochondrial matrix peptidase proteolytic subunit 2 2
MIRT550219 MAVS mitochondrial antiviral signaling protein 2 4
MIRT553804 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT560056 ZNF680 zinc finger protein 680 2 2
MIRT562254 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT563142 NOLC1 nucleolar and coiled-body phosphoprotein 1 2 2
MIRT563176 ZRANB3 zinc finger RANBP2-type containing 3 2 2
MIRT568016 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT571065 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT574904 Plcg2 phospholipase C, gamma 2 2 5
MIRT609813 RAD51 RAD51 recombinase 2 4
MIRT610521 HIAT1 major facilitator superfamily domain containing 14A 2 2
MIRT617055 ZNF677 zinc finger protein 677 2 2
MIRT617140 ZNF556 zinc finger protein 556 2 2
MIRT617409 API5 apoptosis inhibitor 5 2 2
MIRT617464 CCS copper chaperone for superoxide dismutase 2 2
MIRT619856 KIR3DX1 killer cell immunoglobulin like receptor, three Ig domains X1 2 2
MIRT623411 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT626140 SNRNP48 small nuclear ribonucleoprotein U11/U12 subunit 48 2 2
MIRT629672 USP1 ubiquitin specific peptidase 1 2 2
MIRT638942 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT644645 ICA1L islet cell autoantigen 1 like 2 2
MIRT646678 CCDC69 coiled-coil domain containing 69 2 2
MIRT651910 UEVLD UEV and lactate/malate dehyrogenase domains 2 2
MIRT653730 SLC25A32 solute carrier family 25 member 32 2 2
MIRT656115 MSRB3 methionine sulfoxide reductase B3 2 2
MIRT664191 MYOZ2 myozenin 2 2 2
MIRT664458 WDR92 WD repeat domain 92 2 2
MIRT670539 KIF1C kinesin family member 1C 2 2
MIRT671631 C20orf144 chromosome 20 open reading frame 144 2 4
MIRT677611 PRKX protein kinase, X-linked 2 2
MIRT679005 UBN2 ubinuclein 2 2 2
MIRT679185 XIAP X-linked inhibitor of apoptosis 2 2
MIRT679446 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT682791 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 2 2
MIRT683561 SMIM12 small integral membrane protein 12 2 2
MIRT685506 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT686196 ZNF516 zinc finger protein 516 2 2
MIRT687137 QPCTL glutaminyl-peptide cyclotransferase like 2 2
MIRT687724 KIAA1467 family with sequence similarity 234 member B 2 2
MIRT688416 DUSP2 dual specificity phosphatase 2 2 2
MIRT690611 DCTN3 dynactin subunit 3 2 2
MIRT692001 PTCD2 pentatricopeptide repeat domain 2 2 2
MIRT692719 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT694687 CD300LG CD300 molecule like family member g 2 2
MIRT697131 OTUD5 OTU deubiquitinase 5 2 2
MIRT699117 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT700235 RDH10 retinol dehydrogenase 10 2 2
MIRT701634 MYO10 myosin X 2 2
MIRT701703 MXD1 MAX dimerization protein 1 2 2
MIRT702778 IFNLR1 interferon lambda receptor 1 2 2
MIRT704347 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT706265 MKLN1 muskelin 1 2 2
MIRT707699 FAM118A family with sequence similarity 118 member A 2 2
MIRT708067 LIX1L limb and CNS expressed 1 like 2 2
MIRT708917 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT713012 BBX BBX, HMG-box containing 2 2
MIRT720318 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT722877 XPNPEP3 X-prolyl aminopeptidase 3 2 2
MIRT724847 MED28 mediator complex subunit 28 2 2
MIRT725149 SLC43A1 solute carrier family 43 member 1 2 2
MIRT736561 CDKN1B cyclin dependent kinase inhibitor 1B 3 0
MIRT736563 BRCA1 BRCA1, DNA repair associated 3 0
MIRT756052 EDN1 endothelin 1 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-575 4-hydroxynonenal NULL 5283344 Microarray human leukemic HL-60 cell 19022373 2009 down-regulated
miR-575 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-575 5-Fluorouracil approved 3385 Quantitative real-time PCR MCF-7 breast cancer cells 21506117 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-575 (1'S,2'S,11'R)-11'-phenylsulfanylspiro[1,3-dioxolane-2,10'-8-oxa-7-azatricyclo[7.4.0.02,7]tridecane]-13'-one 392646 NSC693225 sensitive
hsa-miR-575 (11E)-11-(2-aminoethylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 11452147 NSC725665 sensitive
hsa-miR-575 (11E)-11-(3-aminopropylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 9978660 NSC724562 sensitive
hsa-miR-575 (11E)-11-(4-aminobutylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027844 NSC727621 sensitive
hsa-miR-575 (11E)-11-(4-iodobutylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 5472476 NSC719211 sensitive
hsa-miR-575 (11E)-11-(6-aminohexylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 45027835 NSC727049 sensitive
hsa-miR-575 (11Z)-11-(5-bromopentylidene)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-19-one 5472472 NSC719162 sensitive
hsa-miR-575 (1R,12S)-20-[2-(dimethylamino)ethyl]-15,16-dimethoxy-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene-11,19-dione 45027831 NSC726770 sensitive
hsa-miR-575 (1R,2R,3E,7R,11E,13S,15S)-2,15-dihydroxy-7-(2-hydroxyethyl)-6-oxabicyclo[11.3.0]hexadeca-3,11-dien-5-one 71763189 NSC757946 resistant
hsa-miR-575 (1S,10R,12R,14R,15S)-15-hydroxyspiro[13,16-dioxapentacyclo[8.5.1.01,10.03,8.012,14]hexadeca-3,5,7-triene-11,3'-2,4-dioxatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene]-2,9-dione 388424 NSC683332 sensitive
hsa-miR-575 (1S,12R)-15,16-dimethoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene-11,19-dione 335395 NSC344505 sensitive
hsa-miR-575 (1Z)-2-anilino-N-[(5-carbamoyl-1H-imidazol-4-yl)amino]-2-oxoethanimidoyl cyanide 5466279 NSC683605 sensitive
hsa-miR-575 (2,3-dihydroxyphenyl)-[1-[(4-fluorophenyl)methyl]-4-hydroxyindol-3-yl]methanone 42624812 NSC746053 sensitive
hsa-miR-575 (2S,4S,5S,8R,11Z,15S)-8,28-dihydroxy-5-methyl-3-oxa-16-azaheptacyclo[15.12.0.02,4.02,8.04,15.018,27.020,25]nonacosa-1(29),11,17,20,22,24,27-heptaen-9,13-diyne-7,19,26-trione 54608726 NSC670656 sensitive
hsa-miR-575 (2z)-2-[(4z)-3-chloro-4-hydroxyiminocyclohexa-2,5-dien-1-ylidene]-2-(4-chlorophenyl)acetonitrile 5715133 NSC102225 sensitive
hsa-miR-575 (3-cyano-3,3-diphenylpropyl) 4-[3-[[(6aS)-2-methoxy-11-oxo-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-3-yl]oxy]propyl]piperazine-1-carbodithioate 45028821 NSC744469 sensitive
hsa-miR-575 (3e)-3-[(2-chloro-5-methoxy-6-methyl-1h-indol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471478 NSC711618 sensitive
hsa-miR-575 (3E)-3-[1-(4-chloroanilino)ethylidene]oxolan-2-one 820318 NSC680781 sensitive
hsa-miR-575 (3e)-5-methoxy-3-(pyridin-4-ylmethylidene)-1h-indol-2-one 24203974 NSC730294 sensitive
hsa-miR-575 (3e)-7-chloro-4-hydroxy-1-oxido-3-(p-tolylimino)quinoxalin-1-ium-2-carbonitrile 135457335 NSC693867 sensitive
hsa-miR-575 (3E,5E)-1-methyl-3,5-bis[(2-nitrophenyl)methylidene]piperidin-4-one;hydrochloride 5468196 NSC666038 sensitive
hsa-miR-575 (3E,5E)-3,5-bis[(3,4-dichlorophenyl)methylidene]-1-[3-(dimethylamino)propanoyl]piperidin-4-one;hydrochloride 5388808 NSC638645 sensitive
hsa-miR-575 (3E,5Z)-3,5-bis[(3,4-dimethoxyphenyl)methylidene]thian-4-one 6477009 NSC144310 sensitive
hsa-miR-575 (3z)-1-(2,6-dichlorophenyl)-3-[(4-hydroxy-3,5-dimethoxyphenyl)methylidene]indol-2-one 60147866 NSC752703 sensitive
hsa-miR-575 (4-nitrophenyl) (3E,5E)-3,5-dibenzylidene-4-oxopiperidine-1-carboxylate 5388007 NSC630608 sensitive
hsa-miR-575 (4S,9aR)-4-(4-fluoroanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-1-one 369962 NSC642329 sensitive
hsa-miR-575 (4z)-4-[(4-nitrophenyl)hydrazinylidene]pentanoic acid 6369925 NSC23936 sensitive
hsa-miR-575 (4Z)-4-[[1-(3-chlorophenyl)-3-(4-methoxyphenyl)pyrazol-4-yl]methylidene]-5-imino-1-phenylpyrazol-3-amine 135276800 NSC763587 sensitive
hsa-miR-575 (5E)-2-[(4-chloroanilino)methyl]-5-[(4-hydroxyphenyl)methylidene]cyclopentan-1-one 5930524 NSC639541 sensitive
hsa-miR-575 (5r,8ar,9r)-5-[(7,8-dihydroxy-2-propan-2-yl-4,4a,6,7,8,8a-hexahydropyrano[3,2-d][1,3]dioxin-6-yl)oxy]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-on 388573 NSC683584 sensitive
hsa-miR-575 (5s,5as)-5-[3-(dimethylamino)propylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 375034 NSC653860 sensitive
hsa-miR-575 (5S,8aR)-5-(4-aminoanilino)-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5H-[2]benzofuro[5,6-f][1,3]benzodioxol-8-one;hydrochloride 363647 NSC628676 sensitive
hsa-miR-575 (5s,8ar)-5-[(1-benzylpiperidin-4-yl)amino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one;hydrochloride 374331 NSC651855 sensitive
hsa-miR-575 (5s,8ar,9r)-5-[(3-fluorophenyl)methylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 369915 NSC642282 sensitive
hsa-miR-575 (6aS)-3-[3-[4-[(E)-3-(2-hydroxyphenyl)-3-oxoprop-1-enyl]-2-methoxyphenoxy]propoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 24863867 NSC744023 sensitive
hsa-miR-575 (6aS)-3-[4-[6-(4-fluorophenyl)-2-methylpyrimidin-4-yl]oxybutoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 405944 NSC723732 sensitive
hsa-miR-575 (9S)-7-(4,5-dihydroxy-6-methyloxan-2-yl)oxy-6,9,11-trihydroxy-9-(2-hydroxyacetyl)-4-methoxy-8,10-dihydro-7H-tetracene-5,12-dione 341996 NSC376739 sensitive
hsa-miR-575 (9S)-9-(2-bromoacetyl)-7-(3-fluoro-4,5-dihydroxy-6-methyloxan-2-yl)oxy-6,9,11-trihydroxy-8,10-dihydro-7H-tetracene-5,12-dione 6712216 NSC659949 sensitive
hsa-miR-575 (9S)-9-acetyl-7-(3-fluoro-4,5-dihydroxy-6-methyloxan-2-yl)oxy-6,9,11-trihydroxy-8,10-dihydro-7H-tetracene-5,12-dione 6712215 NSC659948 sensitive
hsa-miR-575 (E)-1-(7-fluoro-3-methylquinoxalin-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45029310 NSC746087 sensitive
hsa-miR-575 (E)-2-(3,4-dihydroxybenzoyl)-3-(1H-indol-3-yl)prop-2-enenitrile 5329275 NSC650934 sensitive
hsa-miR-575 (E)-3-(2-methoxyphenyl)-1-phenylprop-2-en-1-one 5383464 NSC636918 sensitive
hsa-miR-575 (E)-3-(3,4-dihydroxyphenyl)-N-[(8R,9S,13S,14S,17S)-3-methoxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl]prop-2-enamide 11546817 NSC734307 sensitive
hsa-miR-575 (E)-3-[3,5-bis(trifluoromethyl)phenyl]sulfanyl-1-(4-chlorophenyl)prop-2-en-1-one 6181983 NSC735169 sensitive
hsa-miR-575 (E)-3-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]-N-(4-chlorophenyl)-2-[[(E)-3-phenylprop-2-enoyl]amino]prop-2-enamide 5920449 NSC645665 sensitive
hsa-miR-575 (e)-3-chloro-2-(4-fluorophenyl)-3-(4-methoxyphenyl)prop-2-enal 5387394 NSC623173 sensitive
hsa-miR-575 (z)-1-(5-chloro-2-hydroxyphenyl)-3-quinolin-2-ylprop-2-en-1-one NSC71097 sensitive
hsa-miR-575 (z)-3-[[(4z)-4-(5,5-dimethyl-4-methyliminofuran-2-yl)imino-5,5-dimethylfuran-2-yl]amino]-4-hydroxy-4-methylpent-2-enenitrile NSC670995 sensitive
hsa-miR-575 .beta.-resorcylaldehyde, 2-pyridylhydrazone 135509512 NSC98572 sensitive
hsa-miR-575 [(1R,2R,3E,7S,11E,13S,15S)-15-hydroxy-7-methyl-5-oxo-6-oxabicyclo[11.3.0]hexadeca-3,11-dien-2-yl] (2R)-2-(dimethylamino)-3-methylbutanoate;hydrochloride 45028997 NSC745103 resistant
hsa-miR-575 [(1S)-2-amino-1-[(2S)-2-methyloxiran-2-yl]-2-oxoethyl] 3-methoxy-5-methylnaphthalene-1-carboxylate 9927456 NSC727012 sensitive
hsa-miR-575 [(1s,2r)-1-benzamido-3-[[(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-2-benzoyloxy-1,9-dihydroxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]heptadec-13-en-15-yl]oxy]-3-oxo-1- 16129931 NSC705435 sensitive
hsa-miR-575 [(1S,5Z,9S,10R)-12-oxo-11-azabicyclo[8.2.0]dodec-5-en-3,7-diyn-9-yl] acetate 5470109 NSC697685 sensitive
hsa-miR-575 [(3S,10R,13S,16E,17S)-16-[[4-(3-imidazol-1-ylpropoxy)-3-methoxyphenyl]methylidene]-10,13-dimethyl-3-pyrrolidin-1-yl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthren-17-yl] acetate 24204019 NSC730460 sensitive
hsa-miR-575 [(4S,5R,6S)-6-(2,2-diphenylcyclopentyl)oxy-2-oxido-4-phenyl-5,6-dihydro-4H-oxazin-2-ium-5-yl] acetate 395279 NSC699757 sensitive
hsa-miR-575 [(5S,8R,9S,10S,13S,14S,17S)-10,13-dimethyl-3-oxo-1,2,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-17-yl] N-(2-chloroethyl)-N-nitrosocarbamate 320803 NSC269721 sensitive
hsa-miR-575 [(6aS,11aR)-2,3,8-trimethoxy-6-methyl-5,11-dioxo-6a,11a-dihydroindeno[1,2-c]isoquinolin-9-yl] methanesulfonate 341886 NSC376254 sensitive
hsa-miR-575 [(9e,21z)-28-(1,3-dithiolan-2-yl)-2,29,31-trihydroxy-11-methoxy-3,7,12,14,17,17,20,24,32-nonamethyl-6,25-dioxo-8,16,18,33-tetraoxa-26-azapentacyclo[25.3.1.14,7.115,19.05,30]tritriaconta-1(30),2,4,9,21 54610764 NSC244404 sensitive
hsa-miR-575 [(e)-n-[(e)-[(2e)-2-[(z)-[(2-carboxyethylamino)-sulfaniumylmethylidene]hydrazinylidene]-2-phenylethylidene]amino]-c-methylsulfanylcarbonimidoyl]sulfanium;nickel 135484799 NSC630994 sensitive
hsa-miR-575 [[2-(3-anilino-3-oxopropanoyl)hydrazinyl]-[5-[(4-bromophenyl)diazenyl]-2-hydroxyphenyl]methyl]phosphonous acid 377948 NSC659616 sensitive
hsa-miR-575 [[5-[(4-bromophenyl)diazenyl]-2-hydroxyphenyl]-[2-[3-(2-chloroanilino)-3-oxopropanoyl]hydrazinyl]methyl]phosphonous acid 377940 NSC659608 sensitive
hsa-miR-575 [1-(4-butylphenyl)-2,5-dimethyl-4-(methylcarbamoyloxymethyl)pyrrol-3-yl]methyl N-methylcarbamate 321869 NSC276361 sensitive
hsa-miR-575 [1-methoxy-3-[methyl(octadecyl)amino]propan-2-yl] 2-(trimethylazaniumyl)ethyl phosphate 131972 NSC643827 sensitive
hsa-miR-575 [1,1'-binaphthalene]-2,2',3,3'-tetrol 316673 NSC245006 sensitive
hsa-miR-575 [10-[2-(diethylamino)ethylamino]-8-oxo-1,14,15-triazatetracyclo[7.6.1.02,7.013,16]hexadeca-2(7),3,5,9,11,13(16),14-heptaen-5-yl] ethyl carbonate 439022 NSC699148 sensitive
hsa-miR-575 [2-(4-methoxyphenyl)-4-thioxo-quinazolin-3-yl] acetate 389393 NSC685459 sensitive
hsa-miR-575 [2-[(2E)-2-[1-(2-hydroxyphenyl)-2-(3-oxo-1H-2-benzofuran-1-yl)ethylidene]hydrazinyl]-2-oxoethyl]-trimethylazanium;chloride 135483962 NSC647614 sensitive
hsa-miR-575 [2-[[5-(4-amino-2-oxopyrimidin-1-yl)-3-ethynyl-3,4-dihydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-3-octadecoxypropyl] [3-azido-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methyl hydrogen phosphate 403924 NSC719660 sensitive
hsa-miR-575 [2-[[5-(4-amino-2-oxopyrimidin-1-yl)-3-ethynyl-3,4-dihydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-3-octadecoxypropyl] [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 6712908 NSC719661 sensitive
hsa-miR-575 [3-(difluoromethyl)-6,7-dimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl]-phenylmethanone 54612713 NSC742327 sensitive
hsa-miR-575 [3-(furan-2-carbonyl)-2-thioxo-imidazolidin-1-yl]-(2-furyl)methanone 396757 NSC703467 sensitive
hsa-miR-575 [3-[(2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenoyl]oxy-5-(5-fluoro-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methyl (2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohe 5468409 NSC669728 sensitive
hsa-miR-575 [3-[(3E,5E)-3,5-dibenzylidene-4-oxopiperidin-1-yl]-3-oxopropyl]-trimethylazanium;bromide 5388801 NSC638635 sensitive
hsa-miR-575 [3-[[5-(4-amino-2-oxopyrimidin-1-yl)oxolan-2-yl]methoxy-hydroxyphosphoryl]oxy-2-hydroxypropyl] [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 397134 NSC704533 sensitive
hsa-miR-575 [3-[1,2-bis(propan-2-ylcarbamoyloxymethyl)-6,7-dihydro-5h-pyrrolizin-3-yl]pyridin-1-ium-1-yl]methyl cyclopropanecarboxylate;iodide 376916 NSC658093 sensitive
hsa-miR-575 [3-[4-[3-(fluoromethylsulfonyloxy)propanoyl]piperazin-1-yl]-3-oxopropyl] fluoromethanesulfonate 383018 NSC671002 sensitive
hsa-miR-575 [3-azido-5-(5-methyl-2,4-dioxopyrimidin-1-yl)oxolan-2-yl]methyl [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 392611 NSC693167 sensitive
hsa-miR-575 [3,4-dihydroxy-5-[4-(octadecylamino)-2-oxopyrimidin-1-yl]oxolan-2-yl]methyl [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 392613 NSC693169 sensitive
hsa-miR-575 [3,4-dihydroxy-5-[4-[[(z)-octadec-9-enyl]amino]-2-oxopyrimidin-1-yl]oxolan-2-yl]methyl [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] hydrogen phosphate 5468967 NSC680417 sensitive
hsa-miR-575 [4-[1,2-bis(propan-2-ylcarbamoyloxymethyl)-6,7-dihydro-5h-pyrrolizin-3-yl]pyridin-1-ium-1-yl]methyl octanoate;iodide 376936 NSC658103 sensitive
hsa-miR-575 [4-acetyloxy-6-[[(3S)-3-acetyl-3,5,12-trihydroxy-6,11-dioxo-2,4-dihydro-1H-tetracen-1-yl]oxy]-5-fluoro-2-methyloxan-3-yl] acetate 6712217 NSC659950 sensitive
hsa-miR-575 [5-(4-amino-2-oxopyrimidin-1-yl)-3-ethynyl-3,4-dihydroxyoxolan-2-yl]methyl [3,4-dihydroxy-5-[4-(octadecylamino)-2-oxopyrimidin-1-yl]oxolan-2-yl]methyl hydrogen phosphate 405222 NSC722308 sensitive
hsa-miR-575 [5-(4-amino-2-oxopyrimidin-1-yl)-3,4-dihydroxyoxolan-2-yl]methyl [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 398531 NSC708446 sensitive
hsa-miR-575 [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] (2e,4e,6e,8e)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenoate 5468408 NSC669727 sensitive
hsa-miR-575 [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-(hydroxymethyl)oxolan-3-yl] [5-[5-fluoro-4-(hexadecylamino)-2-oxopyrimidin-1-yl]-3-hydroxyoxolan-2-yl]methyl hydrogen phosphate 387052 NSC680420 sensitive
hsa-miR-575 [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-2-[[[5-[4-(hexadecanoylamino)-2-oxopyrimidin-1-yl]-2-(hydroxymethyl)oxolan-3-yl]oxy-hydroxyphosphoryl]oxymethyl]oxolan-3-yl] acetate 390212 NSC687369 sensitive
hsa-miR-575 [5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methyl (2-hydroxy-3-octadecoxypropyl) hydrogen phosphate 387050 NSC680418 sensitive
hsa-miR-575 [5-[2,4-dioxo-5-(trifluoromethyl)pyrimidin-1-yl]-3-(4-nitrobenzoyl)oxyoxolan-2-yl]methyl 4-nitrobenzoate 260750 NSC92423 sensitive
hsa-miR-575 [6,7-dimethyl-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-thiophen-2-ylmethanone 23635414 NSC729176 sensitive
hsa-miR-575 [7-chloro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-(furan-2-yl)methanone 23635647 NSC728078 sensitive
hsa-miR-575 [7-chloro-4-oxido-1-oxo-3-(trifluoromethyl)quinoxalin-1-ium-2-yl]-thiophen-2-ylmethanone 23635526 NSC728084 sensitive
hsa-miR-575 [8-methyl-7-(propan-2-ylcarbamoyloxymethyl)thieno[3,2-g]indol-6-yl]methyl n-propan-2-ylcarbamate 399552 NSC710416 sensitive
hsa-miR-575 0199ac 241506 NSC48956 sensitive
hsa-miR-575 1',3',9-trihydroxy-6'-methoxy-3-pentylspiro[6,7-dihydro-2h-cyclopenta[g]isoquinoline-8,2'-cyclopenta[b]naphthalene]-1,4',5',8',9'-pentone 135489797 NSC676769 sensitive
hsa-miR-575 1-(2-thiazoylazo)-2-naphthol 93572 NSC139021 sensitive
hsa-miR-575 1-(4-chlorophenyl)-3-[(E)-1-(1H-imidazo[4,5-b]pyridin-2-yl)ethylideneamino]thiourea 135424828 NSC674103 sensitive
hsa-miR-575 1-(4-nitrophenyl)-3-[(9e,12z)-octadeca-9,12-dienyl]urea 5356823 NSC67041 sensitive
hsa-miR-575 1-(8-(2,3-dimethoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl)piperidine 381369 NSC667909 sensitive
hsa-miR-575 1-(hydroxy(oxido)amino)-7-methoxy-9-((3-(methylamino)propyl)amino)acridine 384254 NSC673800 sensitive
hsa-miR-575 1-[(2r,6r)-6-methylpiperidin-2-yl]nonan-3-ol 370503 NSC643724 resistant
hsa-miR-575 1-[(z)-(5-chloro-2-hydroxyphenyl)methylideneamino]-3-[(e)-(5-chloro-2-hydroxyphenyl)methylideneamino]thiourea 135460243 NSC65022 sensitive
hsa-miR-575 1-[2-(2,4-dinitrophenyl)sulfonyl-1-methylene-allyl]sulfonyl-2,4-dinitro-benzene 361138 NSC623970 sensitive
hsa-miR-575 1-[4-[3-(4-chlorophenyl)-4h-indeno[1,2-c]pyrazol-2-yl]phenyl]sulfonyl-3-cyclohexylurea 24204755 NSC732737 sensitive
hsa-miR-575 1-[4-fluoro-3-(trifluoromethyl)phenyl]-6,6-dimethyl-1,3,5-triazine-2,4-diamine 425379 NSC173516 sensitive
hsa-miR-575 1-[5-(3,3-dimethyl-2-oxobutyl)-2,4,5-trihydroxyfuran-2-yl]-3,3-dimethylbutan-2-one 404260 NSC720438 sensitive
hsa-miR-575 1-[5-[[[4-chlorobutyl(2,3-dihydroxypropyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-4-hydroxyoxolan-2-yl]-5-fluoropyrimidine-2,4-dione 24205136 NSC734430 sensitive
hsa-miR-575 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-4-hydroxyoxolan-2-yl]-5-fluoropyrimidine-2,4-dione 404841 NSC721385 sensitive
hsa-miR-575 1-[bis(4,4'-aminophenyl)methylidenyl]-[3]ferrocenophane NSC754385 sensitive
hsa-miR-575 1-adamantyl-[3-(3-nitrophenyl)oxiran-2-yl]methanone 386283 NSC678040 sensitive
hsa-miR-575 1-allyl-3-[(z)-[1-(morpholinomethyl)-5-nitro-2-oxo-indolin-3-ylidene]amino]thiourea NSC716768 sensitive
hsa-miR-575 1-cyclopropyl-3-[4-[4-(cyclopropylcarbamoylamino)-3-methoxyphenyl]-2-methoxyphenyl]urea 334739 NSC341196 sensitive
hsa-miR-575 1-di(propan-2-yloxy)phosphoryl-n'-[4-[[di(propan-2-yloxy)phosphoryl-[2-(4-nitrophenyl)hydrazinyl]methylidene]amino]phenyl]-n-(4-nitroanilino)methanimidamide 3838849 NSC652151 sensitive
hsa-miR-575 10-methyl-7h-benzo[c]phenothiazine 237061 NSC40273 sensitive
hsa-miR-575 10,11-methylenedioxycamptothecin 72403 NSC634724 sensitive
hsa-miR-575 11-[(5E,7E,13E,19E,25S,29S)-29-hydroxy-3,15,17,21,23-pentamethoxy-5,12,18,24-tetramethyl-9,27-dioxo-10,26-dioxabicyclo[23.3.1]nonacosa-1(28),5,7,13,19-pentaen-11-yl]-4,10-dimethoxy-5,9-dimethyl-6-oxododecanoic acid 5470863 NSC705973 sensitive
hsa-miR-575 11-[2-(dimethylamino)ethyl]pyrido[2,3-b]acridine-5,12-dione 387193 NSC680734 sensitive
hsa-miR-575 11-hydroxy aclacinomycin a 438788 NSC670121 sensitive
hsa-miR-575 11-pyridin-2-yl-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 4595742 NSC686554 sensitive
hsa-miR-575 12-(1H-benzimidazol-2-ylmethyl)-3-oxa-12-azapentacyclo[11.8.0.02,11.05,10.014,19]henicosa-1(13),2(11),5,7,9,14,16,18,20-nonaen-4-one;hydrochloride 368107 NSC638441 sensitive
hsa-miR-575 14-fluoro-4-demethoxydaunorubicin 6711360 NSC623128 sensitive
hsa-miR-575 15-[2-(dimethylamino)ethyl]-10-[2-(2-hydroxyethylamino)ethylamino]-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2,4,6,9,11,13(17)-hexaene-8,14,16-trione;hydrochloride 392057 NSC691849 sensitive
hsa-miR-575 15-[2-(dimethylamino)ethyl]-10-[2-(dimethylamino)ethyl-methylamino]-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2,4,6,9,11,13(17)-hexaene-8,14,16-trione 392571 NSC693118 sensitive
hsa-miR-575 15-[2-(dimethylamino)ethyl]-10-[2-(dimethylamino)ethylamino]-5-methoxy-1,15-diazatetracyclo[7.7.1.02,7.013,17]heptadeca-2(7),3,5,9,11,13(17)-hexaene-8,14,16-trione;hydrochloride 392061 NSC691851 sensitive
hsa-miR-575 15,16-dimethoxy-20-(3-piperazin-1-ylpropyl)-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaene-11,19-dione;hydrochloride 16049841 NSC728316 sensitive
hsa-miR-575 15,16-dimethoxy-20-[3-(2-morpholin-4-ylethylamino)propyl]-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaene-11,19-dione 16090544 NSC725666 sensitive
hsa-miR-575 1h-1,2,4-triazole, 3-(4-diazo-4h-imidazol-5-yl)- NSC95448 sensitive
hsa-miR-575 1h-imidazole-4-carboxamide, 5-(3-methyl-1-tetrazenyl)- 135493930 NSC684047 sensitive
hsa-miR-575 1h-indole-3-methanol, 1-[(3-chlorophenyl)methyl]- 13288729 NSC743380 sensitive
hsa-miR-575 2'-bromo-4'-epi-daunorubicin 6711997 NSC650931 sensitive
hsa-miR-575 2-(1h-benzimidazol-2-yl)-3,4,5,6-tetrachloro-n-[3-chloro-2-[4-(dimethylamino)phenyl]-4-oxoazetidin-1-yl]benzamide 402413 NSC716344 sensitive
hsa-miR-575 2-(2-amino-6-phenylpyrimidin-4-yl)-4-methylphenol 386504 NSC678879 sensitive
hsa-miR-575 2-(2-ethyl-6-propan-2-ylanilino)-3-(4-methylpyridin-1-ium-1-yl)naphthalene-1,4-dione;perchlorate 24202023 NSC618659 sensitive
hsa-miR-575 2-(2,4-dichlorobenzoyl)-7-hydroxy-chromen-4-one 5465338 NSC646381 sensitive
hsa-miR-575 2-(5,11-dimethylpyrido[4,3-b]carbazol-6-yl)ethyl benzoate 294609 NSC163443 sensitive
hsa-miR-575 2-(7-amino-[1,2]thiazolo[4,5-d]pyrimidin-3-yl)-5-(hydroxymethyl)oxolane-3,4-diol 385012 NSC675865 sensitive
hsa-miR-575 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 sensitive
hsa-miR-575 2-[(2e)-2-[(5-bromo-2-hydroxyphenyl)methylidene]hydrazinyl]-4-methyl-1h-pyrimidin-6-one 135458781 NSC97960 sensitive
hsa-miR-575 2-[(4E)-4-(15,16-dimethoxy-20-methyl-19-oxo-5,7-dioxa-20-azapentacyclo[10.8.0.02,10.04,8.013,18]icosa-1(12),2,4(8),9,13,15,17-heptaen-11-ylidene)butyl]isoindole-1,3-dione 45027827 NSC726112 sensitive
hsa-miR-575 2-[(9-amino-5-methylacridine-4-carbonyl)amino]ethyl-dimethyl-[(5-nitrothiophen-2-yl)methyl]azanium;chloride 391703 NSC691247 sensitive
hsa-miR-575 2-[(e)-[[1-(4-chlorophenyl)-3-methylpyrazolo[3,4-d]pyrimidin-4-yl]hydrazinylidene]methyl]phenol 136040127 NSC753018 sensitive
hsa-miR-575 2-[(hexanoyloxy)methyl]-9-methoxy-5,11-dimethyl-6h-pyrido[4,3-b]carbazol-2-ium iodide 367403 NSC637127 sensitive
hsa-miR-575 2-[(Z)-3-(3-chloro-4-fluorophenyl)sulfanyl-3-(4-chlorophenyl)prop-2-enylidene]propanedinitrile 18527565 NSC735431 sensitive
hsa-miR-575 2-[[[4-chlorobutyl(methyl)amino]-[[5-(5-fluoro-2,4-dioxopyrimidin-1-yl)-3-hydroxyoxolan-2-yl]methoxy]phosphoryl]oxymethyl]-5-methoxy-1-methylindole-4,7-dione 404843 NSC721387 sensitive
hsa-miR-575 2-[[1-(chloromethoxy)-2-(dimethylamino)ethyl]amino]-n-[2-[[4-[2-[[2-[[1-(chloromethoxy)-2-(dimethylamino)ethyl]amino]-2-(sulfanylmethylamino)acetyl]amino]ethylamino]-5,8-dihydroxy-9,10-dioxoanthracen- 438971 NSC692228 sensitive
hsa-miR-575 2-[[1H-benzimidazol-2-ylmethyl(benzyl)amino]methyl]-6-[[bis(1H-benzimidazol-2-ylmethyl)amino]methyl]-4-methylphenol;hydrochloride 386989 NSC680300 sensitive
hsa-miR-575 2-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methyl-prop-2-ynylamino]benzoyl]amino]pentanedioic acid 135402053 NSC327182 sensitive
hsa-miR-575 2-[[4-[(2-amino-4-oxo-3H-quinazolin-6-yl)methylamino]benzoyl]amino]butanedioic acid 135443580 NSC173552 sensitive
hsa-miR-575 2-[[4-carboxy-4-[[4-[(2,4-diamino-5-methylpyrido[2,3-d]pyrimidin-6-yl)methylamino]benzoyl]amino]butyl]carbamoyl]benzoic acid 393599 NSC695788 sensitive
hsa-miR-575 2-[[amino-[bis(2-bromoethyl)amino]phosphoryl]oxymethyl]-5-methoxy-1-methylindole-4,7-dione 404935 NSC721513 sensitive
hsa-miR-575 2-[[amino-[bis(2-chloroethyl)amino]phosphoryl]oxymethyl]-5-methoxy-1-methylindole-4,7-dione 404936 NSC721514 sensitive
hsa-miR-575 2-[2-(dimethylamino)ethyl]-5-nitrobenzo[de]isoquinoline-1,3-dione 327044 NSC300288 sensi